ID: 1149544315

View in Genome Browser
Species Human (GRCh38)
Location 17:57491805-57491827
Sequence TTGAATGAACAGCAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 310}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149544315_1149544318 -9 Left 1149544315 17:57491805-57491827 CCTCCTTCCTGCTGTTCATTCAA 0: 1
1: 0
2: 3
3: 34
4: 310
Right 1149544318 17:57491819-57491841 TTCATTCAACCTTTCTAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 139
1149544315_1149544321 18 Left 1149544315 17:57491805-57491827 CCTCCTTCCTGCTGTTCATTCAA 0: 1
1: 0
2: 3
3: 34
4: 310
Right 1149544321 17:57491846-57491868 TTTGCCTCAGTTTTCCTCCCTGG 0: 1
1: 1
2: 5
3: 55
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149544315 Original CRISPR TTGAATGAACAGCAGGAAGG AGG (reversed) Intronic
900332605 1:2143788-2143810 TTGAATGAAGGTCAGGCAGGGGG + Intronic
901089637 1:6632745-6632767 CTGCATCACCAGCAGGAAGGCGG - Intronic
902102846 1:14007423-14007445 TTAAATGCACAGGAGGAAGCTGG - Intergenic
902512758 1:16975181-16975203 TTGAATAAACATCAGGTGGGTGG + Intronic
903341695 1:22658871-22658893 ATGGATGGACAGCAGGATGGAGG + Intronic
903909111 1:26709336-26709358 GTGGATGCACAGGAGGAAGGTGG - Intronic
904246783 1:29193730-29193752 ATGACAGAAAAGCAGGAAGGGGG + Intronic
904855069 1:33491567-33491589 ATGGATGAGCAGGAGGAAGGGGG + Exonic
905363660 1:37437112-37437134 TAAAAGGAACAGCAGCAAGGAGG - Intergenic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
907634165 1:56116832-56116854 GTGAAGAAACAGCAGGAAGGGGG + Intergenic
909417249 1:75420427-75420449 ATGAATGAACAGCAAGATGCTGG + Intronic
909911752 1:81267581-81267603 TTGAATGATCAAGAGAAAGGTGG + Intergenic
909914756 1:81303133-81303155 GTGAATGAACACGAGGACGGAGG - Intergenic
910175198 1:84422589-84422611 TGTAATGAACAGAAGGAAGAAGG + Intergenic
910901878 1:92130113-92130135 ATGAGTGTACAGCAAGAAGGCGG - Intronic
911226649 1:95314411-95314433 ATGAATGAATAAAAGGAAGGAGG + Intergenic
911366696 1:96947202-96947224 ATGCATGTATAGCAGGAAGGTGG - Intergenic
912478909 1:109962612-109962634 ATGAATGACCAACAGAAAGGTGG + Intergenic
913963470 1:143356174-143356196 TTGAAAGAAGTGCAGAAAGGAGG - Intergenic
914057828 1:144181763-144181785 TTGAAAGAAGTGCAGAAAGGAGG - Intergenic
914121318 1:144784602-144784624 TTGAAAGAAGTGCAGAAAGGAGG + Intergenic
914915004 1:151814277-151814299 TTGATGGAAGAGGAGGAAGGAGG + Intronic
915943850 1:160135908-160135930 AATGATGAACAGCAGGAAGGGGG - Exonic
916165273 1:161961215-161961237 TCCACTGAAGAGCAGGAAGGTGG + Exonic
916915026 1:169397185-169397207 TAAAATGAACATGAGGAAGGAGG + Intronic
918087311 1:181256641-181256663 TTCAAGGAACAGCAACAAGGCGG + Intergenic
918767224 1:188501652-188501674 GTGTATTCACAGCAGGAAGGAGG + Intergenic
920328147 1:205183198-205183220 TTGAAGGAAAGGCAGGAGGGTGG + Intronic
922000824 1:221476627-221476649 TGGAAAGAAGGGCAGGAAGGCGG + Intergenic
922069880 1:222181522-222181544 ATGAATTAGCAGCAGGAAGGGGG + Intergenic
922603193 1:226872099-226872121 TTGAAAGAGCAGCAAGGAGGAGG + Intronic
923097709 1:230788687-230788709 CTTAAAGCACAGCAGGAAGGTGG + Intronic
924186941 1:241502798-241502820 ATGAATGAAAATCATGAAGGTGG - Intronic
924482113 1:244445176-244445198 TTAAAGGAAGAGCAGGATGGTGG - Intronic
924612309 1:245583750-245583772 TGGAAAAAACAGCTGGAAGGTGG + Intronic
924927603 1:248698113-248698135 TTAGATGAACTTCAGGAAGGTGG - Intergenic
1066365807 10:34775890-34775912 TTAATTGAAAAGCATGAAGGTGG - Intronic
1066461286 10:35614603-35614625 TTTAGTAAACAGCTGGAAGGAGG - Intergenic
1066484776 10:35832900-35832922 CTGAATGAACTGAATGAAGGAGG + Intergenic
1067202716 10:44187142-44187164 TGGAAGGAACAGCAGGGAAGTGG + Intergenic
1067783529 10:49226466-49226488 TTGAATGCAGGGCATGAAGGAGG + Intergenic
1068380609 10:56249045-56249067 TTGTAAGAACAGCAGCATGGGGG + Intergenic
1069837883 10:71320501-71320523 GTGAAGGCACAGCAAGAAGGAGG - Intronic
1069893752 10:71667869-71667891 TTGAATGCACAAGATGAAGGGGG + Intronic
1071273926 10:84035312-84035334 TTACATGAACAAGAGGAAGGAGG - Intergenic
1072064563 10:91853412-91853434 TTGAATGAACATAAAGAAGATGG - Intronic
1073703245 10:105954157-105954179 AGGAAAGAACAGGAGGAAGGAGG + Intergenic
1075238763 10:120758228-120758250 TTGAGACAATAGCAGGAAGGGGG - Intergenic
1076158474 10:128222411-128222433 TGGCATGAACAGCTGGAAAGCGG - Intergenic
1076841056 10:133045445-133045467 TTTTCTGAGCAGCAGGAAGGTGG - Intergenic
1077890606 11:6415520-6415542 TTGACTGAATATCATGAAGGAGG + Intronic
1078614198 11:12849796-12849818 CTGAATAAATAGCAGGAATGAGG - Intronic
1078899118 11:15625001-15625023 TTGAAAGAAAAGCAGGAAGAAGG - Intergenic
1080354433 11:31425546-31425568 ATGAAGGCACAGCAAGAAGGAGG - Intronic
1080820817 11:35804761-35804783 TTGTATAACCAGCAGGAAAGGGG + Intronic
1081540210 11:44029283-44029305 TTGAAGGAACAGCAAGAAGCTGG - Intergenic
1081753791 11:45530733-45530755 TGGCAGGAACAGCAGGAAGGTGG - Intergenic
1082856663 11:57814210-57814232 GTGAATGAAGGGAAGGAAGGAGG + Intronic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1083316202 11:61816282-61816304 TGGAATGCACGGCAGGGAGGCGG + Intronic
1083829530 11:65222551-65222573 TGCAATGAACGGGAGGAAGGAGG + Intergenic
1084328590 11:68416334-68416356 CTGGCTGAACAGCAAGAAGGTGG - Exonic
1084402252 11:68951340-68951362 TTTAATGAACAGCGGAGAGGAGG + Intergenic
1084863978 11:72041016-72041038 TTGAAAGGAGAGGAGGAAGGGGG + Intronic
1085303558 11:75472721-75472743 CTGAATGAACAACTGGAAGGAGG - Intronic
1085775159 11:79358801-79358823 TTGAATGAATGGCAGGAAGGAGG - Intronic
1086878255 11:92124175-92124197 TTGAAGGAAGAACAGTAAGGAGG + Intergenic
1087096866 11:94327432-94327454 GGGAATGAACACCAGGAATGGGG + Intergenic
1088417120 11:109601464-109601486 TAGAATTAAAAGCATGAAGGTGG + Intergenic
1088810647 11:113389371-113389393 ATGAATGAATAGCTGGAAAGAGG - Intronic
1089111259 11:116059178-116059200 TTAAATGAAAAAAAGGAAGGGGG - Intergenic
1089620230 11:119717864-119717886 TGGAAGCAACAGGAGGAAGGAGG - Intronic
1091235620 11:134020380-134020402 TTGAGGGAAGGGCAGGAAGGAGG - Intergenic
1091300244 11:134502948-134502970 TTGAATGAACAGCGGGACATTGG + Intergenic
1092208455 12:6631103-6631125 AAGAAGGAACACCAGGAAGGAGG + Intronic
1092746631 12:11678558-11678580 TTGTATGAACAGCAGAAAAAAGG - Intronic
1092889382 12:12954548-12954570 ATGACTAACCAGCAGGAAGGGGG - Intergenic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1094475385 12:30836795-30836817 ATGAGTGAACGGTAGGAAGGTGG - Intergenic
1094647791 12:32343641-32343663 ATGGAGGAACAGAAGGAAGGAGG - Intronic
1097982299 12:65746844-65746866 TTGAATGAAGAGGAGAAAGAAGG + Intergenic
1098101926 12:67027122-67027144 TTGAAAGGAGAGCAGGGAGGAGG + Intergenic
1098192760 12:67967736-67967758 ATGAATGTATTGCAGGAAGGTGG - Intergenic
1098954307 12:76672597-76672619 ATGAATGGACATCAGGAGGGAGG - Intergenic
1099824872 12:87762309-87762331 TTTAATGAGCAGCAGCAAAGTGG + Intergenic
1100881583 12:99024424-99024446 TTGTTTGCACAGCAGGAAGTTGG - Intronic
1101210063 12:102526507-102526529 CTGACTGCACAGCTGGAAGGTGG - Intergenic
1101314719 12:103618603-103618625 GGGAAGGGACAGCAGGAAGGTGG + Intronic
1101947534 12:109149397-109149419 AGGAATGGACAGCAGGGAGGGGG + Intronic
1103242146 12:119422602-119422624 TTGAAAGGACAGCACCAAGGGGG + Intronic
1103368232 12:120398528-120398550 ATGAATGAAGAGCAGGGAGGTGG - Intergenic
1103886690 12:124207744-124207766 TGGAAGGAACAGAGGGAAGGAGG + Intronic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104487105 12:129161158-129161180 TCTGAGGAACAGCAGGAAGGAGG + Intronic
1104575045 12:129959040-129959062 GTGATTGCCCAGCAGGAAGGGGG + Intergenic
1107011071 13:35671789-35671811 TTGAAGACACAGCAGAAAGGGGG + Exonic
1108543345 13:51465605-51465627 TTTAAGGAACAGCAGCAAGCAGG + Intergenic
1109253618 13:60050937-60050959 TTCAATGTACAGCAGACAGGAGG + Intronic
1113580859 13:111427673-111427695 TTGTAAGAACTGCAGGAAAGGGG + Intergenic
1114553724 14:23549633-23549655 TAGAATGAACTGAAGGATGGGGG + Intronic
1114768492 14:25402058-25402080 TTTAATTAACTGCAAGAAGGAGG - Intergenic
1115896190 14:38090360-38090382 TTGGAGAAACAGCAGGAAGAAGG + Intergenic
1116538085 14:46061435-46061457 TAAAATGAACAGAAGGTAGGTGG + Intergenic
1116705664 14:48295502-48295524 TTAAATGAGCAGGAGGGAGGTGG - Intergenic
1116862455 14:50005525-50005547 TTAAATAAGCAGCAGGAAGAAGG + Intronic
1117441966 14:55768459-55768481 TTGAATGAAGAGAAGAATGGTGG + Intergenic
1120523278 14:85549067-85549089 TGGAATGAAGAGCTGGAAAGGGG - Intronic
1121051360 14:90820882-90820904 ATGAATGAGCTGAAGGAAGGTGG + Intergenic
1122218686 14:100221485-100221507 CTGAATTTACAGCAGGAAGTTGG + Intergenic
1122550326 14:102545666-102545688 TTGAAAGAACAGCGGGGTGGGGG + Intergenic
1122910290 14:104824515-104824537 TTGGATGGACAGTAGGATGGTGG + Intergenic
1123131588 14:105990134-105990156 TTTAATGAAAGGCAGGTAGGAGG - Intergenic
1123581820 15:21721320-21721342 TTTAATGAAAGGCAGGTAGGAGG - Intergenic
1123618469 15:22163920-22163942 TTTAATGAAAGGCAGGTAGGAGG - Intergenic
1124141650 15:27082296-27082318 TTTCATGAAAAGCAGGAAAGAGG - Intronic
1125646784 15:41279234-41279256 TTTACTGCACAGGAGGAAGGGGG + Intronic
1127572983 15:60262238-60262260 TTGGATGACCAGCAGAAAGAAGG - Intergenic
1128619744 15:69138636-69138658 ATGAATTAACAGAAGGAAGGAGG + Intergenic
1129192340 15:73944774-73944796 TTAACTGAACAGAGGGAAGGAGG + Intronic
1129824957 15:78628879-78628901 ATGAATTAACTGCAGGAAGTGGG + Intronic
1131863038 15:96674972-96674994 CTGAAGGAACAGAGGGAAGGAGG + Intergenic
1131969028 15:97874082-97874104 TTGAATGAACAGGAGCAAATGGG + Intergenic
1133310493 16:4843045-4843067 TTGACTGAGCATCTGGAAGGTGG + Intronic
1134310414 16:13071051-13071073 TTGAATGATAAGCAAGCAGGTGG - Intronic
1135924268 16:26678560-26678582 TTGAATGAAGACCAGGAGGCTGG + Intergenic
1137030968 16:35524030-35524052 TTAAATCAAAAGCAGAAAGGGGG + Intergenic
1138372736 16:56540220-56540242 GTGAATGACCATGAGGAAGGAGG - Intergenic
1139665254 16:68450599-68450621 TTGAAAGAAGAGCAGGAGGCCGG - Intergenic
1141206890 16:81939587-81939609 TTGTTTGCAGAGCAGGAAGGTGG - Intronic
1141472218 16:84246831-84246853 TGGAATAAACAGGAGGAAGGTGG + Intergenic
1144945446 17:18967337-18967359 TGGAAGGAAGGGCAGGAAGGAGG + Intronic
1145044525 17:19602696-19602718 TAGAATTAACAGCAGGATGATGG - Intergenic
1145828915 17:27899082-27899104 TAGAATGAACAGGTGGAAAGGGG - Intergenic
1147520610 17:41168718-41168740 TTGAATGAACAGAATAAAGCAGG - Intergenic
1149537857 17:57446281-57446303 TTCAGGGAACAGAAGGAAGGAGG + Intronic
1149544315 17:57491805-57491827 TTGAATGAACAGCAGGAAGGAGG - Intronic
1151853467 17:76705697-76705719 GTGAAAGTACAGCAAGAAGGTGG + Intronic
1153813319 18:8771008-8771030 ATGAGTGAACAGGAGGAAGGGGG + Intronic
1155339552 18:24799912-24799934 TTGAATGAATTAAAGGAAGGGGG + Intergenic
1155567841 18:27156118-27156140 TTTAAGGAACAGTAGGAATGAGG + Intronic
1156399755 18:36729590-36729612 TTGAAGACACAGCAAGAAGGTGG - Intronic
1158211266 18:55053220-55053242 TTAAACAAACAGCAGGAAGATGG - Intergenic
1158627107 18:59081106-59081128 TTGGGGGCACAGCAGGAAGGTGG - Intergenic
1158677654 18:59536382-59536404 TTGAAGGAAGAGCTGGAGGGTGG - Intronic
1162164619 19:8743844-8743866 TTGAATGAAAGGCAGGGAAGTGG - Intergenic
1162165691 19:8751312-8751334 TTGAATGAAAGGCAGGGAAGTGG - Intergenic
1162166756 19:8758768-8758790 TTGAATGAAAGGCAGGGAAGTGG - Intergenic
1162167822 19:8766228-8766250 TTGAATGAAAGGCAGGGAAGTGG - Intergenic
1162168761 19:8772522-8772544 TTGAATGAAAGGCAGGGAAGTGG - Intergenic
1162170507 19:8785290-8785312 TTGAATGAAAGGCAGGGAAGTGG - Intergenic
1163628946 19:18406860-18406882 TTAAAGGAACGGCTGGAAGGTGG + Intergenic
1165068589 19:33242341-33242363 GTGGATGCACAGCAGGAGGGTGG - Intergenic
1165204273 19:34170749-34170771 ATGAATGAACAGCAGGATGAAGG - Intergenic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1166299883 19:41907547-41907569 ATGAATGAACAACTGGAGGGAGG - Intronic
1166666530 19:44683705-44683727 TTGAAGGAACAGACCGAAGGCGG - Exonic
1202697311 1_KI270712v1_random:134431-134453 TTGAAAGAAGTGCAGAAAGGAGG - Intergenic
925107521 2:1305608-1305630 TTGTATGTACAGCAGTAATGAGG + Intronic
925752383 2:7100516-7100538 TTGGATGAAGAGCAGCATGGTGG + Intergenic
926221070 2:10935712-10935734 GTGAATGAACAGCAGGAGGCCGG - Intergenic
926442456 2:12904092-12904114 TAGAGGGAACAGCAAGAAGGAGG - Intergenic
927112317 2:19872362-19872384 TTGAATGCAAGGCAGGAAAGAGG - Intergenic
927709158 2:25314434-25314456 GTGAATGAAGAGAAGGGAGGAGG - Intronic
929435800 2:41927484-41927506 TGGAAAGACCATCAGGAAGGAGG + Intergenic
929545669 2:42854131-42854153 TAGAATGAACACCAGGCATGAGG + Intergenic
930392384 2:50778543-50778565 TGGAATGAACAAAAGGAAGGTGG + Intronic
932464816 2:71912261-71912283 GTGAAGGCACAGCAAGAAGGTGG + Intergenic
932524686 2:72451938-72451960 TTAAATGAGCAACAGGAATGTGG - Intronic
933373878 2:81453514-81453536 TTCAAAGAACAGTAGGAAGGAGG + Intergenic
934278479 2:91591456-91591478 TTGAAAGAAGTGCAGAAAGGAGG - Intergenic
935542132 2:104361118-104361140 TGGAATGAACAGGAGGATGAAGG + Intergenic
935841956 2:107123180-107123202 TTGAGAAAACAGCAAGAAGGTGG + Intergenic
938370395 2:130764521-130764543 TTGAACAGCCAGCAGGAAGGGGG + Exonic
938397363 2:130961445-130961467 AAGAAGGAACAGCAGCAAGGTGG + Intronic
938546023 2:132332490-132332512 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
938930173 2:136079864-136079886 GTGAAGACACAGCAGGAAGGTGG - Intergenic
939257517 2:139763807-139763829 TGGAATGAAGAGCAGGCAGAAGG + Intergenic
940448052 2:153801495-153801517 ATGAATGAACAGCTGGTAGGTGG + Intergenic
940657442 2:156506089-156506111 TTGAATGAGAAGTAGAAAGGAGG - Intronic
940984873 2:160043060-160043082 GTGAATGAAGAAGAGGAAGGAGG + Intronic
941138624 2:161747797-161747819 TTGAATGTACACCTGGAAGAGGG + Intronic
945047035 2:205790725-205790747 ATGAATCAACAAGAGGAAGGTGG - Intronic
947403602 2:229752330-229752352 TAAAATCACCAGCAGGAAGGAGG + Intergenic
948940180 2:241191423-241191445 TGGGAAGAACAGCAGGAAAGGGG + Intronic
1170036989 20:12000043-12000065 TTGTATGTACAGCAGGATTGGGG + Intergenic
1170343613 20:15357774-15357796 ATGAATGAACAGTAAGAATGTGG - Intronic
1171874886 20:30565223-30565245 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
1172783396 20:37450540-37450562 ATGAATGAACAGATGGATGGAGG - Intergenic
1174266028 20:49332861-49332883 TTCAAGGATCAGCAAGAAGGCGG + Intergenic
1175565420 20:59971951-59971973 ATTATTGAACAGCTGGAAGGAGG - Exonic
1176661927 21:9644908-9644930 AGGAGTGAAGAGCAGGAAGGTGG + Intergenic
1177214403 21:18109760-18109782 ATGGATGAAAAGCAGGGAGGAGG + Intronic
1177757376 21:25363283-25363305 TTGAGGAAACTGCAGGAAGGGGG + Intergenic
1178085209 21:29105351-29105373 TGGAATGAGCAACAGGAAGAAGG - Intronic
1178461265 21:32804865-32804887 TTAAAGGAACAGCAGGAATATGG + Intronic
1178672167 21:34601451-34601473 ATCAATGTACAGCAGTAAGGAGG - Intronic
1179095457 21:38310621-38310643 TTAGATGAACAGCAGGGATGTGG - Intergenic
1179299449 21:40093255-40093277 TTTAAGTAACAGCAGGAAGTAGG - Intronic
1180693677 22:17738578-17738600 CTGAATGGACAGGAGGAAGGGGG + Intronic
1180897408 22:19346909-19346931 AAGAATAATCAGCAGGAAGGAGG + Intronic
1182072614 22:27474375-27474397 ATGAACGAACAGCAGGAGGGAGG + Intergenic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1184913203 22:47549748-47549770 TGGCAGCAACAGCAGGAAGGTGG + Intergenic
953037307 3:39224258-39224280 TTGAATAAAGAGCTGGAAGAAGG - Intergenic
954078265 3:48196827-48196849 TTCAAGAAACAGCAGGAGGGAGG + Intergenic
955017491 3:55086650-55086672 TTCACTGAACAGCAGGAAAGAGG - Intergenic
956083192 3:65581532-65581554 TTGTATGAATAGCAGCAAGGGGG - Intronic
956690762 3:71875923-71875945 TTGCATGAGCAGGAGGAAAGAGG + Intergenic
956818211 3:72928396-72928418 TTGAATGAACTTCAGGTAGAAGG - Intronic
957380220 3:79418088-79418110 TAGAATGAACATCAGCATGGTGG + Intronic
959119024 3:102211114-102211136 TTTTATAAACAGAAGGAAGGTGG + Intronic
961448193 3:126990940-126990962 TGGAATGAACAGGTGGGAGGGGG - Intronic
962659127 3:137583379-137583401 GTGAATGAACAGTATGAAGCGGG - Intergenic
963115840 3:141728291-141728313 CTAAATGAGAAGCAGGAAGGAGG + Intergenic
964244943 3:154640969-154640991 TTGATTGACCAGCAAGAATGTGG + Intergenic
964621775 3:158726010-158726032 AGGAAAGAACAGCAGGGAGGGGG - Intronic
964676694 3:159290290-159290312 ATGTAAGAACAGCAGGAAGGGGG + Intronic
965608881 3:170524254-170524276 TTGAATGTAAAGCTGGAAAGAGG + Intronic
966227299 3:177611577-177611599 TGGAATGAACAGCTGGGAAGAGG + Intergenic
966282674 3:178251266-178251288 TTTAATGGACATCCGGAAGGTGG + Intergenic
967692563 3:192493771-192493793 TTGCAAGAACAGCACCAAGGGGG + Intronic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
969302824 4:6307312-6307334 TGGAAGGAGCAGCAGGAAGGTGG - Intergenic
970706616 4:18811937-18811959 TTGAATGAAAAGCAGGGTGTGGG - Intergenic
971990515 4:33886565-33886587 ATGAAAGAACAGCTGGAAGAGGG - Intergenic
972252960 4:37324198-37324220 TTGAATGCACAATTGGAAGGAGG - Intronic
973550033 4:52025059-52025081 GTGAATGAAAAGAAGAAAGGAGG - Intronic
973604292 4:52571227-52571249 GAGAAGGAACAGCAGGATGGAGG - Intergenic
974501859 4:62715143-62715165 TTGAATGAAAATCATGAAAGTGG + Intergenic
975645808 4:76544809-76544831 TTGATGGAACAGCAGGAAATTGG + Intronic
978286156 4:107079509-107079531 TTGAATAAACAGAAGGAATGTGG - Intronic
978653475 4:111037845-111037867 TTGAATGAAAAGCAGTCGGGGGG - Intergenic
980912169 4:139003749-139003771 GTGACTGAACAGCAAAAAGGAGG + Intergenic
981683436 4:147426513-147426535 ATGAAAGAACGGCAGGCAGGTGG - Intergenic
983502720 4:168518094-168518116 TTTCCTGAACAGCTGGAAGGAGG - Intronic
983922861 4:173365984-173366006 TTAAATGTCAAGCAGGAAGGAGG + Intergenic
984641318 4:182167363-182167385 TTGAATGAATAACAGAAAGTTGG + Intronic
985275472 4:188233753-188233775 TTGACTGAATAACTGGAAGGAGG - Intergenic
985413468 4:189711638-189711660 AGGAGTGAAGAGCAGGAAGGTGG - Intergenic
985430680 4:189876749-189876771 TGGTATGAACAGGAGGCAGGAGG + Intergenic
986237138 5:5921874-5921896 TGGAATGGACAGCAGTAAAGTGG - Intergenic
986500397 5:8392428-8392450 TTGAATTAAAAGCAGGAAATTGG + Intergenic
986669888 5:10133383-10133405 TAGAATGAAGAGCACCAAGGAGG - Intergenic
986955494 5:13145359-13145381 ATGAATGGCCAGCAGGAAGGGGG + Intergenic
987002670 5:13675969-13675991 GTGGATGAACAGGAGGCAGGTGG + Intergenic
989141258 5:38203890-38203912 TTGAAGGGAGAGGAGGAAGGAGG + Intergenic
989242899 5:39220602-39220624 ATGAATGAGTAGAAGGAAGGTGG - Intronic
989275151 5:39580268-39580290 TTGACTAGACAGCAGGAAAGGGG + Intergenic
989548061 5:42697597-42697619 CTCAATGAACAGCAGGCCGGCGG + Intronic
989673816 5:43950770-43950792 CTGAAAGAATAGAAGGAAGGAGG + Intergenic
990066440 5:51721130-51721152 TTGAAGGAGCAGCAGGAATGTGG + Intergenic
990085860 5:51976018-51976040 TTGATTGATCAGTAGGAAGTTGG - Intergenic
990470654 5:56112197-56112219 TTCAATGAGCAGAAGGATGGAGG + Intronic
991170011 5:63613900-63613922 CTGAATGAACTGCATGAAGAGGG + Intergenic
991666462 5:69004705-69004727 TTGAATCAAAAGCATGAAGCGGG + Intergenic
994478459 5:100301141-100301163 TTGACTTAACAGCAGAAAAGAGG + Intergenic
994825655 5:104710169-104710191 TTGCAGGTCCAGCAGGAAGGGGG - Intergenic
997973260 5:138421943-138421965 TTCAAAGAACAGCAAGAAGGTGG - Intronic
998601189 5:143586898-143586920 TTGAATGAATGGCAAGAGGGAGG - Intergenic
998786433 5:145714826-145714848 TAGAAAGAAGAGCAGGAAAGAGG - Intronic
999112828 5:149136993-149137015 AAGAATGACCATCAGGAAGGAGG + Intergenic
999380258 5:151116563-151116585 TTGAATGAATAGCAGGGAAAAGG - Intronic
999493023 5:152070339-152070361 TTGAAAAAACAGAAGGAAGCAGG - Intergenic
1001249524 5:170136049-170136071 TTGAAGGGCCAGCAGGAAGGAGG + Intergenic
1001328063 5:170744030-170744052 TTGTGTGAACAGCAGGGGGGAGG - Intergenic
1003768650 6:9270874-9270896 TTGAAAGAACAGCAGGCTGTAGG - Intergenic
1003964040 6:11236294-11236316 TTGGTTGAAGAGCAGGCAGGCGG - Intronic
1004184168 6:13407647-13407669 TTGAATCAAAAGCGGGAATGGGG + Intronic
1005385751 6:25282428-25282450 TTCAAGGAACAGCAAGGAGGTGG - Intronic
1007236856 6:40396639-40396661 TAGGATGAAGAGCAGAAAGGCGG + Intronic
1009439346 6:63657979-63658001 TTGAATGAACTGAAGGAAATAGG - Intronic
1011186147 6:84677735-84677757 CTGAGTGAATAGGAGGAAGGTGG - Intergenic
1011505208 6:88034111-88034133 TTGAATGAAAAGAAGAAAGCAGG + Intergenic
1011617730 6:89212380-89212402 ATGATGGAACACCAGGAAGGGGG - Intronic
1012012051 6:93801282-93801304 GTGAGCGCACAGCAGGAAGGTGG - Intergenic
1014143806 6:117973166-117973188 GTGAAAGCACAGCAAGAAGGTGG - Intronic
1015863018 6:137700132-137700154 GGGAGTAAACAGCAGGAAGGAGG + Intergenic
1016211064 6:141534227-141534249 TTAAATGAATAGCATAAAGGAGG - Intergenic
1016404996 6:143720426-143720448 TTGAAGGAAAGGCAGGAAGGAGG + Intronic
1017037641 6:150280737-150280759 TTGAATGAGCACCAGGAGGAAGG + Intergenic
1017733500 6:157339188-157339210 GTGAAGGCACAGCAAGAAGGTGG + Intergenic
1017865771 6:158441991-158442013 ATAACTGAAAAGCAGGAAGGGGG - Intronic
1017989444 6:159473337-159473359 TTGCATGATGAGCAGGAAGGAGG + Intergenic
1018650193 6:165986581-165986603 TTGAAGGAAAAGGAGGAAGGAGG - Intronic
1021015804 7:15531743-15531765 TCGCTTGAACAGCAGCAAGGTGG - Intronic
1023049964 7:36242433-36242455 ATGAATGAACAGAAGGAAGGAGG - Intronic
1023052059 7:36261421-36261443 TTGAAGGAACAGCAGTGAGTTGG - Intronic
1024153907 7:46600742-46600764 TTGTCTGTACAGCAGGAAGATGG - Intergenic
1024307944 7:47943887-47943909 GTGAGTGAGCAGCAGGAATGGGG - Intronic
1026158604 7:67849374-67849396 TTGCAGGGATAGCAGGAAGGTGG + Intergenic
1027533002 7:79358748-79358770 TGGAACCAACAGCAAGAAGGAGG + Intronic
1027842884 7:83336781-83336803 TTGAATGAACTGAAGAAAGATGG - Intergenic
1027848384 7:83416020-83416042 TTGAAAAAGCAGCAGGAATGTGG - Intronic
1027898880 7:84082326-84082348 AAGAATGAGCAGCAGGAAGTGGG + Intronic
1030319868 7:108154573-108154595 TTGAAAGAAGAGAAGGAAGTGGG + Intronic
1030367686 7:108663934-108663956 TTGAATGAAGCGAAGGACGGAGG - Intergenic
1030716315 7:112811837-112811859 CTGAATGAAGAGAAGGAATGGGG + Intergenic
1031074118 7:117196270-117196292 TTGAATGAATACCCAGAAGGGGG + Intronic
1031602209 7:123723762-123723784 TTTCAGGAACAGCAGGAAGCTGG - Intronic
1032192641 7:129773435-129773457 TTGACTGCACAGCAGGAACATGG - Intergenic
1032999266 7:137484980-137485002 TAGAAGGACCAGCAGGAAAGTGG + Intronic
1033017315 7:137684968-137684990 TTGAATGAAAAGCCAGAAGGAGG - Intronic
1033443242 7:141398631-141398653 TTGACTGTTCAGCAGGAAGCAGG + Intronic
1033479595 7:141726527-141726549 TAGACTGAACAAAAGGAAGGAGG - Intronic
1033890703 7:146009384-146009406 ATGAAAGAAGAGCAGGAAGATGG + Intergenic
1033965038 7:146965109-146965131 ATGTAAGAACGGCAGGAAGGTGG + Intronic
1035055523 7:156032562-156032584 TTTACTGAAAAGCAGGAATGAGG + Intergenic
1035963719 8:4166909-4166931 TTGAATGCTCAGCAGCCAGGTGG + Intronic
1037620402 8:20558506-20558528 GTGAAAATACAGCAGGAAGGTGG + Intergenic
1038846079 8:31230706-31230728 TGGGATGAACTGCAGGTAGGAGG - Intergenic
1041748017 8:61230652-61230674 TTGAGTGATGAGCAGGAAAGGGG - Intronic
1042732232 8:71948778-71948800 AAGAATGAAAAGAAGGAAGGGGG + Intronic
1042905273 8:73766162-73766184 GTGAATGCATAGGAGGAAGGCGG + Intronic
1043934768 8:86130739-86130761 TTCAAGTAGCAGCAGGAAGGAGG - Intronic
1047422510 8:124718704-124718726 TTGAGTGCAGAGCAGGAAGCGGG - Intronic
1047600399 8:126420452-126420474 TTTAAGCAACAGCATGAAGGAGG - Intergenic
1048529672 8:135235949-135235971 ATGAGTGAACTTCAGGAAGGGGG - Intergenic
1048603488 8:135943603-135943625 GTGCAGGGACAGCAGGAAGGAGG + Intergenic
1049015974 8:139920380-139920402 TTAAATGAATAGCAGAAAAGTGG - Intronic
1049210432 8:141384038-141384060 TTGGGTGATCTGCAGGAAGGAGG + Intergenic
1050935028 9:11385669-11385691 TGGCATGAGCAGGAGGAAGGAGG - Intergenic
1051926337 9:22331587-22331609 ATCAATGAACAGCAAGAAGCAGG - Intergenic
1052419608 9:28225164-28225186 GTGAAAGAAGAGCAGGAAAGGGG + Intronic
1054805978 9:69396081-69396103 TAGAATGCAGAGCAGGAAGAGGG + Intergenic
1055511035 9:76995791-76995813 TGGAAGGAGCAGAAGGAAGGGGG - Intergenic
1057736319 9:97664806-97664828 TAGAATGCACACCAGGAAGTAGG + Intronic
1057840504 9:98482121-98482143 ATGGATGAACTGCAGGAAGGTGG - Intronic
1058619986 9:106872714-106872736 TTCAATTGACAGCAGAAAGGGGG - Intronic
1058629167 9:106968913-106968935 TGGCCTGAAGAGCAGGAAGGAGG - Intronic
1058684297 9:107466560-107466582 TTGAATGTGAAGCAGGATGGAGG + Intergenic
1058951812 9:109910971-109910993 TTTATTGACTAGCAGGAAGGAGG + Intronic
1061237092 9:129349528-129349550 ATGAAACAAGAGCAGGAAGGGGG + Intergenic
1062406530 9:136399518-136399540 AGCAATGATCAGCAGGAAGGAGG + Intergenic
1203639488 Un_KI270750v1:146751-146773 AGGAGTGAAGAGCAGGAAGGTGG + Intergenic
1186388107 X:9130539-9130561 TTAAAGGAACATGAGGAAGGAGG + Intronic
1186404143 X:9286916-9286938 GTGCAAGAACAGCAGGTAGGTGG - Intergenic
1186697411 X:12051749-12051771 TTGAATAAACAGATGGATGGAGG - Intergenic
1187213094 X:17248928-17248950 ATGAATGTCCAGCAGGAAAGGGG - Intergenic
1187931613 X:24298484-24298506 ATAAAGGAAGAGCAGGAAGGTGG - Intergenic
1189142120 X:38618045-38618067 TGCAGTGAACATCAGGAAGGTGG + Intronic
1190445385 X:50518965-50518987 TTGAATGAACACCCAGAAGTGGG + Intergenic
1192822790 X:74662022-74662044 TTGAAAGCAGAGCAAGAAGGTGG - Intergenic
1193584764 X:83307337-83307359 TTGAATGCAAAGGAGGGAGGAGG + Intergenic
1193963791 X:87958233-87958255 TTCACACAACAGCAGGAAGGAGG - Intergenic
1199771130 X:150976043-150976065 TTGAATGAAAAGCGGGAAGTGGG - Intergenic
1201133315 Y:10971731-10971753 TGGAATGAACAGCAGTAGAGAGG - Intergenic
1201147286 Y:11072259-11072281 TTAAATGAACAGAAGGAAGCCGG - Intergenic