ID: 1149536962

View in Genome Browser
Species Human (GRCh38)
Location 17:57440736-57440758
Sequence CAGGGTAAGGACTGAGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 482}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149536953_1149536962 13 Left 1149536953 17:57440700-57440722 CCCTGTGCATGGGTGTGGATGTG 0: 1
1: 1
2: 11
3: 75
4: 480
Right 1149536962 17:57440736-57440758 CAGGGTAAGGACTGAGGAGGTGG 0: 1
1: 0
2: 0
3: 43
4: 482
1149536952_1149536962 14 Left 1149536952 17:57440699-57440721 CCCCTGTGCATGGGTGTGGATGT 0: 1
1: 0
2: 1
3: 53
4: 447
Right 1149536962 17:57440736-57440758 CAGGGTAAGGACTGAGGAGGTGG 0: 1
1: 0
2: 0
3: 43
4: 482
1149536954_1149536962 12 Left 1149536954 17:57440701-57440723 CCTGTGCATGGGTGTGGATGTGA 0: 1
1: 1
2: 1
3: 37
4: 308
Right 1149536962 17:57440736-57440758 CAGGGTAAGGACTGAGGAGGTGG 0: 1
1: 0
2: 0
3: 43
4: 482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149536962 Original CRISPR CAGGGTAAGGACTGAGGAGG TGG Intronic
900151927 1:1182604-1182626 CTGGGTGGGGACTGAGGAGTTGG + Intronic
900437820 1:2639890-2639912 GTGGGTGAGGCCTGAGGAGGAGG + Intronic
900525483 1:3126388-3126410 CAGGGCAAGGCCGGAGGAGCTGG + Intronic
900743070 1:4342349-4342371 CAGGGCAGGGGCTGAGGAAGAGG + Intergenic
900773444 1:4563788-4563810 CAGGGAGAGGACCTAGGAGGAGG + Intergenic
900884551 1:5405184-5405206 CTGGGTGGGGACTAAGGAGGGGG - Intergenic
901167639 1:7231213-7231235 CCAGGCAAGGGCTGAGGAGGAGG + Intronic
901327296 1:8374881-8374903 CAGGGCCTGGACAGAGGAGGAGG - Intronic
901333932 1:8432249-8432271 CAGGGAAAGGAATCAGGATGGGG - Intronic
902235189 1:15052955-15052977 CACGGGAAGGAGTGAGGAAGAGG - Intronic
902838674 1:19062010-19062032 CAAGGGAAGGCTTGAGGAGGTGG - Intergenic
903801490 1:25971937-25971959 CTGGGTAAGGAGAGAGGTGGTGG + Intronic
904311618 1:29632863-29632885 CAGGAGGAGGACTGAGGAGATGG - Intergenic
904617522 1:31757971-31757993 GTGGGTAAGGGCTGAGGATGGGG + Intronic
904757064 1:32773757-32773779 CTGAGCAAGCACTGAGGAGGTGG + Exonic
905313634 1:37067504-37067526 CAGTGTCAGGACTGTGAAGGTGG - Intergenic
905946013 1:41902027-41902049 CTGGCTAAGAAGTGAGGAGGGGG + Intronic
906127751 1:43437899-43437921 GCAGGTAAGGTCTGAGGAGGGGG + Exonic
907283205 1:53363978-53364000 AAGGGTGGGGACTGGGGAGGAGG - Intergenic
907399666 1:54217098-54217120 CAGGGTCAGGACTGCGAAAGCGG + Intronic
907573573 1:55506014-55506036 CAGGGTAGGGAGTGAGGCAGAGG - Intergenic
912625046 1:111199604-111199626 CAAGGTAAGGACTGAAGGAGGGG - Exonic
912703452 1:111895203-111895225 CAGGGTGAGGACGGAGAGGGAGG + Intronic
914464450 1:147913727-147913749 CAGGGAAAGGAGAGAAGAGGAGG - Intergenic
915053513 1:153103142-153103164 CAGTGTTAGGAGTGAGCAGGTGG - Intronic
915283314 1:154837500-154837522 CAGGGTGAGGAACCAGGAGGAGG - Intronic
915308963 1:154997672-154997694 CAGTGTAAAGACTGAGGAGAGGG + Intergenic
915345706 1:155195833-155195855 CAGGGAAGGGTGTGAGGAGGAGG - Exonic
915592095 1:156876363-156876385 CAGGGACAGGACTGAGTTGGGGG - Intronic
915923730 1:159999475-159999497 CAGGGCATGGAAAGAGGAGGTGG - Intergenic
915932672 1:160069919-160069941 CAGGGTAGGGACTGAGGATCTGG + Intronic
917723716 1:177810817-177810839 GAGGGAAAGGACTGAGGGGCTGG + Intergenic
920069896 1:203295380-203295402 CAGAGTATGGACTGAGGAAAGGG + Intergenic
920159838 1:203988106-203988128 CAGGGTGAGGACGTGGGAGGAGG + Intergenic
920344652 1:205298491-205298513 CCGGGAAAGGGCTGAGGATGGGG + Intergenic
920692119 1:208155050-208155072 CTTGGAAAGGACAGAGGAGGAGG - Intronic
920936659 1:210441188-210441210 GAGGGTAAGGAATGAGGAACAGG + Intronic
921728875 1:218554483-218554505 GAGAGTGAGGAATGAGGAGGAGG - Intergenic
921969338 1:221129202-221129224 CATGGGAAGGAAGGAGGAGGAGG + Intergenic
922756364 1:228099310-228099332 GAGGGTGTGGACTGAGGTGGCGG - Intergenic
924504399 1:244667706-244667728 AAAAGTTAGGACTGAGGAGGGGG - Intronic
1062828223 10:587651-587673 CAGGGTCAGGGCTGAGGCAGTGG - Intronic
1062828247 10:587743-587765 CAGGGTCAGGGCTGAGGCAGTGG - Intronic
1062828271 10:587835-587857 CAGGGTCAGGGCTGAGGCAGTGG - Intronic
1062828295 10:587927-587949 CAGGGTCAGGGCTGAGGCAGTGG - Intronic
1062828319 10:588019-588041 CAGGGTCAGGGCTGAGGCAGTGG - Intronic
1062828343 10:588111-588133 CAGGGTCAGGGCTGAGGCAGTGG - Intronic
1062828367 10:588203-588225 CAGGGTCAGGGCTGAGGCAGTGG - Intronic
1063168698 10:3486793-3486815 CAGGGTGAAGTCTGAGGAGCTGG + Intergenic
1063368282 10:5504658-5504680 CAGGGTGAGGACTCGGAAGGTGG + Intergenic
1063475335 10:6323488-6323510 CAGGGTAAGAAGTGAGAAAGGGG - Intergenic
1063623369 10:7667648-7667670 CGGGGTGGGGACTGGGGAGGAGG - Intergenic
1063879970 10:10521077-10521099 CAGGGTCAGCACTGAGCAAGAGG + Intergenic
1064220514 10:13436754-13436776 CAGGGGTAGGGATGAGGAGGTGG - Intergenic
1067058532 10:43066006-43066028 CAGAGCAAGGGCTGAGGAGCTGG - Intergenic
1067346077 10:45440059-45440081 CAGGGCAAGGAGGGAAGAGGGGG + Intronic
1068569669 10:58615641-58615663 CAAGCTGAGGACTGAGGAGTGGG - Intronic
1068630239 10:59290553-59290575 CTGAGTAGGGTCTGAGGAGGAGG - Intronic
1069536406 10:69256885-69256907 CAGGGTTAGGGTTGTGGAGGTGG + Intronic
1070769947 10:79076388-79076410 CAGGGTGAGGACGAAGGATGGGG + Intronic
1070961545 10:80503258-80503280 CAGGGGGAGGACTGAGAAGCGGG + Intronic
1071289272 10:84176884-84176906 CTGGCTGAGGACTGTGGAGGTGG + Intronic
1071718427 10:88119948-88119970 CAGCAAAAGGACAGAGGAGGAGG + Intergenic
1072194940 10:93109463-93109485 CAGGCCAAGGACTGAGGGAGGGG - Intergenic
1072747489 10:97951136-97951158 CAAGGTATGGACAGAGGAGGTGG - Intronic
1073099246 10:100998337-100998359 CAGGGCAAGGCCAGAGGAGGGGG + Intronic
1073324045 10:102632302-102632324 CAGGGTAAGGCAGGAGGAAGTGG + Exonic
1073932749 10:108594993-108595015 CAGGGTCAGAACAGAGCAGGGGG + Intergenic
1074172682 10:110958783-110958805 CAGGGTAATGTCTGAGTAGCCGG - Intronic
1075151383 10:119935733-119935755 CATGGTAAAGACTGAGCAGCTGG + Intronic
1076065153 10:127442551-127442573 CAGGGAAAGGGCTTAGGTGGGGG + Intronic
1076196879 10:128524972-128524994 CTGGCTAAGGACTGAAGTGGGGG + Intergenic
1076224744 10:128764992-128765014 GGGGGTAAGGGCTGGGGAGGGGG + Intergenic
1076268717 10:129131951-129131973 CTGGGTAAGAACAGAGCAGGAGG + Intergenic
1076718785 10:132383398-132383420 CAGGTTGTGGACGGAGGAGGAGG - Intergenic
1076795466 10:132795859-132795881 CAGGGAGAGGACACAGGAGGAGG + Intergenic
1076909881 10:133381698-133381720 CAGGGTAAGGGCAGAGGCGGGGG - Intronic
1077521400 11:3037517-3037539 CAGGGAAAGGCCTGAGGAAGAGG + Intronic
1079426059 11:20343068-20343090 CAGGGTCAGGCCTGAAAAGGCGG - Intergenic
1079496066 11:21045656-21045678 AAAGGTAAGAAATGAGGAGGTGG - Intronic
1079695824 11:23481664-23481686 CAGGTTGAGGGCAGAGGAGGTGG - Intergenic
1080577735 11:33615244-33615266 CCTGGAAAGGACTGAGGAGCGGG - Intronic
1081147087 11:39575659-39575681 GAAGGGAAGGACTGAGAAGGAGG - Intergenic
1081574462 11:44310492-44310514 CAGTGGAAGGAGAGAGGAGGAGG - Intergenic
1082787091 11:57323301-57323323 CAGGATGGGAACTGAGGAGGTGG - Intronic
1082808346 11:57463795-57463817 CAGGGCAGGGACTGAGGGCGGGG + Intronic
1083356411 11:62069528-62069550 CAGGGAAATGAGTTAGGAGGAGG + Intergenic
1083398377 11:62406816-62406838 CAGGGAAAGGATAGAGGAAGAGG + Intronic
1083544630 11:63539024-63539046 TGGGGCAAGGTCTGAGGAGGAGG + Intronic
1084156426 11:67315607-67315629 CAGGGTATAGAGTGAGGAGGAGG - Intergenic
1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG + Intergenic
1084471760 11:69365746-69365768 GAGGGTGAGGAGTGGGGAGGAGG + Intronic
1084973890 11:72785895-72785917 CAGGGTTACCCCTGAGGAGGGGG - Intronic
1085217918 11:74848561-74848583 CTGGGTACGGACTGAGGCGGGGG + Intronic
1086392136 11:86375695-86375717 CAGGGTAAGTACTTTGGAAGGGG + Intronic
1086960744 11:92978134-92978156 GAGGGTGAGCACAGAGGAGGGGG + Intronic
1087677170 11:101176323-101176345 CATGGCAGTGACTGAGGAGGAGG + Intergenic
1088685992 11:112284941-112284963 CATAGTAAGGACTGAGAAGTGGG + Intergenic
1089496044 11:118909196-118909218 GAGGGGAAGGCCTGAGGAGGGGG + Intronic
1089610771 11:119667285-119667307 CTGGGTGAGAACCGAGGAGGGGG - Intronic
1090003936 11:122984121-122984143 AAAGATAAGGACGGAGGAGGCGG - Intergenic
1090057116 11:123432811-123432833 CGGGGTGGGGACTGAGGAGTAGG + Intronic
1090911317 11:131122019-131122041 CAGGGGAAGGATGGAAGAGGAGG + Intergenic
1091224664 11:133950272-133950294 CAGGGCAAGGTGTGAGGAGCAGG + Intronic
1092534165 12:9372071-9372093 CTGGGGGAGGAGTGAGGAGGAGG + Intergenic
1092769250 12:11881940-11881962 CAGGGGATGGGCTGAGGTGGGGG - Intronic
1094042523 12:26132904-26132926 CAGGGTGAGGGCTGAGGGGCTGG - Intronic
1095955601 12:47803979-47804001 CTGGGTAGGGACTGGGGAGGTGG - Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096979536 12:55720325-55720347 TGGGGATAGGACTGAGGAGGAGG - Intronic
1097140189 12:56896066-56896088 CAAGGTAAGGATGGTGGAGGAGG - Intergenic
1097145902 12:56939214-56939236 CAGGGCCAGGCCTGTGGAGGAGG - Intergenic
1097151463 12:56982752-56982774 CAGGGCCAGGCCTGTGGAGGAGG - Intergenic
1097927826 12:65149873-65149895 GATGGGAAGTACTGAGGAGGGGG - Intergenic
1098913612 12:76235246-76235268 CAGGCTTAGGCCTGATGAGGAGG - Intergenic
1100813678 12:98364794-98364816 CAGGGTGAGGACTGAGAAATAGG - Intergenic
1100891062 12:99126497-99126519 CAGGGTAAGGTGGGGGGAGGGGG - Intronic
1101484078 12:105133393-105133415 AAGGATAAGGACTGGGGTGGAGG - Intronic
1101907826 12:108840801-108840823 CAGGCTAAGCCCTGCGGAGGAGG + Intronic
1102177309 12:110885658-110885680 CAGGGTCAGGACTAATGAGCAGG - Intronic
1102228411 12:111245728-111245750 CAGGGTAGGGACAGAGGAAAAGG + Intronic
1102575468 12:113853607-113853629 CTGGGTAAAGAGAGAGGAGGTGG + Intronic
1102702632 12:114852799-114852821 GAAGGTAATGACTGAGAAGGTGG - Intergenic
1102798787 12:115713435-115713457 TGGGGAAAGGACTGAGAAGGTGG + Intergenic
1103056733 12:117827134-117827156 CATGGTAAAAACTGAAGAGGAGG + Intronic
1103629495 12:122248229-122248251 CAAGGGAAGGCCTGAGGAGAGGG - Intronic
1103945717 12:124525303-124525325 CAGGGTAGCTTCTGAGGAGGTGG - Intronic
1104179597 12:126365789-126365811 CAGGGTGAAGACTGAAGATGAGG + Intergenic
1105404427 13:20121566-20121588 CAGGGCAAGGTATGAGGTGGGGG + Intergenic
1106770489 13:32956889-32956911 CGTGGTAAGGACTGAGGATTAGG - Intergenic
1107879265 13:44818722-44818744 CAGGATATGGAGTGAGAAGGAGG - Intergenic
1108213232 13:48159037-48159059 GAAGGTGAGGACTGAGAAGGAGG + Intergenic
1108304022 13:49113037-49113059 GAGGGAAAGGACAGAAGAGGTGG - Intronic
1108982113 13:56527977-56527999 CAGGTTAAAAATTGAGGAGGGGG - Intergenic
1111205242 13:84999420-84999442 CAGGGGAAGTAGTGAGGAAGTGG + Intergenic
1111268322 13:85849452-85849474 CATGGGAAGGACTGTGTAGGAGG - Intergenic
1111942498 13:94625526-94625548 GAGGGTTAGAACAGAGGAGGGGG - Intronic
1112092013 13:96091616-96091638 CTGGGTCAGGACTGAGGAAGAGG - Intronic
1112200412 13:97268928-97268950 AAGGGAAAGGACGAAGGAGGGGG + Intronic
1112976860 13:105330419-105330441 CTGAGAAAGGAATGAGGAGGGGG + Intergenic
1113574991 13:111389057-111389079 CAGGGGAAGGACGCAGGGGGTGG + Intergenic
1113643175 13:111972857-111972879 CAAGGAGAGGACTGAAGAGGAGG + Intergenic
1114414747 14:22534346-22534368 CATGGTAGGGACTGAGATGGTGG - Intergenic
1114936900 14:27549524-27549546 CATGGGAAGGACTAAGAAGGAGG + Intergenic
1115258400 14:31427184-31427206 CAGAGCTAGGACTGAGGAGGAGG + Intronic
1115522948 14:34251592-34251614 CATGGTCAGCACTGAGGAGGTGG + Intronic
1115524105 14:34262312-34262334 CAGGGAATGGACTGAGGGGACGG + Intronic
1117228767 14:53693124-53693146 TAAGGTAAACACTGAGGAGGGGG + Intergenic
1118668236 14:68093851-68093873 CAGGGTATGTACTGAGGGGTAGG + Intronic
1119552245 14:75523384-75523406 CAAGGAAATGAATGAGGAGGTGG + Intronic
1121171042 14:91854760-91854782 CAGGGTATGGATTGTGGAAGTGG - Intronic
1121437201 14:93927688-93927710 GAGCGTGGGGACTGAGGAGGGGG + Intronic
1121577255 14:94998359-94998381 CAGGGGAAGGGCTGAAGAGCTGG - Intergenic
1123469774 15:20541374-20541396 CAGGGGCAGGACTTATGAGGGGG + Intronic
1123648289 15:22459325-22459347 CAGGGGCAGGACTTATGAGGGGG - Intronic
1123730052 15:23136360-23136382 CAGGGGCAGGACTTATGAGGGGG + Intronic
1123748222 15:23333842-23333864 CAGGGGCAGGACTTATGAGGGGG + Intergenic
1124220537 15:27846758-27846780 CAGGGAAAGGAATGGGGAGGAGG + Intronic
1124280586 15:28357694-28357716 CAGGGGCAGGACTTATGAGGGGG + Intergenic
1124302112 15:28553918-28553940 CAGGGGCAGGACTTATGAGGGGG - Intergenic
1125479183 15:40069108-40069130 GAGGCTTAGGCCTGAGGAGGGGG - Intergenic
1125548383 15:40525680-40525702 CAGGGTCAGCTCTGAGGAGCAGG - Intergenic
1126955326 15:53927310-53927332 CAGGGAATGGACTGGAGAGGAGG + Intergenic
1127828005 15:62722735-62722757 CAGGATATGGAAAGAGGAGGAGG - Intronic
1128096416 15:64959868-64959890 CAGGTTAAGAACTGAGGTGAAGG + Intergenic
1128258435 15:66214973-66214995 CATGGCAAGGGCTGAGGAGCAGG + Intronic
1128609529 15:69062902-69062924 TAGGGAAAGGAATGAGAAGGAGG - Intergenic
1130041769 15:80411053-80411075 AATGGTTAGGAGTGAGGAGGGGG - Intronic
1130085785 15:80777827-80777849 CATGGTGAGGACTGGGGAGAGGG + Intergenic
1130116961 15:81013775-81013797 CAGGCTGAGGACTGCGGAAGCGG - Intronic
1130128307 15:81113652-81113674 TAGGGTAAGGAGTGAGGAAAGGG + Intronic
1130688831 15:86062671-86062693 CAGGAGAAGGAAAGAGGAGGAGG - Intergenic
1131131696 15:89904563-89904585 CAGGGCCAGGAGAGAGGAGGGGG - Intronic
1132000793 15:98178207-98178229 CAGGAAGAGGACTGACGAGGAGG - Intergenic
1132113838 15:99121258-99121280 CAGGGCCAGCACTGTGGAGGGGG + Intronic
1132397228 15:101482766-101482788 CAGAATCAGGACTGAGCAGGTGG - Intronic
1132645311 16:996810-996832 CAGGGTCAGGGCTGGGGCGGGGG + Intergenic
1132668955 16:1094949-1094971 GAGGGGAGGGACTGAGAAGGAGG + Intronic
1132989858 16:2787028-2787050 CGGGGTGAGGATAGAGGAGGAGG - Intronic
1133002018 16:2856571-2856593 CAGGGTAAGGAAAGAGGGGGAGG - Intronic
1133140429 16:3739836-3739858 CAGGCCACGGTCTGAGGAGGTGG - Intronic
1133206697 16:4238359-4238381 CAGCCTATGGACTCAGGAGGGGG - Intronic
1133278401 16:4651619-4651641 AAGGGTGGGGACTGAGGAAGGGG + Intronic
1133596878 16:7302418-7302440 CGGGGTGAGCCCTGAGGAGGAGG + Intronic
1133933973 16:10254139-10254161 TAAGGGAAGGCCTGAGGAGGTGG - Intergenic
1134189188 16:12108244-12108266 AAGGGCCAGGACTGAGGTGGGGG + Intronic
1134381057 16:13726251-13726273 AAGGGTAAGGATTAAGGTGGAGG + Intergenic
1136556242 16:31009578-31009600 CAGGGGAAGGACTGCAGTGGAGG - Intronic
1136612064 16:31372297-31372319 CAGGATAAGAACTGCGGATGAGG + Intronic
1139601062 16:67987515-67987537 CAGAATAAGGACTGGGAAGGTGG + Exonic
1140128003 16:72133816-72133838 CTGGGTAAGGTCTCAGGAGTTGG + Intronic
1142138117 16:88460877-88460899 CAGGCTAAGGACTGAGGGATGGG + Intronic
1142290668 16:89192490-89192512 CAGGGGACGGCCTGGGGAGGAGG - Intronic
1142363266 16:89637145-89637167 CAGGGTCGGGGCTGCGGAGGTGG - Intronic
1142594439 17:1022691-1022713 CAGGGTGAGGGCTGGAGAGGCGG - Intronic
1142855884 17:2730022-2730044 GATGGGAAGGACTGGGGAGGTGG + Intergenic
1143709658 17:8725599-8725621 TAGGGGAAGGACAGAAGAGGGGG - Intergenic
1143760841 17:9102964-9102986 GAGGGTAGTGACTGTGGAGGAGG + Intronic
1144244869 17:13352931-13352953 CCAGGGAAGGACTGGGGAGGAGG - Intergenic
1144836701 17:18160089-18160111 AGGGGTCAGGCCTGAGGAGGTGG - Intronic
1145200628 17:20941731-20941753 CAGGGGCAGGACAGAGGAGTAGG - Intergenic
1145976873 17:28988868-28988890 CAGGGTTGGGACTCAGGATGGGG + Intronic
1146034132 17:29390930-29390952 GAGGGTGAGGAGTGAGGAGGAGG - Exonic
1146913779 17:36665182-36665204 TTGGGAAAGGACTGAGGAAGTGG + Intergenic
1147599787 17:41738677-41738699 CAGGGTCAGGCCAGGGGAGGGGG - Intergenic
1147990679 17:44330997-44331019 CTGGGTGTGGTCTGAGGAGGTGG + Intergenic
1148045464 17:44741276-44741298 GAAGGTAAAGGCTGAGGAGGGGG - Intronic
1148047750 17:44754210-44754232 CAGGGTCAGGTCTGATGAGGAGG + Intergenic
1148183519 17:45624298-45624320 CAGGGTTAGGGCTAAGGAGTGGG + Intergenic
1148265332 17:46221393-46221415 CAGGGTTAGGGCTAAGGAGTGGG - Intronic
1148683341 17:49486973-49486995 CAGGGCAAGGACACAGGTGGAGG - Intergenic
1148829796 17:50424312-50424334 CTGGGTAAGAATTGAGTAGGTGG - Intergenic
1149536962 17:57440736-57440758 CAGGGTAAGGACTGAGGAGGTGG + Intronic
1150131312 17:62670705-62670727 CAGGGTTAGGAGTTAGGAGCGGG + Intronic
1151029361 17:70718419-70718441 CAGGGTAAGGACTGAGACTGAGG - Intergenic
1151235225 17:72715080-72715102 CAGGGTCTGCACTCAGGAGGAGG + Intronic
1151936205 17:77263221-77263243 CAGGGGAGGGGCTGAGAAGGTGG + Intergenic
1152028080 17:77824635-77824657 CAGGGCCAGGAATGAGGAGAAGG + Intergenic
1152133428 17:78490836-78490858 CAGGGTGAGGACCTAGGAGGGGG + Exonic
1152190176 17:78883390-78883412 CAGGGTGAGGACAGAGGACTTGG + Intronic
1153028221 18:690069-690091 CAGGGCAAGGTGTGAGGAGGGGG - Intronic
1153254816 18:3160126-3160148 AAGGGAAAGGAAGGAGGAGGAGG - Intronic
1153361908 18:4207044-4207066 GTGGGTAAGCACTGAGGTGGAGG + Intronic
1153829436 18:8908563-8908585 CATGGCATGGACTCAGGAGGTGG + Intergenic
1154375218 18:13803413-13803435 CAGGGCAAGGAATCAGGTGGAGG + Intergenic
1155143708 18:23066350-23066372 CAGGTTGAGGAACGAGGAGGAGG - Intergenic
1155179595 18:23332378-23332400 TTGGGTAAATACTGAGGAGGGGG + Intronic
1155611275 18:27670595-27670617 CAGAGAAAGCACTGAAGAGGGGG + Intergenic
1157059591 18:44272353-44272375 CAGGGTAAGTACTAGGGAAGAGG + Intergenic
1157791219 18:50532894-50532916 CTGGGTAAGTGCAGAGGAGGAGG + Intergenic
1158158925 18:54457753-54457775 CAGGGCAATGACTGGGGAGGTGG + Intergenic
1158294723 18:55983251-55983273 CAGGGAAAGGACGGAAGAGTGGG - Intergenic
1158699749 18:59735314-59735336 CTGGGTCAGGACAGAGTAGGTGG + Intergenic
1160749521 19:727345-727367 CAGGGTCAGGATTGAGGTTGGGG - Intronic
1160809089 19:1005345-1005367 CAGGTTGAGGGCTGAGGAGTAGG - Exonic
1161467567 19:4440227-4440249 GAGGGTAAGCACTGACGTGGAGG + Intronic
1161554953 19:4935933-4935955 TAGGGGAGGGACTGAGGTGGAGG - Intronic
1161927627 19:7312986-7313008 CCGGGTAAAGACTGGGAAGGCGG - Intergenic
1162054177 19:8052960-8052982 AGTGGTAAGGACTGAGGAAGAGG - Intronic
1162099312 19:8330272-8330294 CAGGGGAAGGTCTGGAGAGGTGG + Intronic
1162124356 19:8491193-8491215 CAGGGTAAAGGCTGAGCCGGCGG - Intronic
1162737046 19:12752453-12752475 AAGGGTCAGGACTGAAGGGGTGG + Intronic
1163390410 19:17027017-17027039 CCGGGTAGGGGGTGAGGAGGCGG - Intergenic
1163695320 19:18760815-18760837 CTGGGAAAGGACAGAGGAGTTGG - Intronic
1163779541 19:19239352-19239374 GAGGGAAAGGAAGGAGGAGGAGG - Intronic
1164916068 19:32053228-32053250 GAGTGTAGGGTCTGAGGAGGTGG - Intergenic
1165066563 19:33232632-33232654 CAGGGCAAGGCCAGAGAAGGTGG - Intergenic
1165095591 19:33408098-33408120 AAGGGTAAGGACGGAGCAGTAGG + Intronic
1165956605 19:39505152-39505174 AGTGGTTAGGACTGAGGAGGGGG + Intronic
1166228932 19:41414300-41414322 CAGGGTTAGGACTCTGGAGGGGG + Intronic
1166930592 19:46299062-46299084 CAGGGTGAGGCCTGAGAATGGGG - Intronic
1167109239 19:47449188-47449210 GAGGGTAGGGAGTGAGGAGAGGG + Intronic
1167654721 19:50756103-50756125 CAGGGTGATGTCAGAGGAGGGGG - Intergenic
1167656400 19:50767182-50767204 CAGGGTGATGTCAGAGGAGGGGG - Intergenic
1167716286 19:51144562-51144584 GAGGGTGAGCACTGAGGAGCGGG - Exonic
1167721996 19:51185595-51185617 GAGGGTGAGCACTGAGGAGCGGG - Intergenic
1167762331 19:51457561-51457583 AAGGGTGAGCACTGAGGAGCGGG + Exonic
1168015042 19:53566161-53566183 CTGGGAGAGGACTGAGGAAGAGG - Intronic
925068680 2:950300-950322 CGGGGAAAGGTCTGAGGACGCGG + Intergenic
926618210 2:15020899-15020921 CAGAGTAAGCACTGAGTAAGTGG - Intergenic
927038465 2:19204506-19204528 CAGGACAAGGCCTGAGAAGGAGG + Intergenic
927207062 2:20617399-20617421 CTGGGTTAAGACGGAGGAGGAGG + Intronic
927880726 2:26688297-26688319 CAGGGTCAGGCCTGAGAAGGGGG - Intergenic
928979838 2:37126466-37126488 AAGGGAAAGGAGTGGGGAGGCGG - Intronic
929188543 2:39120261-39120283 CTGGGGAAGGGCTGGGGAGGCGG - Intronic
929399529 2:41563919-41563941 CAGGGTTGTGAGTGAGGAGGTGG - Intergenic
929444461 2:41991844-41991866 GAGGGGAAGGAGGGAGGAGGAGG + Intergenic
929745172 2:44649757-44649779 CAGGGTAAGGACAGGAGAGCAGG - Intronic
929942412 2:46344647-46344669 CAGGGCAAGTCCTGAGAAGGTGG + Intronic
930022367 2:47009145-47009167 CAGGGCAGGGCCTCAGGAGGAGG + Intronic
930094363 2:47555765-47555787 CAGAGTGAGGACTGAGCATGGGG + Intronic
930312097 2:49754935-49754957 CAGGGTAAGGTCTTAGGATAAGG - Intergenic
930674978 2:54190853-54190875 CTGGGTAAGGAATGAGTTGGGGG - Intronic
931187116 2:59963983-59964005 CAGGGGAAGGACAGATGAGAAGG + Intergenic
931529969 2:63202836-63202858 CAAGGGAAGGAAGGAGGAGGAGG - Intronic
931948121 2:67332872-67332894 CAGGCTAAGGGAGGAGGAGGAGG - Intergenic
934884653 2:98013965-98013987 CAGGACATGGACAGAGGAGGAGG + Intergenic
935054353 2:99552684-99552706 CAGGGGTAGAACAGAGGAGGAGG + Intronic
935680847 2:105635826-105635848 CAAGGGAAGGAATGAGCAGGTGG - Intergenic
935685378 2:105678225-105678247 AAGGGTAAGGGCTGAGGAGATGG + Intergenic
935725211 2:106018122-106018144 CAGGGCAAGGAGTGGGGAGTGGG + Intergenic
935805055 2:106737420-106737442 CAGGGGAAGGACCCAGTAGGAGG + Intergenic
936064735 2:109322124-109322146 AAGGGTAAGGAGTAAGGGGGAGG + Intronic
936233849 2:110726365-110726387 CTGGGGAAGGATTCAGGAGGTGG + Intergenic
936493969 2:113001634-113001656 CAGGGTTGGGGCTGGGGAGGTGG - Intergenic
938104711 2:128521875-128521897 CAGGGTAAGGACTCCAGGGGTGG + Intergenic
938186353 2:129235346-129235368 CTGGGTAAAGGGTGAGGAGGTGG + Intergenic
938316453 2:130332534-130332556 GCGGGCAAGGAGTGAGGAGGGGG - Intergenic
939665421 2:144945532-144945554 CTGGGTAAGTGCAGAGGAGGAGG - Intergenic
940099925 2:150023335-150023357 CAGGGTAATGCCTCAGAAGGTGG - Intergenic
941029246 2:160493211-160493233 CAGGGTCAGGCCTGGGGAGGGGG - Intronic
945313991 2:208350689-208350711 CAGGGTAGGGAGTGAGGGAGCGG + Intronic
947317863 2:228881445-228881467 AAGGAAAAGGACAGAGGAGGTGG + Intronic
948136270 2:235638745-235638767 CAGGCTGAGGCCGGAGGAGGAGG + Intronic
948486998 2:238287794-238287816 CAGGGTAAGGGATGACGAGTTGG - Intronic
948604043 2:239123516-239123538 CAGGCTCAGGATTGAGGAGATGG - Intronic
1168779592 20:477526-477548 CAGGGGCAGGATTGAGGTGGTGG - Intronic
1168980346 20:1998348-1998370 CTGGGTAAGGGCAGAGGAAGAGG - Intergenic
1169351428 20:4871355-4871377 CAGGGAAGGATCTGAGGAGGAGG + Intronic
1170571704 20:17636474-17636496 AAGGGTGAGGCATGAGGAGGGGG - Intronic
1170762548 20:19263618-19263640 CAGGGAAAGGAGAGAGGATGTGG - Intronic
1171447979 20:25218074-25218096 AAGGAGAAGGACAGAGGAGGCGG - Intronic
1171456661 20:25276291-25276313 GAGGGTAAGGAGGGAGGTGGGGG + Intronic
1171461572 20:25300935-25300957 CAGTGTGAGGACTGTGGAGAAGG - Intronic
1171973883 20:31581578-31581600 CAGGGAAGGGAGTGAGGGGGTGG + Intergenic
1172109090 20:32535022-32535044 CAGGGAAAGGAAGGAGGAGGTGG + Intronic
1173143173 20:40502614-40502636 CTGGGTGAGGAAGGAGGAGGGGG - Intergenic
1173183188 20:40820008-40820030 CAGGGCAATGACTTAGAAGGTGG + Intergenic
1174734262 20:52949996-52950018 AAGGGTAAGGGATGAGAAGGAGG - Intergenic
1174949647 20:55029885-55029907 CAGGAGCAGGACTGAGGGGGGGG + Intergenic
1175608024 20:60327562-60327584 CTGGGTAAGAAGTGAGGAAGTGG + Intergenic
1177180673 21:17741608-17741630 CAGGCTAAGGTGTGAGTAGGCGG + Intergenic
1178095921 21:29215630-29215652 CATTGTAAGGACTGAGAAAGAGG - Intronic
1178702500 21:34845384-34845406 TCGGGAAAGGATTGAGGAGGGGG - Intronic
1178819214 21:35960003-35960025 CTGCGTAGGGACTGAGGAGATGG - Intronic
1178842153 21:36146395-36146417 CAGCATCAGGACTGTGGAGGAGG + Exonic
1179544482 21:42105231-42105253 CAGGGTAGGGCCTGAGGTTGGGG + Intronic
1180040840 21:45278836-45278858 CAAGGAAGGCACTGAGGAGGAGG - Intronic
1181136271 22:20768753-20768775 CTGGGTAGGTGCTGAGGAGGTGG + Intronic
1181669761 22:24420595-24420617 CAAGGCCAAGACTGAGGAGGTGG + Intronic
1181998793 22:26903612-26903634 GAGGGAAAGGGCTGGGGAGGGGG + Intergenic
1182721729 22:32407459-32407481 AAGGGTTAGCACTGAGGGGGAGG - Intronic
1182735602 22:32530478-32530500 CAGGGTAGGAACTGAGAAGAGGG + Intronic
1182948192 22:34344797-34344819 CAGGGGAGGGACTGAGGGTGTGG + Intergenic
1183253477 22:36745955-36745977 AAGGGTGAGGACAGAGAAGGGGG + Intergenic
1183256721 22:36767135-36767157 CAAGGGAGGGACTGAGGAGGTGG - Intronic
1183529852 22:38347450-38347472 CAGGGCCAGGGGTGAGGAGGAGG + Intronic
1184019815 22:41813442-41813464 CCTGGTAAGGACTGGGGTGGAGG + Exonic
1184149670 22:42630850-42630872 CTGGGTCATGACTGTGGAGGGGG - Intronic
1184265958 22:43346134-43346156 CAGGGTATGGGCAGAAGAGGAGG - Intergenic
1184624626 22:45714962-45714984 TAGGGCAAGGACGGAGGAGAAGG - Intronic
949571167 3:5294581-5294603 AAGGGAAAGGACAGAGGAGAAGG - Intergenic
949988176 3:9555605-9555627 CAGGCTAAGCACTGGGGAGAAGG + Intergenic
950423264 3:12910933-12910955 CAGGGAAGGGACAAAGGAGGGGG + Intronic
950804860 3:15591432-15591454 CCGGGGAGGGAATGAGGAGGAGG - Intronic
951524452 3:23640243-23640265 GAGGGTAAGGAAGCAGGAGGTGG + Intergenic
951829610 3:26911367-26911389 CAAGGTGAGGACTCAGAAGGAGG + Intergenic
953033578 3:39193028-39193050 CAGGCTCAGAACAGAGGAGGAGG - Intergenic
953865594 3:46580520-46580542 CATGGTAAGGTATGGGGAGGGGG - Intronic
954263367 3:49455836-49455858 CAGGGTAAGGAATTGGGAGGAGG - Intergenic
954689005 3:52385986-52386008 CATGGTGAGCACTCAGGAGGTGG + Intronic
954901735 3:54025986-54026008 AAGGGCTTGGACTGAGGAGGAGG - Intergenic
956580658 3:70808536-70808558 CAGGGAGGGTACTGAGGAGGTGG + Intergenic
957142925 3:76384701-76384723 AAGGGTAAGTACTGAGGAGAGGG + Intronic
958674116 3:97244095-97244117 CAGTGTGAGGACTGTGGTGGAGG + Exonic
959651867 3:108758067-108758089 CAGGGTCTGGGCTGAGGATGTGG - Intergenic
960357189 3:116668035-116668057 CAGGGTAAGGAATAAGGAAGAGG - Intronic
960385833 3:117020686-117020708 CTGGGAAAGGACTGATGACGTGG + Intronic
961043251 3:123692322-123692344 CAGGGTCAGCCGTGAGGAGGAGG - Intronic
961112652 3:124298160-124298182 CAGGGTATGGAGCTAGGAGGAGG + Intronic
961235439 3:125362522-125362544 AAGGGTAAGGACTTTGGTGGGGG - Intronic
961414971 3:126750528-126750550 CAGGATAAGGACTGAGATGGAGG + Intronic
961672184 3:128541406-128541428 GAGGGTAAGGTCCGAGCAGGAGG - Intergenic
961820527 3:129573497-129573519 CAGAGTGAGGACAGAGGATGGGG + Intronic
962193209 3:133332936-133332958 CATGTTAGGGACTGAGGAGATGG - Intronic
962465161 3:135650704-135650726 CGGGGTAAAGTCTGTGGAGGAGG - Intergenic
963823433 3:149925058-149925080 GAGGGTGAGGACAGAGGAGGAGG + Intronic
964044642 3:152308509-152308531 CAGGGTATGCAGTGAGGAGCTGG + Intronic
964313024 3:155414407-155414429 CAGGGAAAAGACTCAGGAAGTGG + Intronic
964839779 3:160981059-160981081 CAGGGCAAGGAAGGAAGAGGAGG - Intronic
965046389 3:163584095-163584117 CAAGGTAGGGACTGAGTGGGAGG - Intergenic
966439418 3:179927288-179927310 CAGGGTAAAGACAGAGGCTGTGG + Intronic
966854356 3:184183991-184184013 CAGAGTAGGGACTGAGGCCGGGG - Exonic
966906017 3:184526141-184526163 CTGGGCACGGACTGAGGGGGAGG + Intronic
967478415 3:189946869-189946891 CAGGGTAGGGAATAAAGAGGAGG + Intergenic
968215879 3:196889887-196889909 CATGGTAAGGACTGAGTAGTTGG + Intronic
968757545 4:2424650-2424672 CAGGACAAGGACAGAGCAGGAGG - Intronic
969110998 4:4844229-4844251 AAGGGTTAAGGCTGAGGAGGAGG - Intergenic
969149843 4:5160281-5160303 CATGGTAAGCACTGAGTATGCGG - Intronic
969307735 4:6335456-6335478 CAGAGAAAGGAGTGAGCAGGGGG + Intronic
969652015 4:8473641-8473663 CACGGTAAGGAGGGAGGAGGCGG + Intronic
969926669 4:10592029-10592051 CAGGGCAGGGTCTGAGGAGGTGG - Intronic
970306279 4:14735485-14735507 CATGGTAAGGACTCAGAAGTTGG + Intergenic
971470314 4:27018028-27018050 GGGGGTAAGGTGTGAGGAGGGGG + Intronic
973946575 4:55962511-55962533 TAGGTTAAGGAGTGAGCAGGAGG - Intronic
974013644 4:56629608-56629630 CAGGGGAATGACTGGGTAGGAGG - Intergenic
974664609 4:64942056-64942078 CAAGGTGAGTACTTAGGAGGTGG - Intergenic
975515503 4:75243207-75243229 GAGGGTAAGGACTGAGTGGGAGG + Intergenic
976200133 4:82569877-82569899 CAGGGTAAAGACTGGGCAGTTGG - Intergenic
976527063 4:86105520-86105542 CAGGGTCTGGAATGAGGATGAGG + Intronic
977598428 4:98909887-98909909 CAGGGTAATCATGGAGGAGGCGG + Intronic
977891707 4:102319619-102319641 CAGGGGTAGGAGTGGGGAGGGGG - Intronic
978446662 4:108786942-108786964 CACGGTAAGGAGTGATGGGGTGG + Intergenic
979072280 4:116223098-116223120 CAGGATAAGATCTCAGGAGGTGG - Intergenic
979567998 4:122178656-122178678 CAGGATAAGGAATGTTGAGGAGG - Intronic
981187778 4:141824443-141824465 AAGGGAAAGGATTGAGGAAGTGG + Intergenic
981807725 4:148736013-148736035 TGAGGTAAGGAGTGAGGAGGTGG - Intergenic
982245286 4:153344737-153344759 CATGGTAAGGACTGAGGCTACGG + Exonic
982914022 4:161181960-161181982 CAGGGTCAGGAAAGAGGAAGTGG + Intergenic
983839323 4:172436855-172436877 CAGGTTATGGAATAAGGAGGGGG + Intronic
985126688 4:186701675-186701697 CAGGAGAAGGAATGTGGAGGAGG - Intronic
985677643 5:1240453-1240475 CAGGGGAGGAAGTGAGGAGGGGG - Intronic
985680853 5:1254897-1254919 CAGGCCAAGGGCTTAGGAGGAGG - Intronic
986054599 5:4123763-4123785 CAGTCTCAGGACTGAGCAGGAGG + Intergenic
986062058 5:4201174-4201196 CAGGGAAAGGTATGAGGAAGAGG - Intergenic
986155039 5:5165908-5165930 CTGAGTAAGGGCAGAGGAGGCGG - Intronic
987766706 5:22240955-22240977 AAGGGCAAGGAAGGAGGAGGAGG + Intronic
989608852 5:43272522-43272544 CAGGGGAAGGAAGGAGAAGGAGG + Intronic
989824763 5:45839645-45839667 GAGGGTAAGGGGTGAGGAGGTGG + Intergenic
990317067 5:54592768-54592790 TAGGGTAAGGACTCAGCAAGAGG - Intergenic
990446239 5:55896695-55896717 GAGGGGAGGGACTGGGGAGGGGG - Intronic
991347214 5:65682230-65682252 CAGGACAAGGGCTGATGAGGAGG + Intronic
991678158 5:69109582-69109604 CAGGGTTAAGAATGAGTAGGGGG - Intronic
992441446 5:76800970-76800992 CAGGGTAAGGAGAGAGAATGAGG + Intergenic
993072407 5:83181884-83181906 CAGGGTATGGACTGCTGAAGTGG + Intronic
993838555 5:92846970-92846992 CAGGGTAAGGGATGAGGACAGGG - Intergenic
994097523 5:95860327-95860349 TTGGGTGAGGACTGAGGAGAGGG + Intergenic
994775546 5:104032901-104032923 CAGGCTAAGGGAGGAGGAGGAGG - Intergenic
996025999 5:118646611-118646633 CAGGGTAAGGACATATGTGGCGG - Intergenic
996387591 5:122925245-122925267 GAGGGGAAGGAAGGAGGAGGAGG - Intronic
996618372 5:125469458-125469480 GAGGGTAAGGGTTGAGGTGGAGG - Intergenic
997566646 5:134892803-134892825 CAGGGAGAGGCCTGAGGAGAGGG + Intronic
998132659 5:139659241-139659263 CCGGGGAAGGACTGAGGTGGGGG + Intronic
998596586 5:143536676-143536698 TTGGGGAAGGACTGAGGAAGAGG + Intergenic
998758091 5:145402970-145402992 CAAGGCAAGCACTGAGGAGTTGG - Intergenic
1001073107 5:168604061-168604083 CAGTGTTAGGCCTGAGGAAGAGG + Intergenic
1002133906 5:177096782-177096804 CATGGTCAGGGCAGAGGAGGAGG - Intronic
1003153604 6:3572849-3572871 CAAGGGAAGGAGTGAAGAGGAGG - Intergenic
1003454049 6:6264143-6264165 CAGGATAACTACTCAGGAGGTGG - Intronic
1003624251 6:7727679-7727701 CAGGGGATGGAGTGAGGGGGTGG + Intronic
1003805273 6:9721126-9721148 CAGGTTAAGTACGGTGGAGGAGG - Intronic
1004979593 6:21008398-21008420 CAGGGTCAGGCCCGTGGAGGTGG + Intronic
1005968020 6:30741438-30741460 CAGGGAAAGAAAGGAGGAGGAGG + Intronic
1006131359 6:31871209-31871231 CAGGCTTTGGACAGAGGAGGAGG - Intronic
1006802164 6:36766152-36766174 CAGGGTCAGGTTTGGGGAGGTGG + Intronic
1006912096 6:37570121-37570143 CAGGGAAGAGACAGAGGAGGAGG + Intergenic
1007124825 6:39417171-39417193 CCAGGTTAGGACTAAGGAGGAGG - Intronic
1007173256 6:39879262-39879284 CAGGCAAAGGGCAGAGGAGGAGG - Exonic
1007740778 6:44008295-44008317 GAAGTAAAGGACTGAGGAGGGGG + Intergenic
1008902032 6:56631282-56631304 TAGGGTAGGGACTGATGAAGAGG + Exonic
1010703145 6:79077161-79077183 CAGTGCAAGGCCGGAGGAGGAGG - Intronic
1011041587 6:83035253-83035275 CAGGGTAAGGAGTGGGCAGCAGG - Intronic
1011962326 6:93106425-93106447 CAGGGTAAGGAGTCAGCAGATGG - Intergenic
1013308452 6:108871693-108871715 CTGGGGAAGCACTGAGGAGGGGG - Intronic
1013313254 6:108917396-108917418 GAAGGAAAGGACTGATGAGGTGG - Intronic
1014215472 6:118748772-118748794 CAGGGTAGGAACATAGGAGGTGG + Intergenic
1015106479 6:129542587-129542609 CAGGGAAAGGATTGGGGAGATGG - Intergenic
1016375611 6:143417677-143417699 AGAGGTAAGGACTGAGGAAGTGG - Intergenic
1016505617 6:144775868-144775890 GAGGGGAAGAGCTGAGGAGGGGG - Intronic
1016785349 6:148005495-148005517 CAGGGAAAGGAAAGAGGAGGAGG + Intergenic
1018982777 6:168613350-168613372 CAGTGTGAGGACAGAGGGGGCGG + Intronic
1021121274 7:16798398-16798420 CTGGGGAAGGACTGAGTTGGGGG + Intronic
1021558971 7:21949648-21949670 AAGGGCATGGAGTGAGGAGGTGG - Intergenic
1022021007 7:26399093-26399115 CTGGGGAAGGAAAGAGGAGGCGG - Intergenic
1022343008 7:29486304-29486326 CAGGGCAGGGAGTGAGGAGAGGG - Intronic
1023010008 7:35917913-35917935 CAGGATGAGGGGTGAGGAGGAGG - Intergenic
1024080823 7:45853666-45853688 CAGGATGAGGGGTGAGGAGGAGG + Intergenic
1025030325 7:55551644-55551666 CACGGTCAGGGCTGAGGTGGAGG + Intronic
1027432831 7:78132277-78132299 CAGGTTAAGCAGTTAGGAGGTGG - Intronic
1028607505 7:92671252-92671274 CACTGTAAGCACTGAGAAGGCGG + Intronic
1028995280 7:97093291-97093313 CAGGGACAGGCCTGGGGAGGTGG - Intergenic
1029034368 7:97503451-97503473 CAGGAGCAGGACCGAGGAGGGGG + Intergenic
1029168125 7:98610395-98610417 CAGGGTAAGCTTTGTGGAGGGGG + Intergenic
1029440681 7:100585225-100585247 CAGGCTTAGGAAGGAGGAGGAGG + Intronic
1031016703 7:116583219-116583241 CAGGGCAAAGAAAGAGGAGGAGG + Intergenic
1032045774 7:128606280-128606302 CAGAGTAAGGACTGAGTCTGTGG + Intergenic
1032262324 7:130347438-130347460 AAGGGAAAGGAATGGGGAGGGGG - Intronic
1032720912 7:134550291-134550313 CAGGGTAAGGGATGGGGATGAGG - Intronic
1033446367 7:141425829-141425851 CGGAGGTAGGACTGAGGAGGAGG + Intronic
1033621865 7:143069168-143069190 CAGGGTGAGGAATGAGAAAGAGG + Intergenic
1034307790 7:150059590-150059612 TAGAGGAAGGACAGAGGAGGAGG + Intergenic
1034512508 7:151547776-151547798 CCAGCTAAGGACTGAGGAGGGGG + Intergenic
1034777910 7:153848264-153848286 CGGGGTGAGGACTGGGGTGGGGG - Intergenic
1034799057 7:154041079-154041101 TAGAGGAAGGACAGAGGAGGAGG - Intronic
1035204178 7:157284060-157284082 CAGGGTGAGGACAGCGTAGGAGG + Intergenic
1035263103 7:157674166-157674188 CAGGGGAGGGAAGGAGGAGGCGG + Intronic
1035353255 7:158261308-158261330 CAGGGCAAGGAGTCAGGGGGAGG + Intronic
1035416890 7:158696730-158696752 AAGGGTGTGGACTTAGGAGGAGG - Intronic
1035902816 8:3476438-3476460 TAGGGTAAATACTTAGGAGGTGG + Intronic
1037055273 8:14432523-14432545 CAGGGTAAAGGGTGAGAAGGGGG + Intronic
1038084293 8:24176126-24176148 CAGGGTAAGGAATGGACAGGAGG - Intergenic
1038259749 8:25982432-25982454 AGGGGCAAGGAGTGAGGAGGAGG - Intronic
1038795238 8:30703782-30703804 CAGGGGAAGGAAGAAGGAGGAGG + Intronic
1039315212 8:36364263-36364285 CAGTGTAAGGAATGAGAAAGTGG + Intergenic
1039561024 8:38512629-38512651 GAGGGTAATGACTGAGGGGATGG + Exonic
1041300606 8:56407643-56407665 CAGGGTCAGGGTTGAGGTGGAGG - Intergenic
1042453408 8:68974446-68974468 CAGGCTAAGGGAGGAGGAGGAGG - Intergenic
1042683879 8:71416241-71416263 CAGAGCAAGGACTGCTGAGGAGG - Intronic
1043566923 8:81558931-81558953 CAGGGGAAGGACAGAGAAGGAGG + Intergenic
1044445272 8:92267937-92267959 GACAGTAAGGAGTGAGGAGGTGG + Intergenic
1044607245 8:94058125-94058147 CAGGGTCTGAACAGAGGAGGGGG - Intergenic
1045690971 8:104759443-104759465 CTGGCTAAGGACCGAGGAAGAGG + Intronic
1045803939 8:106134973-106134995 CAGGGTGTTGAGTGAGGAGGTGG + Intergenic
1048671019 8:136719918-136719940 CAGGGCTAGGGCTGAGGATGTGG - Intergenic
1048977552 8:139681457-139681479 CAGGGGAAGGAGTGAGAAGCTGG + Intronic
1049254127 8:141604910-141604932 GAGGGTCTGGAGTGAGGAGGGGG + Intergenic
1049473275 8:142785677-142785699 CAGGGTAAGGGCTGGCGGGGAGG + Exonic
1049694369 8:143976359-143976381 CAGGCCAAGGGCTAAGGAGGAGG + Intronic
1050857840 9:10384032-10384054 TAGTGCAGGGACTGAGGAGGAGG + Intronic
1051217842 9:14817753-14817775 CAGGGTAGGAACTGAGGTTGAGG + Intronic
1051502015 9:17788365-17788387 CAGGGCATGGACTGAGGGGCGGG + Intronic
1052822189 9:33146206-33146228 CAGCGGAAGGAGTGAGAAGGAGG - Intronic
1053037408 9:34836979-34837001 CTGGGGCAGGACTGAGGAGATGG - Intergenic
1053360902 9:37486120-37486142 CTGGGTAAAGACTGCGGAGCTGG + Exonic
1053418367 9:37961103-37961125 CAGGGTAAGCTTTGTGGAGGAGG - Intronic
1055781353 9:79824786-79824808 CAATGTAAGCACTGAGGAGAAGG + Intergenic
1056577468 9:87867467-87867489 CAGGGGAACCACTGAGGGGGCGG + Intergenic
1058787558 9:108405205-108405227 CAGGGTCTGCACTGAGTAGGTGG - Intergenic
1061395728 9:130342449-130342471 CTGGGGAGGGACTGGGGAGGTGG + Intronic
1061542132 9:131283079-131283101 CCGGGGAAGGACGGAGGGGGCGG + Intergenic
1061916846 9:133759850-133759872 GAGGGCAAGGACGGAGGAAGGGG + Intergenic
1062207777 9:135346803-135346825 GAGGGTGAGGCCAGAGGAGGAGG - Intergenic
1062240901 9:135537398-135537420 CAGGGCCAGGGCTGAGGATGTGG + Intergenic
1062271574 9:135712253-135712275 TAGTGTAAGGGCTGAGGAGAGGG + Intronic
1062439525 9:136563491-136563513 CTGGCTCTGGACTGAGGAGGTGG - Intergenic
1062511436 9:136908336-136908358 CAGGGAAAGGGCCGAGGGGGTGG - Intronic
1062634736 9:137484861-137484883 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1062634748 9:137484894-137484916 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1185449560 X:275222-275244 CAGGGGGAGGAAGGAGGAGGGGG + Intergenic
1186528500 X:10271450-10271472 CAGGGGCAAGACTGAGGCGGGGG + Intergenic
1186676855 X:11826921-11826943 CAGAGAAAGGTATGAGGAGGAGG + Intergenic
1188764624 X:34076347-34076369 CAAGGTAATGATTTAGGAGGGGG + Intergenic
1188981789 X:36733466-36733488 CAGGGGGAGGACTGGGTAGGGGG - Intergenic
1189313095 X:40033640-40033662 CAGGGCAGGGACAGAGGAGAGGG + Intergenic
1190756523 X:53406284-53406306 GACTGTATGGACTGAGGAGGAGG + Intronic
1192198776 X:69050260-69050282 CAGGGTAGAGACAGTGGAGGTGG + Intergenic
1192790026 X:74372409-74372431 GAGGGAAATGACAGAGGAGGAGG + Intergenic
1195527666 X:105910610-105910632 CAGGGCATGGAGTGAGGAGGTGG + Intronic
1196830308 X:119770795-119770817 AAAGTTAAGGACTGAGGAAGAGG - Intergenic
1197705937 X:129634515-129634537 CAGGGAAGAGGCTGAGGAGGAGG + Intergenic
1198267391 X:135022174-135022196 CCCGGTAATCACTGAGGAGGGGG + Exonic
1198686058 X:139229236-139229258 CAGGGGCAGGAATGAGGAGTGGG - Intergenic
1198871370 X:141179786-141179808 CAGTGTAAGGATTGAGGGGAGGG + Intergenic
1199320820 X:146436589-146436611 CAAAGGCAGGACTGAGGAGGAGG - Intergenic
1200043321 X:153385842-153385864 CAGGTGAAGGACTGAGGCTGAGG - Intergenic
1202085448 Y:21132209-21132231 CAGGGCAAGGAATGAGGAAAGGG + Intergenic