ID: 1149543354

View in Genome Browser
Species Human (GRCh38)
Location 17:57485106-57485128
Sequence CAAATGGGTGTTCCCAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149543349_1149543354 9 Left 1149543349 17:57485074-57485096 CCGGCTCACTGCAGAGCTGAGTG 0: 1
1: 0
2: 2
3: 24
4: 310
Right 1149543354 17:57485106-57485128 CAAATGGGTGTTCCCAGAGTGGG 0: 1
1: 0
2: 2
3: 10
4: 139
1149543345_1149543354 30 Left 1149543345 17:57485053-57485075 CCTCGTGTAGAGCCCTTAGTGCC 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1149543354 17:57485106-57485128 CAAATGGGTGTTCCCAGAGTGGG 0: 1
1: 0
2: 2
3: 10
4: 139
1149543348_1149543354 17 Left 1149543348 17:57485066-57485088 CCTTAGTGCCGGCTCACTGCAGA 0: 1
1: 0
2: 0
3: 4
4: 98
Right 1149543354 17:57485106-57485128 CAAATGGGTGTTCCCAGAGTGGG 0: 1
1: 0
2: 2
3: 10
4: 139
1149543347_1149543354 18 Left 1149543347 17:57485065-57485087 CCCTTAGTGCCGGCTCACTGCAG 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1149543354 17:57485106-57485128 CAAATGGGTGTTCCCAGAGTGGG 0: 1
1: 0
2: 2
3: 10
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149543354 Original CRISPR CAAATGGGTGTTCCCAGAGT GGG Intronic
900759384 1:4460815-4460837 CAAAGGCGTGTTCCCAGGATGGG + Intergenic
901484575 1:9549529-9549551 TCAATGGGAGTTCCCAGTGTTGG + Intronic
905118167 1:35660375-35660397 CAGACGGGGGTCCCCAGAGTGGG - Intergenic
911086906 1:93986177-93986199 GAAATGGGTGATTCCAGATTGGG + Intergenic
913413595 1:118579935-118579957 CAAATTGCTGTTCCCAAAATTGG - Intergenic
920618965 1:207525207-207525229 CAAATGGTAATTCCCAGTGTTGG - Intronic
920620745 1:207543763-207543785 CAAATGGTAATTCCCAGTGTTGG - Intronic
920622527 1:207562320-207562342 CAAATGGTAATTCCCAGTGTTGG - Intronic
921628887 1:217409781-217409803 CTAATGGGTATAACCAGAGTGGG - Intergenic
922745383 1:228040129-228040151 CCAATGGGTGTTCCCATGGCTGG - Intronic
922867422 1:228872063-228872085 CAAATGGAGGTTCCCAGAGAGGG - Intergenic
923390234 1:233507599-233507621 CAAATGGGTTTTACCAGTGGTGG + Intergenic
1067056747 10:43056958-43056980 CCACTGGGTGTGCACAGAGTGGG - Intergenic
1067056757 10:43056998-43057020 CCACTGGGTGTGCTCAGAGTGGG - Intergenic
1069819809 10:71220430-71220452 CAGCTGGGGGTTCCCAGAGGTGG - Intronic
1071423508 10:85525802-85525824 CAAATGGGTGTTTTCTGAGATGG + Intergenic
1072727355 10:97822644-97822666 CCAATGAGGGTTCCCAGAGAAGG - Intergenic
1074960411 10:118440092-118440114 CATCTGGGAATTCCCAGAGTAGG + Intergenic
1074961375 10:118448968-118448990 CAGGGGGGTGTTCCCAGAGGAGG - Intergenic
1078319807 11:10324033-10324055 CAAATGGATCTTCCCAAAGAAGG - Intronic
1081570625 11:44288618-44288640 GCAATGTGTGCTCCCAGAGTTGG - Intronic
1085402818 11:76244673-76244695 CGATTGGGTGGCCCCAGAGTAGG - Intergenic
1085977114 11:81670365-81670387 CAAATGGGTGATTTCAGAGAAGG + Intergenic
1088987475 11:114922435-114922457 CATATGGGGGCTCCCAGAGAAGG - Intergenic
1091033600 11:132213649-132213671 CTAATGGATGTTCTCAGAGAAGG + Intronic
1091238424 11:134036881-134036903 CAAATGGGTGGGCCCAGGATTGG - Intergenic
1102378686 12:112444890-112444912 GAAATGGCTGATCCCAGCGTTGG - Intronic
1106111661 13:26783080-26783102 CAAGTGGGTGTTTGCAGAGCAGG + Intergenic
1106411070 13:29511791-29511813 CAAATGGGTCTTTCCAATGTGGG + Exonic
1115292510 14:31788494-31788516 CACATGTGTGTGCCCAGTGTTGG + Intronic
1118984986 14:70746383-70746405 CAAATAGGTGTTGCAAAAGTAGG - Intronic
1121714781 14:96065812-96065834 CAAATGGGCGTCCCCTGTGTGGG - Intronic
1122590891 14:102850019-102850041 CAAAAGGGTGCTCCAAGAGCTGG - Intronic
1123161331 14:106280920-106280942 CAAATTGTTATTCCCAGTGTTGG + Intergenic
1124161943 15:27278507-27278529 CTAATGTGTGCTCCAAGAGTGGG + Intronic
1125373135 15:38999958-38999980 CTCATGGGAGTTCCCAGAGCTGG - Intergenic
1128114162 15:65094940-65094962 CGAATGGGTGCTCCCAGACAGGG - Intronic
1130069034 15:80630947-80630969 AGAATGGTGGTTCCCAGAGTTGG - Intergenic
1131441567 15:92463601-92463623 CACATGGGTGTGGCCAGACTTGG - Intronic
1132126949 15:99235824-99235846 AGAATGGGTGTTGCCAGAGGTGG - Intronic
1134456188 16:14397373-14397395 CACATGGGTGTTTGGAGAGTGGG - Intergenic
1137592699 16:49703559-49703581 CAAATGGCTCTTCCTAGAGAAGG + Intronic
1137600020 16:49750195-49750217 CAACTGAGAATTCCCAGAGTAGG - Intronic
1137736309 16:50726415-50726437 CAAATGAGTGTCGCCAGAGTGGG - Intronic
1141603895 16:85142308-85142330 CACATAGGTGGTCCCAGAGCTGG - Intergenic
1141953192 16:87352657-87352679 CAGATCTGTGCTCCCAGAGTGGG - Intronic
1147370564 17:39989868-39989890 CAAGTCTGTGTTCCCAGAGCAGG + Exonic
1148717532 17:49726568-49726590 AAACTGGGAGTGCCCAGAGTGGG + Intronic
1149543354 17:57485106-57485128 CAAATGGGTGTTCCCAGAGTGGG + Intronic
1150815705 17:68390436-68390458 CAAAAGGCTGTCCTCAGAGTGGG - Intronic
1153135380 18:1911565-1911587 CAAGTGGGTTTTCACAGAATTGG + Intergenic
1157279826 18:46339063-46339085 CACATGGATGTTCCCAGTGGAGG + Intronic
1158187994 18:54793312-54793334 CAAATGGCTTTTCCCTAAGTCGG - Intronic
1160377707 18:78426251-78426273 ATAACGGGAGTTCCCAGAGTCGG + Intergenic
1161409424 19:4108656-4108678 AAAATGGGGGTTCCCAGAGTGGG - Intronic
1162982650 19:14249121-14249143 CAGGTGGAGGTTCCCAGAGTGGG + Intergenic
1164335498 19:24314892-24314914 CAAATGTCTGTTCGCAGAGTGGG - Intergenic
1165555456 19:36627369-36627391 CCAATGGGTGTCCTCAGTGTGGG + Exonic
1167400258 19:49262078-49262100 AAAATGGTGGTTACCAGAGTGGG + Intergenic
1168030798 19:53678020-53678042 CAAAGGGGGCTTCCCAGAGCAGG + Intergenic
1168031549 19:53683546-53683568 CAAAGGGGGCTTCCCAGAGCAGG + Intergenic
1168042059 19:53766408-53766430 CAAAGGGGGCTTCCCAGAGCAGG + Intergenic
925687026 2:6483079-6483101 CCAATGGGTGTCCCCTGAGTAGG - Intergenic
925687847 2:6491848-6491870 AAACTGTGAGTTCCCAGAGTAGG + Intergenic
930981296 2:57529001-57529023 CAATTTGGTGTTCCCACAGGGGG + Intergenic
931671269 2:64650126-64650148 CAAATGGGTCTTTCCAGCTTTGG + Intronic
931734383 2:65180773-65180795 CAAATTGGTGCCCGCAGAGTGGG + Intergenic
935611677 2:105032186-105032208 CAAAGGGTGGTTCCCAGAGCAGG - Intergenic
936159906 2:110077070-110077092 CTAATTGGTGTTCCAAGAATTGG - Intergenic
936184758 2:110294283-110294305 CTAATTGGTGTTCCAAGAATTGG + Intergenic
937936724 2:127251375-127251397 CAAATGGGTTTTCTTATAGTTGG - Intergenic
939126988 2:138189475-138189497 CAACTGGGTGTAGCCAGAGTAGG - Intergenic
939318596 2:140585524-140585546 CAAATGGCTGATCTTAGAGTTGG + Intronic
940040800 2:149358465-149358487 TAACTGGGTGTGCCCAGAGAGGG + Intronic
941222374 2:162799092-162799114 CAAGTGGGGCTTCCCACAGTGGG - Intronic
941998508 2:171624131-171624153 AGAATGGGTGATCACAGAGTGGG - Intergenic
945256578 2:207808194-207808216 AAAATGGGTGGCCCCAGACTGGG - Intergenic
945714056 2:213336316-213336338 CTCATGGGAGTTCCCAGAGCTGG - Intronic
946299935 2:218816713-218816735 GAAGAGGGTGTTCCAAGAGTGGG - Intergenic
947845778 2:233242527-233242549 CAAATCGGTGTTCCCATTTTTGG + Intronic
947958927 2:234218341-234218363 CACATGGGTGATACCACAGTGGG + Intergenic
949060626 2:241954947-241954969 CAAAATGGTGTTGCCAGAGAAGG - Intergenic
1170317986 20:15063219-15063241 CAATTTGCAGTTCCCAGAGTCGG - Intronic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1170815470 20:19710047-19710069 CAAATGGATGTTCCCAGCTGTGG - Intronic
1171936455 20:31278993-31279015 CAAATTGATGTTTCCACAGTGGG + Intergenic
1173319557 20:41975208-41975230 CAAATGAGTGGTTCCTGAGTAGG - Intergenic
1173343460 20:42176153-42176175 CAAATGAGTGTTTCCAGAGTAGG - Intronic
1174250109 20:49212940-49212962 CAAATGGTTGCTCCCACATTGGG - Intergenic
1175099959 20:56572109-56572131 GAGATGGGTGTGCTCAGAGTTGG + Intergenic
1178732377 21:35116781-35116803 GAACTGGCTGTTTCCAGAGTTGG - Intronic
1179494183 21:41761265-41761287 CCAACCGGTGTTCCCAGAGGAGG - Intronic
1184112351 22:42402676-42402698 CAAAGTGGTGTTCCCAGAGCAGG - Intronic
949910157 3:8897505-8897527 CAACTGGGCGTTCTCAGGGTGGG - Intronic
952512812 3:34074146-34074168 CAAATAGGTGTGGCCAGGGTTGG + Intergenic
953458499 3:43062811-43062833 CAGATGTGGGTTCCCTGAGTTGG + Intergenic
953631134 3:44618832-44618854 TAAATGGGTGTTCACAAAATTGG + Intronic
963729433 3:148957161-148957183 CAGATGGGTGTTCAGAGATTAGG - Intergenic
965319507 3:167234288-167234310 CAAATGAGTGTTCCAATATTAGG - Intergenic
965368963 3:167836993-167837015 GAAATGTGTGTTTGCAGAGTGGG + Intergenic
967699478 3:192574693-192574715 CAAATATGTGTTGCTAGAGTAGG - Intronic
969029884 4:4203432-4203454 CACATGGGGGTTTGCAGAGTCGG + Intronic
970649943 4:18166588-18166610 CATATGGCTGTTCCCAGTTTGGG - Intergenic
970883973 4:20965392-20965414 CAAATGGGTTTTCTAAGAGGAGG + Intronic
981824693 4:148926687-148926709 CGCATGGGTGTTCCAAGATTTGG - Intergenic
984036895 4:174680464-174680486 CATATGGATGTTTCAAGAGTTGG + Intronic
984171706 4:176367966-176367988 CAAATGGGTGGGGCCAGACTGGG + Intergenic
986431220 5:7683087-7683109 CAAGTGGGGGTTACCAGTGTGGG + Intronic
988878035 5:35469734-35469756 CAAATGAGTGTTCCCAGCATCGG - Intergenic
989177037 5:38538330-38538352 CAAATCCGTGTTCCCAGGATTGG + Intronic
990819064 5:59817059-59817081 CACACTAGTGTTCCCAGAGTGGG - Intronic
991618164 5:68518112-68518134 CAGATGGGTGTTCCCCAAATGGG + Intergenic
992546996 5:77822951-77822973 CAAATTGTCGTTCCCAGTGTTGG - Intronic
996019111 5:118572841-118572863 CACATGGGTGTTCCCTGCGGGGG - Intergenic
999709835 5:154308326-154308348 CAAGTGGGTGGTCCCTGAATAGG - Intronic
1000399059 5:160806104-160806126 CAGATGGCTGTCCCCAGTGTGGG - Intronic
1004449186 6:15728998-15729020 CAAATGTTTGGTCCCAGAGATGG - Intergenic
1004490735 6:16112374-16112396 GAAATGGCTGATTCCAGAGTTGG + Intergenic
1011518516 6:88179004-88179026 AAAATGGCTGTTCTCTGAGTTGG - Intergenic
1013771281 6:113630980-113631002 CCACTGGGTGTTTCAAGAGTTGG + Intergenic
1018159557 6:161025125-161025147 CAAATGGGAGTTCTTTGAGTTGG + Intronic
1018598040 6:165504809-165504831 CAAAAGGGAGCTCCCAGAGGAGG - Intronic
1018631829 6:165828064-165828086 CAAATGGGTAATCCAAGAGTAGG - Intronic
1020383204 7:7567819-7567841 CACATCGGATTTCCCAGAGTTGG + Intronic
1021236183 7:18144990-18145012 CTAGGGAGTGTTCCCAGAGTCGG - Intronic
1023833013 7:44051118-44051140 CAATTTGCTGTCCCCAGAGTGGG + Intronic
1031493632 7:122420485-122420507 CAAATGGGTGAAACCAGAGACGG - Intronic
1031943807 7:127817489-127817511 CAAATGGGTATCAGCAGAGTTGG - Intronic
1035769918 8:2138849-2138871 GAAATGGCTGTTCCCAGGGATGG - Intronic
1036989495 8:13576710-13576732 CAAATGAATCTCCCCAGAGTAGG + Intergenic
1038153205 8:24960714-24960736 CAAATTGGTGTCCCCAAAGCAGG - Intergenic
1038731154 8:30128959-30128981 TAAATGGGGTTTCCCAGAGTTGG - Intronic
1040660956 8:49574740-49574762 GAAATGGTTGATTCCAGAGTTGG + Intergenic
1041887008 8:62821773-62821795 CAGGTGGGTGTTCCCTGAGAAGG + Intronic
1042194617 8:66221645-66221667 CAATTGGGAGTTCCCAGTGGGGG - Intergenic
1042344420 8:67712688-67712710 AAATTCGGTGTTCCCAGAGAAGG - Intronic
1043175250 8:77016907-77016929 TGAATAGGAGTTCCCAGAGTTGG - Intergenic
1045036212 8:98178416-98178438 CACATGGGTGCTCCCACAATGGG - Intergenic
1045527883 8:102956897-102956919 CAGATGGGTGTTCTCAGTCTTGG + Intronic
1047184660 8:122621940-122621962 CAGATGGCTTTTCCCAGTGTGGG + Intergenic
1051504242 9:17810370-17810392 GAAATAGGTGGTCCCAGAGGTGG + Intergenic
1051701379 9:19827851-19827873 TATATGGGTGATTCCAGAGTTGG - Intergenic
1052128917 9:24816341-24816363 CTAATGGTTGTTCCCAGAATGGG + Intergenic
1057706226 9:97396884-97396906 CATTTGGGTTTTCCCAGAGGGGG - Intergenic
1057742332 9:97722588-97722610 CAAATGGTTCTTCCCTGAATTGG + Intergenic
1189926382 X:45959668-45959690 CAAGTGGGTGTGGCCAGACTGGG - Intergenic
1190303989 X:49072258-49072280 AAAAGGGGTGTTCCCAGAAGGGG + Intronic
1192631479 X:72781091-72781113 CCCACGGGTGCTCCCAGAGTGGG - Intronic
1192650230 X:72939710-72939732 CCCACGGGTGCTCCCAGAGTGGG + Intronic
1197227114 X:123965104-123965126 AAAATGTCTGTTCCCAGATTGGG - Intronic
1199855507 X:151755986-151756008 GAAATGGGTCTTCCCAGGCTTGG + Intergenic
1200177151 X:154125281-154125303 CAATTTGGTGTTCCCGCAGTGGG - Intergenic