ID: 1149539193

View in Genome Browser
Species Human (GRCh38)
Location 17:57455891-57455913
Sequence TGTGCCTAACACCCACACGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149539193_1149539198 11 Left 1149539193 17:57455891-57455913 CCCGCGTGTGGGTGTTAGGCACA 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1149539198 17:57455925-57455947 CAAAGCTCTGGAGATGAATTGGG 0: 1
1: 0
2: 3
3: 26
4: 265
1149539193_1149539199 23 Left 1149539193 17:57455891-57455913 CCCGCGTGTGGGTGTTAGGCACA 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1149539199 17:57455937-57455959 GATGAATTGGGAAAGAAGTGTGG 0: 1
1: 0
2: 5
3: 40
4: 422
1149539193_1149539197 10 Left 1149539193 17:57455891-57455913 CCCGCGTGTGGGTGTTAGGCACA 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1149539197 17:57455924-57455946 ACAAAGCTCTGGAGATGAATTGG 0: 1
1: 0
2: 6
3: 38
4: 226
1149539193_1149539196 -1 Left 1149539193 17:57455891-57455913 CCCGCGTGTGGGTGTTAGGCACA 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1149539196 17:57455913-57455935 AGACTCTTTGGACAAAGCTCTGG 0: 1
1: 0
2: 2
3: 17
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149539193 Original CRISPR TGTGCCTAACACCCACACGC GGG (reversed) Intronic
900620553 1:3585117-3585139 TGTCACTCACACCCACACACAGG - Intronic
900620560 1:3585170-3585192 TGTCACTCACACCCACACACAGG - Intronic
900620565 1:3585229-3585251 TGTCACTCACACCCACACACAGG - Intronic
900620585 1:3585393-3585415 TGTCACTCACACCCACACACAGG - Intronic
900620592 1:3585448-3585470 TGTCACTCACACCCACACACAGG - Intronic
900620597 1:3585497-3585519 TGTCACTCACACCCACACACAGG - Intronic
900620609 1:3585596-3585618 TGTCACTCACACCCACACACAGG - Intronic
900620627 1:3585729-3585751 TGTCACTCACACCCACACACAGG - Intronic
900620632 1:3585778-3585800 TGTCACTCACACCCACACACAGG - Intronic
900620648 1:3585904-3585926 TGTCACTCACACCCACACACAGG - Intronic
902759439 1:18571633-18571655 TGTGCCTCACAGCCACTCCCAGG - Intergenic
903295207 1:22339302-22339324 TGTGCCTGACACCCTCACCCGGG + Intergenic
906057490 1:42928376-42928398 TGTGCCTGGCACTCACACACAGG - Intronic
913546296 1:119872075-119872097 TGTGCCTAACAGCCACAAACTGG + Intergenic
916078731 1:161218729-161218751 TGTGCCTACCTCCCCCACCCAGG + Intronic
917438395 1:175044177-175044199 TGTGCCTTACGCCGACACTCAGG - Intergenic
922701179 1:227762026-227762048 TGTGGCTACAACCCACACTCAGG - Intronic
1064363699 10:14688427-14688449 TGTGACTAATACACACACACAGG + Intronic
1076677609 10:132155538-132155560 TGGGCCTTACACCCCCACCCAGG - Intronic
1076791345 10:132778609-132778631 TGTGCCCAACACCCAGAGCCGGG + Intronic
1077248211 11:1549214-1549236 TGTGCCTCCCACCCCCAAGCAGG - Intergenic
1083620926 11:64049024-64049046 TCTGCCTATCACCCACACTCAGG - Intronic
1086308933 11:85514147-85514169 AGTGCCTAACAAACACACACAGG - Intronic
1088595753 11:111439043-111439065 TGTCCCGCACACCCACCCGCTGG + Intronic
1091719695 12:2803674-2803696 TGTCCCTAGCACCCACATGGAGG - Exonic
1091890625 12:4051398-4051420 TGTGCCTCCCACCCTCATGCTGG + Intergenic
1102862398 12:116347881-116347903 TGTGCCTGAGACCCAGAGGCTGG - Intergenic
1104802453 12:131563878-131563900 TGTCCCTAACACCCCCTCACAGG + Intergenic
1118952423 14:70446720-70446742 CGTGCCAAACACACACACACAGG - Intergenic
1123192620 14:106585826-106585848 TGTGCCAAACACACACATCCTGG + Intergenic
1134754100 16:16650874-16650896 TTTGCCTAACACCCATGTGCTGG + Intergenic
1137727606 16:50667640-50667662 GGTTCCCAACACCAACACGCTGG + Intronic
1142246965 16:88974699-88974721 TGTGCCTGACAGCCACACAGTGG + Intronic
1146005665 17:29159090-29159112 TGTGCCCACCACCCACAGGCTGG + Intronic
1149539193 17:57455891-57455913 TGTGCCTAACACCCACACGCGGG - Intronic
1156763283 18:40619821-40619843 CCTGCCTAAAACCCACACACTGG - Intergenic
1157327148 18:46677627-46677649 TGGCCCTAAGACCCACAGGCAGG + Intronic
1158877993 18:61751546-61751568 GCTGCCTATCACCCACACCCAGG - Intergenic
1159763039 18:72452514-72452536 TGTCACTCACACCCACACACAGG - Intergenic
1160811361 19:1014347-1014369 TGTGCCGCACTTCCACACGCAGG + Exonic
1162291156 19:9781587-9781609 TTTGCCTAACTTCCACAAGCAGG - Intronic
1164211155 19:23098472-23098494 TGTGCCAAACACCTAAACGATGG + Intronic
1168523027 19:57067746-57067768 TTTGCCTAACAACCACATGAAGG - Intergenic
927336291 2:21928473-21928495 TATGCCTATCACCCACAAGAGGG + Intergenic
936951075 2:117977911-117977933 TCTGACTAACACTCACAAGCCGG - Intronic
940825098 2:158402046-158402068 TGTACCTAATACCCATAGGCAGG + Intronic
943229140 2:185223125-185223147 TGTGACTAAAACACACACTCTGG + Intergenic
946303268 2:218839023-218839045 TCTGCCTCACACCCACACCCTGG - Intergenic
1169714804 20:8603428-8603450 TGATGCTAAAACCCACACGCTGG - Intronic
1170941311 20:20850193-20850215 TTTGCTTAACACTCACAGGCTGG + Intergenic
1175292711 20:57888612-57888634 TGACCCGAACACCCACATGCAGG - Intergenic
1176708034 21:10129419-10129441 TGTGCCTAACATCCACTAGTTGG + Intergenic
1176717910 21:10368777-10368799 TCTGCCTAACACGCACTCTCTGG - Intergenic
1178122826 21:29486319-29486341 TGAGCCTACCAGCCACACACAGG + Intronic
1180030143 21:45201206-45201228 TGTGTCTGACACCCTCTCGCTGG + Intronic
1180299137 22:11021683-11021705 TCTGCCTAACACGCACTCTCTGG - Intergenic
1185404922 22:50642322-50642344 TGGGACTAACACCCACAGTCAGG + Intergenic
952166657 3:30757047-30757069 TGTGACTACCACCAACACCCTGG - Intronic
952826823 3:37531248-37531270 TGTGCCTATCACCCTGACACAGG - Intronic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
954576116 3:51677284-51677306 GGCTCCTAACACCCACACACTGG - Intronic
961643289 3:128378696-128378718 TGTGCCTGACACCCCCAGGCTGG + Intronic
968644468 4:1732677-1732699 TGGGCCTGTCACCCTCACGCAGG + Intronic
969343313 4:6556019-6556041 TCTGCCCAGCACCCACAGGCAGG + Intronic
970990638 4:22209410-22209432 TGTGCTTCCCACCCAAACGCAGG - Intergenic
979218321 4:118192963-118192985 TGTCCCTAACACCCACATGGAGG + Intronic
985699316 5:1361060-1361082 TGTCCCAGACATCCACACGCAGG + Intergenic
997926665 5:138036442-138036464 TGTGTCTGACTCCCACAGGCTGG - Intronic
1001324937 5:170716426-170716448 TTTACCTAACATCCACAGGCAGG + Intronic
1012358571 6:98347856-98347878 TGTGCCTAAAACACACACTATGG + Intergenic
1018301035 6:162403331-162403353 TGTGCCTCACTCCCTCACCCGGG + Intronic
1021636475 7:22699119-22699141 TGTGCATGACACCCACTTGCTGG - Intergenic
1021863090 7:24926680-24926702 TCTGCCTAACATCCCCAGGCTGG + Intronic
1023350350 7:39314196-39314218 TGTGCTGGACTCCCACACGCCGG - Intronic
1034710654 7:153188683-153188705 TCTGCCTAACACTGACACTCTGG - Intergenic
1037220323 8:16511605-16511627 TGTGGTTAACCCACACACGCAGG - Intronic
1049154280 8:141057294-141057316 TGGGACTGACACCCACACTCTGG - Intergenic
1053760728 9:41348608-41348630 TGTGCCTAACATCCACTAGTTGG - Intergenic
1055635741 9:78276582-78276604 TGTGCACAACACCAACACACCGG + Intronic
1056689843 9:88798701-88798723 TGTGCCTGGCCCCCACAAGCAGG - Intergenic
1057383463 9:94588774-94588796 GGTGCCTGACACCCACTTGCGGG - Intronic
1061812147 9:133168447-133168469 TGTGGGAAACCCCCACACGCTGG - Intergenic
1202792797 9_KI270719v1_random:98388-98410 TGTGCCTAACATCCACTAGTTGG + Intergenic