ID: 1149542125

View in Genome Browser
Species Human (GRCh38)
Location 17:57475358-57475380
Sequence TGTGCACGCATGTGTCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 0, 2: 0, 3: 67, 4: 418}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149542125_1149542132 17 Left 1149542125 17:57475358-57475380 CCCCAAGGACACATGCGTGCACA 0: 1
1: 0
2: 0
3: 67
4: 418
Right 1149542132 17:57475398-57475420 AAGCCCAAGTGGCATCTTTGGGG 0: 1
1: 0
2: 1
3: 45
4: 267
1149542125_1149542130 15 Left 1149542125 17:57475358-57475380 CCCCAAGGACACATGCGTGCACA 0: 1
1: 0
2: 0
3: 67
4: 418
Right 1149542130 17:57475396-57475418 TAAAGCCCAAGTGGCATCTTTGG 0: 1
1: 0
2: 0
3: 12
4: 145
1149542125_1149542131 16 Left 1149542125 17:57475358-57475380 CCCCAAGGACACATGCGTGCACA 0: 1
1: 0
2: 0
3: 67
4: 418
Right 1149542131 17:57475397-57475419 AAAGCCCAAGTGGCATCTTTGGG 0: 1
1: 0
2: 1
3: 19
4: 276
1149542125_1149542129 6 Left 1149542125 17:57475358-57475380 CCCCAAGGACACATGCGTGCACA 0: 1
1: 0
2: 0
3: 67
4: 418
Right 1149542129 17:57475387-57475409 AGGAGAGAATAAAGCCCAAGTGG 0: 1
1: 0
2: 1
3: 37
4: 297
1149542125_1149542135 24 Left 1149542125 17:57475358-57475380 CCCCAAGGACACATGCGTGCACA 0: 1
1: 0
2: 0
3: 67
4: 418
Right 1149542135 17:57475405-57475427 AGTGGCATCTTTGGGGCTTCTGG 0: 1
1: 0
2: 0
3: 23
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149542125 Original CRISPR TGTGCACGCATGTGTCCTTG GGG (reversed) Intronic