ID: 1149536144

View in Genome Browser
Species Human (GRCh38)
Location 17:57435142-57435164
Sequence AACTTGGGGCTACTTTTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149536144 Original CRISPR AACTTGGGGCTACTTTTGAT GGG Intronic
902074744 1:13775292-13775314 AATCTGTGGCTTCTTTTGATGGG - Intronic
905150487 1:35923130-35923152 AGCCTGGGGCTACTGTTGCTGGG + Exonic
909809915 1:79919949-79919971 AACATGGGGATATTTTTTATGGG + Intergenic
910922570 1:92364940-92364962 AAGTTGGGGCCACTTCTGAAGGG - Intronic
911905457 1:103562739-103562761 AATGTGAGGCTACTTTGGATAGG + Intronic
916551658 1:165855705-165855727 AAGCTGGGGCTACCTGTGATGGG + Intronic
920250493 1:204619403-204619425 AACTTGGAGATACTCATGATTGG - Exonic
920987358 1:210902969-210902991 AAATAGGGGCTACTTTTGAAGGG - Intronic
923281920 1:232451416-232451438 AACTGGGGGCTGCTGTGGATGGG + Intronic
1063526748 10:6794298-6794320 AATTTGTGGCAACTTTTGTTGGG - Intergenic
1066685819 10:37980627-37980649 AAGATGGGGCTACTTTTGAGAGG - Intergenic
1070494184 10:77006389-77006411 AACATGGAGCTACTCTTCATGGG + Intronic
1070546415 10:77456361-77456383 GTCTGGGGGCTACTTTTGATGGG - Intronic
1073758293 10:106604187-106604209 AATTTGGTGATACTTTTGAGTGG + Intronic
1076279944 10:129237886-129237908 AATTTGGGGCTTCTATGGATGGG + Intergenic
1076395356 10:130134892-130134914 CACTTGGGGCTCCTTCTGACTGG - Intergenic
1076568700 10:131416928-131416950 AACTTGGAGCTACTGTGGAAAGG - Intergenic
1078674965 11:13402035-13402057 CACTGGGAGCTACTTTAGATTGG - Intronic
1082837563 11:57662800-57662822 GACTGGAGGCTACTTTAGATTGG + Intergenic
1088023265 11:105146160-105146182 AAATTGTGTCTATTTTTGATTGG - Intergenic
1091179819 11:133594391-133594413 AATTTGGGTCTGCTTGTGATAGG - Intergenic
1094586121 12:31778866-31778888 AACATTTGGCTACATTTGATTGG + Intergenic
1099331497 12:81294673-81294695 ACCTTGCTGCTACTTTTAATAGG - Intronic
1100794099 12:98162195-98162217 AAGTTGGGGCTACTTTATTTAGG - Intergenic
1105076032 13:16024147-16024169 AACTTCTGCCTACTTTTTATGGG - Intergenic
1105076622 13:16035905-16035927 AACTTCTGCCTACTTTTTATGGG - Intergenic
1105076819 13:16039824-16039846 AACTTCTGCCTACTTTTTATGGG - Intergenic
1105077242 13:16047657-16047679 AACTTCTGCCTACTTTTTATGGG - Intergenic
1105077651 13:16055483-16055505 AACTTCTGCCTACTTTTTATGGG - Intergenic
1105078245 13:16067055-16067077 AACTTCTGCCTACTTTTTATGGG - Intergenic
1105078648 13:16074716-16074738 AACTTCTGCCTACTTTTTATGGG - Intergenic
1105078835 13:16078459-16078481 AACTTCTGCCTACTTTTTATGGG - Intergenic
1105079045 13:16082378-16082400 AACTTCTGCCTACTTTTTATGGG - Intergenic
1105079237 13:16086120-16086142 AACTTCTGCCTACTTTTTATGGG - Intergenic
1105079434 13:16089863-16089885 AACTTCTGCCTACTTTTTATGGG - Intergenic
1105079642 13:16093784-16093806 AACTTCTGCCTACTTTTTATGGG - Intergenic
1105079837 13:16097526-16097548 AACTTCTGCCTACTTTTTATGGG - Intergenic
1105080048 13:16101440-16101462 AACTTCTGCCTACTTTTTATGGG - Intergenic
1105080460 13:16109274-16109296 AACTTCTGCCTACTTTTTATGGG - Intergenic
1109131485 13:58592011-58592033 AACTGTTGTCTACTTTTGATGGG + Intergenic
1109330428 13:60922433-60922455 AACTTGAGGATATTTTTTATTGG - Intergenic
1109349803 13:61164280-61164302 AACTTGTCACTACTTTGGATTGG - Intergenic
1109695732 13:65954559-65954581 TACTTGTGGCTACTTTAAATGGG + Intergenic
1110160234 13:72368196-72368218 AACTTGTGGCTACACTTGAGTGG - Intergenic
1110285524 13:73745750-73745772 ATCTTGGTGCTATTTTTGCTTGG - Intronic
1111143267 13:84150088-84150110 AACTTGGGACTACTGTTGGGGGG - Intergenic
1113272821 13:108693653-108693675 CACTTTGGGCTGCTGTTGATAGG + Intronic
1114261368 14:21039026-21039048 AACTTGGATCTGCTTTTGCTTGG + Intronic
1119836239 14:77751708-77751730 GAAAAGGGGCTACTTTTGATAGG + Intronic
1121416579 14:93783427-93783449 CACTTGGGGGTTCTGTTGATTGG + Intronic
1125057672 15:35381732-35381754 AGCTTGAGGCAACTTTTGTTGGG - Intronic
1125321164 15:38490750-38490772 AATTGAGAGCTACTTTTGATTGG + Intronic
1135738054 16:24949244-24949266 AACTTGGGGCTACTGGGAATGGG - Intronic
1142986428 17:3697802-3697824 GACTGGGGGCTACTTTGGGTGGG - Intergenic
1143528466 17:7485858-7485880 GAGGTGGGGCTACTTTAGATGGG + Intronic
1143641324 17:8199738-8199760 AACTTGGGGCAATTGGTGATTGG + Intergenic
1149536144 17:57435142-57435164 AACTTGGGGCTACTTTTGATGGG + Intronic
1153047670 18:871528-871550 AACTGAGAGCTACTTCTGATGGG - Intergenic
1166899439 19:46047787-46047809 AACTTTGGGCTTTTTTTGGTTGG - Intronic
1167395969 19:49229123-49229145 TAATTAAGGCTACTTTTGATGGG - Intergenic
925147824 2:1592670-1592692 TACTAAGTGCTACTTTTGATGGG - Intergenic
926313557 2:11693025-11693047 GACTTGGGCCCAGTTTTGATTGG + Intronic
926416070 2:12650968-12650990 AACTTGGGGCTGTGTTTGAAGGG - Intergenic
927305866 2:21572123-21572145 AAGTGGGGGCTACTTTAGATTGG - Intergenic
929344314 2:40862534-40862556 AACTTAGGGCTAATTTTCAGTGG - Intergenic
929972980 2:46599894-46599916 AAATTGGGGCTAGTTAAGATAGG - Intronic
931010655 2:57908933-57908955 AGGTTTTGGCTACTTTTGATTGG - Intronic
937836140 2:126471967-126471989 GACTTGGAGCCACTTCTGATGGG - Intergenic
939446628 2:142318436-142318458 AAATTGGGACCAGTTTTGATGGG + Intergenic
943317433 2:186407616-186407638 AAATTAGGGCTGCTTTGGATGGG - Intergenic
944882423 2:204026951-204026973 AACTTGTTGCTGCTTTTAATAGG + Intergenic
945862428 2:215139195-215139217 AACTTGGGGATAACTTTGAAAGG - Intergenic
946617236 2:221523246-221523268 AAGTAGGGGCTATTTTTAATTGG + Intronic
947591114 2:231386508-231386530 AACATGGGGAAACTTTTGGTGGG - Intergenic
947957538 2:234206448-234206470 AAGCTGGAGCTATTTTTGATTGG - Intergenic
1172551122 20:35800802-35800824 TACTTGGTGCTACTTTTGGAAGG - Intronic
1173901209 20:46590579-46590601 AATTTTGGGCAACTTTTCATAGG - Intronic
1176531779 21:7971144-7971166 AACTTCTGCCTACTTTTTATGGG + Intergenic
1176532181 21:7978970-7978992 AACTTCTGCCTACTTTTTATGGG + Intergenic
1176532392 21:7983053-7983075 AACTTCTGCCTACTTTTTATGGG + Intergenic
1176532601 21:7987136-7987158 AACTTCTGCCTACTTTTTATGGG + Intergenic
1176532813 21:7991220-7991242 AACTTCTGCCTACTTTTTATGGG + Intergenic
1176533019 21:7995134-7995156 AACTTCTGCCTACTTTTTATGGG + Intergenic
1176533239 21:7999382-7999404 AACTTCTGCCTACTTTTTATGGG + Intergenic
1176533440 21:8003297-8003319 AACTTCTGCCTACTTTTTATGGG + Intergenic
1176533647 21:8007212-8007234 AACTTCTGCCTACTTTTTATGGG + Intergenic
1176533854 21:8011126-8011148 AACTTCTGCCTACTTTTTATGGG + Intergenic
1176534259 21:8018952-8018974 AACTTCTGCCTACTTTTTATGGG + Intergenic
1176534573 21:8025246-8025268 AACTTCTGCCTACTTTTTATGGG + Intergenic
1176534745 21:8028485-8028507 AACTTCTGCCTACTTTTTATGGG + Intergenic
1176534919 21:8031724-8031746 AACTTCTGCCTACTTTTTATGGG + Intergenic
1176535122 21:8035639-8035661 AACTTCTGCCTACTTTTTATGGG + Intergenic
1176535317 21:8039550-8039572 AACTTCTGCCTACTTTTTATGGG + Intergenic
1176535508 21:8043293-8043315 AACTTCTGCCTACTTTTTATGGG + Intergenic
1182764298 22:32747443-32747465 CAATTGGGGCTGCTATTGATGGG + Intronic
1183002612 22:34874303-34874325 AAGTAGTGGCTACTTTAGATTGG + Intergenic
952233547 3:31455889-31455911 AAGTAGGGGCCACTCTTGATGGG + Intergenic
953364695 3:42333857-42333879 AAATGGGGGCCACTTTTGAGGGG - Intergenic
957370797 3:79291810-79291832 AACTTGGGGCCATTTATGGTGGG - Intronic
961154287 3:124665829-124665851 AAGTTGGGGGTACTATAGATAGG - Intronic
965933504 3:174076963-174076985 TACTTGGAGCTGCTTTGGATAGG - Intronic
969857449 4:10011591-10011613 AAATTCAGGCTACATTTGATTGG + Intronic
970165416 4:13232009-13232031 GACTTTGGGGTACTTTTGAAAGG - Intergenic
970196222 4:13552805-13552827 GACTTAAGGCTACTTTTCATGGG + Intergenic
970419501 4:15892044-15892066 ACTTTGGGGCTGCATTTGATGGG + Intergenic
972314667 4:37914894-37914916 AGTGTGGGGCTACTTTTGAGTGG - Intronic
974408100 4:61502158-61502180 TACCTGGGGCTCATTTTGATAGG + Intronic
974480030 4:62431322-62431344 AACTTGGGGTAACTTATGAATGG + Intergenic
977394236 4:96451260-96451282 AAGTTGCAGCTACTTTTGCTGGG + Intergenic
977706061 4:100071412-100071434 AAATTGGTGGTAATTTTGATTGG + Intergenic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
983760948 4:171405966-171405988 AAATTGTATCTACTTTTGATGGG + Intergenic
989866776 5:46522271-46522293 TGCTTGGGTCTACTTTTCATGGG - Intergenic
989867125 5:46527960-46527982 TGCTTGGGTCTACTTTTCATGGG - Intergenic
989867285 5:46530688-46530710 TGCTTGGGTCTACTTTTCATGGG - Intergenic
991635201 5:68697691-68697713 AACTTGGGCCAACTTGTGAAGGG + Intergenic
993249677 5:85503594-85503616 GACTTGGGGCTATCTCTGATTGG + Intergenic
994277308 5:97854850-97854872 AAGTTGCAGCTACTTTTGCTGGG - Intergenic
998511208 5:142715597-142715619 AACTCGTGACTACTTTTTATTGG + Intergenic
1004765294 6:18720170-18720192 AACAGTGGGCTACATTTGATTGG - Intergenic
1004901548 6:20199007-20199029 AACATTTGGCTACATTTGATTGG - Intronic
1006194515 6:32230447-32230469 ACTTGGGGGCTACTTTAGATTGG + Intergenic
1016011961 6:139146555-139146577 AAGTTCTGGCTATTTTTGATTGG + Intronic
1019441290 7:1048572-1048594 AACCCGGGGCTAACTTTGATAGG - Intronic
1028226405 7:88257098-88257120 TAGTTGGGGATACTTTTGAGAGG - Intergenic
1033878025 7:145845916-145845938 GTTTTGGGGCTAGTTTTGATTGG - Intergenic
1037196259 8:16194015-16194037 AATTTGGGGCATCTTTTGGTAGG - Intronic
1041347342 8:56913245-56913267 AAATTGCGGCTACATTTGAAGGG - Intergenic
1042013353 8:64276378-64276400 AACTTAGTGCTATTTTTAATTGG - Intergenic
1044250943 8:90003135-90003157 AACTTGAGGCTACATGTGCTAGG - Intronic
1046002688 8:108440995-108441017 ACCTAAGGGCTACTTTTTATTGG + Intergenic
1048683116 8:136868869-136868891 AACTTGGGCCTACTTGTGATTGG + Intergenic
1050998391 9:12248412-12248434 AACTGGGGGATACTTTTCAGCGG + Intergenic
1051049020 9:12909501-12909523 ATCTTGTGGCTAATTTTGCTAGG + Intergenic
1054928262 9:70610223-70610245 GATTTGGGGGTACTTTTGGTGGG - Intronic
1056447535 9:86680218-86680240 AACTTGCAGTTACTATTGATTGG + Intergenic
1060363924 9:122989684-122989706 ATCTGTTGGCTACTTTTGATTGG + Intronic
1203385140 Un_KI270438v1:31539-31561 AACTTCTGCCTACTTTTTATGGG - Intergenic
1199404251 X:147437464-147437486 AATTTGGGGCTATATTTGACAGG - Intergenic