ID: 1149539600

View in Genome Browser
Species Human (GRCh38)
Location 17:57459019-57459041
Sequence CCCTCTTTGTAAGAGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149539595_1149539600 20 Left 1149539595 17:57458976-57458998 CCTCGTCAGTGGTTGTTTTGCTG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1149539600 17:57459019-57459041 CCCTCTTTGTAAGAGCTGGATGG 0: 1
1: 0
2: 2
3: 4
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149539600 Original CRISPR CCCTCTTTGTAAGAGCTGGA TGG Intronic
900691926 1:3986175-3986197 GCCCCTGTGAAAGAGCTGGAGGG - Intergenic
902191912 1:14769657-14769679 CTCTGTTGGTAAGACCTGGAAGG - Intronic
903616275 1:24660474-24660496 CCATTTTTGTAATAGCAGGAAGG + Intronic
907516923 1:54998754-54998776 CCCTGTTTTCTAGAGCTGGAAGG + Intergenic
910712155 1:90193270-90193292 CCTTCTTTCAAAGAGCTGGCTGG - Intergenic
911058839 1:93730689-93730711 ACCTTTTAGTAAGTGCTGGAGGG + Intronic
913737273 1:121799305-121799327 CCCTCTTTCTAACATCTGCAAGG - Intergenic
913737358 1:121800275-121800297 CCCTCTTTCTAACATCTGCAAGG - Intergenic
913766367 1:122195594-122195616 CCCTCTTTCTAACATCTGCAAGG + Intergenic
917300359 1:173567746-173567768 CCTTCATTGAAAGGGCTGGAAGG - Intronic
920436807 1:205952234-205952256 CCCCCTCTCTAAGGGCTGGATGG + Intergenic
921839769 1:219815863-219815885 TCCTCCTTGTAAGCCCTGGAGGG + Intronic
924061672 1:240181494-240181516 CCTTCTTTGTATGAATTGGAAGG + Intronic
1063379316 10:5574550-5574572 CGTTCTCTGTAAGAGCTGGGGGG - Intergenic
1063590930 10:7394854-7394876 CCCTCTGTGTAACAGAGGGAGGG - Intronic
1064536617 10:16364006-16364028 GTCCCTTTGTCAGAGCTGGATGG - Intergenic
1065897058 10:30172702-30172724 CACTGTGTGTTAGAGCTGGAGGG + Intergenic
1071545156 10:86523103-86523125 TCCTCTTGGGAAGAGCTGCAGGG - Intergenic
1072660193 10:97359080-97359102 CCCTCTCTGAGAGAGCTGCAAGG + Intronic
1074688107 10:115978306-115978328 CCCTCTTTGTTTGAGTTGGTCGG + Intergenic
1077343967 11:2037962-2037984 GCCTCCTTGGTAGAGCTGGAGGG - Intergenic
1078551055 11:12280925-12280947 GACTCTGTGTCAGAGCTGGAAGG - Intronic
1079844990 11:25454214-25454236 CCATCTTGGTAAGAGCTAAAGGG - Intergenic
1080827825 11:35862568-35862590 CCCTCTTTGTTGGAGCTAAAAGG - Intergenic
1086940852 11:92796918-92796940 CCCACTTTGATAGAGCTGGCAGG - Intronic
1089313282 11:117574044-117574066 CCCTCATTCTAGGAGCTGGATGG + Intronic
1202826953 11_KI270721v1_random:93151-93173 GCCTCCTTGGTAGAGCTGGAGGG - Intergenic
1093862926 12:24189913-24189935 CCCCTATTGTAAGAGCTGCAGGG - Intergenic
1094140904 12:27181387-27181409 CCCTCCTTGTCAGACCAGGATGG + Intergenic
1095059662 12:37667418-37667440 CCCTTTTTGTAAAATCTGCATGG - Intergenic
1100586550 12:95985963-95985985 CTCTCTGTGGAAGAGGTGGAGGG + Exonic
1100785113 12:98070622-98070644 ACATCATTGTGAGAGCTGGAAGG - Intergenic
1104634025 12:130426667-130426689 CCCTGTTGCTAAGAGGTGGAGGG + Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1106303466 13:28490194-28490216 CACACGTTGTAAGAGCTAGATGG - Intronic
1106626246 13:31423809-31423831 CCCTATTTGTAAAATCTTGAAGG + Intergenic
1108359250 13:49654038-49654060 ATCTCTTTTTAAGAGCTGGGAGG + Intergenic
1113999938 14:18225132-18225154 CTCTCTTTGTAGGATCTGCAAGG - Intergenic
1115954235 14:38759876-38759898 ACGTCTTTCTCAGAGCTGGATGG - Intergenic
1117918710 14:60705415-60705437 CCCTATTTGTAAGTGCAGCAGGG - Intergenic
1123970589 15:25504447-25504469 CTCTCTTTGTCATTGCTGGAGGG + Intergenic
1126242371 15:46460020-46460042 GCCTCTTCCTAAGATCTGGAAGG - Intergenic
1126819802 15:52491171-52491193 CCTTTTTTGAAACAGCTGGATGG - Intronic
1127682379 15:61310351-61310373 CACTCTTTTTAATAGCTGCATGG + Intergenic
1128086780 15:64892071-64892093 CCCTTTCTGTAAAAGCAGGAGGG - Intronic
1130031216 15:80316135-80316157 CCCTAAATGTCAGAGCTGGAAGG + Intergenic
1134036937 16:11038122-11038144 GCCTCTTTCTGGGAGCTGGAAGG + Intronic
1134348398 16:13413362-13413384 CCTTGTTTTTAAGAGCAGGAAGG - Intergenic
1135107272 16:19661187-19661209 CCCTCTTTGTAATGGCTGTTTGG + Intronic
1136053578 16:27671393-27671415 CATTCTTTGTAAGAGCTGCCTGG + Intronic
1139009781 16:62617466-62617488 CTCCCTTTGCAAGAGCAGGAAGG + Intergenic
1142040081 16:87887707-87887729 TCCTCCTTGTAAGAACTGGCGGG - Exonic
1143720023 17:8802931-8802953 CCCTGGTTTTAAGGGCTGGATGG + Exonic
1149539600 17:57459019-57459041 CCCTCTTTGTAAGAGCTGGATGG + Intronic
1149785875 17:59434471-59434493 CCCTCCTTGTAACACCTGGCAGG - Intergenic
1151653457 17:75484326-75484348 CCCTCCCTGACAGAGCTGGAAGG + Intronic
1157685959 18:49642739-49642761 CCTTCTTTCTTAAAGCTGGATGG + Intergenic
1159697449 18:71577944-71577966 CCCCCCTTGTAAGAGGTGGGGGG + Intergenic
1166582871 19:43918086-43918108 CTCTCTTTGGAAGAGGTGGATGG + Intronic
1168012842 19:53547365-53547387 CCTTCTTTATAAAGGCTGGATGG + Intronic
925012222 2:494886-494908 CCCTCTTTCTCAGAGAAGGAGGG + Intergenic
927380511 2:22474808-22474830 TCCTCTTTATAAGAGCTGCTAGG + Intergenic
929134644 2:38611853-38611875 GCCTCTATGTAAGATCCGGAAGG - Intergenic
929805439 2:45140828-45140850 CCCTCTTTGAAAGAACAGCAAGG + Intergenic
931722360 2:65076456-65076478 CCCACTTTGTGACAGCTGTATGG - Intronic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934615367 2:95767431-95767453 CACTCTTAGTAAGAGTTTGATGG + Intergenic
938759198 2:134408590-134408612 CTCTCTAGGGAAGAGCTGGAAGG - Intronic
940588474 2:155687165-155687187 CCCTATATGTAGGAGTTGGATGG + Intergenic
945672749 2:212821691-212821713 CCTTCCTTCTTAGAGCTGGAAGG + Intergenic
948358994 2:237405088-237405110 CCGTCCTTTTCAGAGCTGGAAGG - Intronic
948869520 2:240791317-240791339 GCCTCTGTGTCAGAGCTGGGAGG - Intronic
1169203557 20:3727891-3727913 CCTTCCTTGAAACAGCTGGAGGG - Intergenic
1172603964 20:36202221-36202243 CCTGCTGTGGAAGAGCTGGATGG - Intronic
1173290908 20:41714539-41714561 CCCTCTTGCTATGACCTGGAAGG - Intergenic
1174547393 20:51335832-51335854 CCCCAGTTGTAACAGCTGGAAGG - Intergenic
1174671867 20:52315716-52315738 CAGTCTTTGCAAGAACTGGAAGG + Intergenic
1175521124 20:59603636-59603658 CCCCCTTTGCAGGTGCTGGAAGG - Intronic
1175752751 20:61510419-61510441 GCCTCTGTCAAAGAGCTGGAAGG + Intronic
1178952235 21:36994529-36994551 CCCAGTTTTTAAGAGCTGCACGG - Intergenic
1179400547 21:41078665-41078687 CCCTCTCGGTAAGAGTTGGCTGG - Intergenic
1180424402 22:15154905-15154927 CTCTCTTTGTAGGATCTGCAAGG - Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181749640 22:24980107-24980129 CCTTCTTTTTAAAGGCTGGATGG + Intronic
1183317043 22:37142529-37142551 CCCTCTTTAGAAGAACAGGAAGG + Intronic
1185087695 22:48749602-48749624 CCCTCTGTGCACGACCTGGAGGG - Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949340588 3:3026255-3026277 ACCACTTTGAAAGAGTTGGAGGG + Exonic
950973931 3:17220009-17220031 TCCTCTTTTTAAGAGCTGTGAGG + Intronic
951803196 3:26619701-26619723 CCCTCTGGGTCAGAGATGGATGG - Intergenic
952547597 3:34437211-34437233 CCCTCTTTGTAAGAGCAGCAGGG + Intergenic
953040453 3:39251192-39251214 CCCTGTGTGGAAGAGATGGAAGG - Intergenic
954452501 3:50579391-50579413 GCCCCTGTGTAAGAGCAGGATGG - Intronic
954517412 3:51191015-51191037 CCAACTATGTAAGAGCTGGGTGG - Intronic
955649481 3:61178276-61178298 CCCTCATTTTCAGAGGTGGAAGG + Intronic
959554363 3:107699600-107699622 GACTCTTTGTAAGAGGTAGAAGG + Intronic
959753224 3:109863516-109863538 CCATCTTTTTAAGAGCTGATGGG + Intergenic
959869843 3:111313707-111313729 TCTTCTTTGTAAGAGTAGGAAGG + Intronic
962976535 3:140450949-140450971 CCATTTTTGCAAGAGCTGTATGG - Intronic
968845425 4:3038745-3038767 ACCTGTTTGTAAATGCTGGAAGG - Intronic
970327659 4:14944148-14944170 CCTTCTTTGTAAAAGGTGGGTGG - Intergenic
971056170 4:22915243-22915265 GCCTCTTTGGAAGAGCTGGAGGG - Intergenic
980223460 4:129949315-129949337 CACTATAGGTAAGAGCTGGATGG + Intergenic
980566662 4:134551343-134551365 TCCTCTATGTAAGAGGAGGAAGG - Intergenic
983430083 4:167638527-167638549 CGTTCTTTGATAGAGCTGGAAGG - Intergenic
985716682 5:1466975-1466997 CCCGCTTTGTCAGAGCTGCTGGG + Intronic
997372657 5:133371795-133371817 CACTGTCTGTTAGAGCTGGAAGG + Intronic
998463376 5:142325223-142325245 CCCTCTTTGTAAAAGAACGACGG - Intronic
998771836 5:145554540-145554562 CACTCTTTCAAAGAGCTGGTTGG + Intronic
1001334016 5:170783073-170783095 TCCTCTGTGTGAGAGCAGGATGG + Intronic
1001363785 5:171116315-171116337 CCCTCTTTGTAGAAGATGGGAGG - Intronic
1001896232 5:175383852-175383874 CACTTTTTGTTAGTGCTGGATGG - Intergenic
1002284904 5:178155651-178155673 CCTTCCATGTAAGAGCTGAAGGG - Intergenic
1002483602 5:179519215-179519237 CATTCTTTTTAAGAGCTGCACGG + Intergenic
1004127994 6:12892258-12892280 TCCTCTTTGTAAAAACTGAAAGG + Intronic
1006273703 6:32984104-32984126 TCCTGTTTGTAAGGGGTGGATGG + Intergenic
1007257232 6:40537771-40537793 CCCTCAGTGTTAAAGCTGGATGG + Intronic
1012380644 6:98615783-98615805 CCCTGTTAGTCACAGCTGGAGGG + Intergenic
1014648918 6:124011210-124011232 TCCTCCTTGTTAGTGCTGGAAGG + Intronic
1016212703 6:141559307-141559329 CCCTCTTTGTAAAAGTTTGAGGG + Intergenic
1018212451 6:161495573-161495595 CTCTCTTTGTGCAAGCTGGAAGG + Intronic
1020963452 7:14835502-14835524 CCCTCTTTGTATGAGACAGAAGG - Intronic
1023204418 7:37732761-37732783 GACTCTTTATAAGAGCTAGATGG + Intronic
1023314526 7:38921610-38921632 CCTTCTTTGCAAGATTTGGATGG + Intronic
1024002785 7:45202064-45202086 CCCAAATTGTCAGAGCTGGAAGG + Intergenic
1028391236 7:90320346-90320368 CCCTCTGTTTAGGAGCTGGTTGG + Intergenic
1029843187 7:103387446-103387468 CCCTCTGTGTTAGAGCGGGAAGG + Intronic
1029916647 7:104216516-104216538 AGCTGTTTGTAAGAGATGGAGGG + Intergenic
1031381154 7:121087451-121087473 CCCTCTTTCTTAGAGAGGGAAGG + Intronic
1032753635 7:134866980-134867002 TCCTCATTTAAAGAGCTGGAAGG + Intronic
1034830898 7:154306328-154306350 CCCTCCTTGGAAGATCTTGAGGG + Intronic
1037059852 8:14494037-14494059 CCCTGTTTTTAAGAGATGAATGG - Intronic
1042356472 8:67833956-67833978 CTCTCTTTGTTAGAGTTGGTAGG + Intergenic
1045792621 8:106002084-106002106 TCCTCTTTGAATGAGCTGGTGGG - Intergenic
1047346497 8:124033885-124033907 GCCTCTTTGTGAGCCCTGGAGGG + Intronic
1048667921 8:136684940-136684962 TCCTCTTTGTAAGAGTTATAGGG + Intergenic
1052907679 9:33850813-33850835 CCATTTTTATAAGAGCTGAAAGG - Intronic
1053164736 9:35836444-35836466 CCCACTTTGTAAGAACTGACAGG + Intronic
1053316017 9:37052432-37052454 GCCCCTCTGAAAGAGCTGGAGGG - Intergenic
1053713977 9:40862731-40862753 CTCTCTTTGTAGGATCTGCAAGG + Intergenic
1054424364 9:64993079-64993101 CTCTCTTTGTAGGATCTGCAAGG + Intergenic
1055288861 9:74761537-74761559 TCCTCTTTTTAAGAGATGGGTGG - Intronic
1059586669 9:115614736-115614758 TATTCTTTGTAAGTGCTGGAGGG + Intergenic
1185741171 X:2533529-2533551 CGCTCTGTAAAAGAGCTGGAGGG - Intergenic
1186556593 X:10566586-10566608 CTCTCTTTGGAAGAACTGTAAGG + Intronic
1189862936 X:45291957-45291979 CCCTGAATGTGAGAGCTGGAAGG + Intergenic
1200303942 X:155006432-155006454 CACTCTTTGTCAGAGCTCCAGGG - Intronic
1200317444 X:155148474-155148496 CACTCTTTGTCAGAGCTCCAGGG + Intergenic