ID: 1149544601

View in Genome Browser
Species Human (GRCh38)
Location 17:57494039-57494061
Sequence CTACATAGCAGAAGCTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149544600_1149544601 -9 Left 1149544600 17:57494025-57494047 CCTCTGGTCACTCTCTACATAGC 0: 1
1: 0
2: 1
3: 12
4: 132
Right 1149544601 17:57494039-57494061 CTACATAGCAGAAGCTCCACTGG 0: 1
1: 0
2: 1
3: 7
4: 87
1149544598_1149544601 5 Left 1149544598 17:57494011-57494033 CCCTCGGGGTTCTGCCTCTGGTC 0: 1
1: 0
2: 2
3: 6
4: 117
Right 1149544601 17:57494039-57494061 CTACATAGCAGAAGCTCCACTGG 0: 1
1: 0
2: 1
3: 7
4: 87
1149544599_1149544601 4 Left 1149544599 17:57494012-57494034 CCTCGGGGTTCTGCCTCTGGTCA 0: 1
1: 0
2: 1
3: 22
4: 121
Right 1149544601 17:57494039-57494061 CTACATAGCAGAAGCTCCACTGG 0: 1
1: 0
2: 1
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149544601 Original CRISPR CTACATAGCAGAAGCTCCAC TGG Intronic
904947056 1:34207006-34207028 CTCCATATCAGAAAGTCCACAGG + Intronic
906100531 1:43257565-43257587 CTACCTAGCTGAGGCTCCCCTGG + Intronic
916652362 1:166843956-166843978 CAACATAGCAGAAGGTAAACAGG - Intronic
919439057 1:197604462-197604484 CAACACAGCAGAGGGTCCACAGG + Intronic
919448097 1:197735619-197735641 CTTCATGGCGGCAGCTCCACGGG - Intronic
919569284 1:199225861-199225883 CAACATAGCAAAAGCATCACAGG + Intergenic
922890901 1:229061432-229061454 CAACATAGCAGAACCTCGTCTGG + Intergenic
1064272213 10:13875758-13875780 CTACATATCACAAGCTCTAGTGG + Intronic
1070837707 10:79460760-79460782 CTGCCCAGCAGAAGCTCCACAGG + Intergenic
1071832008 10:89381246-89381268 CATCATAGCACAAGCTCCACGGG + Intronic
1072540479 10:96394499-96394521 CTACAGAGCAGCAGGTCCCCAGG + Intronic
1072936704 10:99719988-99720010 CAACATTTCAGATGCTCCACAGG - Intronic
1075446153 10:122514698-122514720 GTAGATAGAAGAAGCCCCACGGG + Exonic
1086262816 11:84961011-84961033 CTACAGAGCAGATTCTCAACAGG - Intronic
1089986585 11:122819744-122819766 ATTGTTAGCAGAAGCTCCACAGG + Intergenic
1093304846 12:17502650-17502672 TTATATAGCAGTAGCTCCATAGG + Intergenic
1101212013 12:102544073-102544095 TTACATAGCAGAAGCAGCATCGG - Intergenic
1103388446 12:120552495-120552517 CTAGGTAGCAGAGGCTCAACGGG + Exonic
1104713245 12:130999934-130999956 CTAGAAAGCAGAAGCTACTCAGG - Intronic
1104897628 12:132172101-132172123 CTCCAGAGGGGAAGCTCCACTGG - Intergenic
1108065126 13:46569636-46569658 CTGCCTAGCAGCAGATCCACAGG + Intronic
1110973656 13:81801030-81801052 GTCCAGAGCTGAAGCTCCACGGG + Intergenic
1117471574 14:56051280-56051302 CTACTTACCAGAAGCTTCAAGGG + Intergenic
1124868786 15:33520133-33520155 CTATAAAGCAGAAGGTCAACTGG - Intronic
1131550092 15:93349855-93349877 ATACACAGCAGATGCTCCATAGG + Intergenic
1131602990 15:93868903-93868925 CTGCATAGCAGAATCACCAAGGG + Intergenic
1133611426 16:7437105-7437127 CCACAGAGCAGAAGCATCACAGG + Intronic
1139746422 16:69078251-69078273 CTACATAGAACAAGCTCCCCAGG - Intronic
1140721003 16:77772158-77772180 CTTCATAGCAGAAGTTCCCAGGG + Intergenic
1141645607 16:85365864-85365886 CCACATAGCAGAAGCTCCAAAGG - Intergenic
1146044368 17:29491380-29491402 CTATATAGAAGAAGATCCAAGGG + Intronic
1149544601 17:57494039-57494061 CTACATAGCAGAAGCTCCACTGG + Intronic
1150358701 17:64509992-64510014 CTACACAGCAGAATCTTTACTGG - Intronic
1155280808 18:24237730-24237752 CCCCATAGAAGAAGCGCCACTGG + Intronic
1164437392 19:28242723-28242745 CTACAAAGAGGAAGCTACACTGG + Intergenic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
927055124 2:19359834-19359856 GGAGATAGCAGAAGCTCCTCGGG - Intergenic
935079440 2:99777833-99777855 CCACAGAGCAGATGCGCCACAGG + Intronic
939303638 2:140380733-140380755 CTACACAGCAAAGGCTTCACAGG + Intronic
940798233 2:158103496-158103518 CTACATATCAGAACCACCAGGGG - Intronic
942552890 2:177138099-177138121 CTACAAAGCAGATGCTACAGAGG - Intergenic
945328349 2:208510017-208510039 CCAGATAGCAGAACCTCAACTGG - Intronic
947850060 2:233279700-233279722 CTCCAAAGCAGAAGTTCCACTGG + Intronic
1170576365 20:17664751-17664773 TTACTAAGCAGCAGCTCCACGGG + Intronic
1172935980 20:38620702-38620724 GCACAGAGCAGAAGCTTCACTGG - Intronic
1175162377 20:57018703-57018725 CTACACAGCAGCGGTTCCACTGG - Intergenic
1177756639 21:25356577-25356599 CTGCATAGCAGGAGCTGCAAAGG - Intergenic
1178110281 21:29363315-29363337 CTACACAACAGTAGCTCCAGGGG - Intronic
1179949562 21:44702181-44702203 CCACAGAGCAAAAGCTCCAGAGG + Intronic
1181420489 22:22794460-22794482 CTAGGTAGGAGAAGCTCTACTGG - Intronic
1181918867 22:26303683-26303705 CTACATACCAGGAGCTCTTCTGG + Intronic
1183159213 22:36100123-36100145 CTACCTAGCAGAAACTTCAGGGG - Intergenic
1183654292 22:39176025-39176047 CTGCAAAGCAGAAGCTCCCAGGG + Intergenic
949915628 3:8961883-8961905 CTACAAAGCAGGAGCTTTACAGG + Intronic
949991202 3:9580694-9580716 CCACACAGCAGAAGCTGCAAGGG - Intergenic
953871928 3:46634303-46634325 GTCCATAACAGAAGCTTCACGGG + Intergenic
955024132 3:55150977-55150999 CCAGATGGCAGAAGCTCCAATGG + Intergenic
959879632 3:111428845-111428867 CTAGAAAGCAGTTGCTCCACAGG - Intronic
961341749 3:126227790-126227812 CTGCATGGCAGCAGCTCTACAGG - Intergenic
963958959 3:151286570-151286592 CTCCATGGAAGAAGCTTCACAGG + Intronic
965327184 3:167321251-167321273 CTATCTAGCAGAGGCTTCACGGG + Intronic
965545211 3:169908847-169908869 CTAATTGGAAGAAGCTCCACCGG - Intergenic
968036819 3:195554593-195554615 CTTCATGGCAGCGGCTCCACGGG - Intergenic
980643980 4:135617912-135617934 CTACATAGAGGAAACTCCAGAGG - Intergenic
984973898 4:185213271-185213293 GTACATAGGAGATGCTCAACAGG - Intronic
986790786 5:11157596-11157618 CTGCATAGCAGAAGCAGCACAGG + Intronic
987864588 5:23523097-23523119 AATCAGAGCAGAAGCTCCACAGG - Intronic
988079957 5:26402477-26402499 CTAGTTAGCAGCAGCTCCAGTGG + Intergenic
992459810 5:76950331-76950353 CTTCATGGCAGAGCCTCCACAGG - Intergenic
999530876 5:152462291-152462313 ACACAAAGCAGAAGCACCACAGG + Intergenic
1003098659 6:3160594-3160616 CTAAAGAGGAGCAGCTCCACCGG + Intergenic
1005121175 6:22390551-22390573 CTCCATAGCAGCATCTCCAAAGG + Intergenic
1005901999 6:30224854-30224876 CAACAGAACACAAGCTCCACTGG - Intergenic
1006405334 6:33841703-33841725 CAACATAGCTGGAGCTGCACTGG - Intergenic
1018550708 6:164995249-164995271 TAACATAGCAGAAGCACTACAGG - Intergenic
1019918332 7:4147671-4147693 TTACATTGCAGAAGCACCTCGGG - Intronic
1023117179 7:36873941-36873963 CTCCATAGTAGAAGCTCCTGTGG + Intronic
1028433703 7:90777583-90777605 CTACATATCAGAATCACCAGAGG - Intronic
1032146798 7:129390537-129390559 GTACATAGCAGAAAGTCCAAAGG + Intronic
1034282268 7:149862570-149862592 GTGCATGACAGAAGCTCCACAGG - Intronic
1034463408 7:151211025-151211047 GCAGATAGCAGAAGCTCCCCAGG + Intronic
1037541447 8:19875815-19875837 CTACAAGGCTGAAGCTCCAGGGG + Intergenic
1039386067 8:37136592-37136614 CTACATGGCAGAAATACCACTGG - Intergenic
1039580088 8:38658530-38658552 TTACAGAGCAGAAGGGCCACTGG - Intergenic
1042193352 8:66210385-66210407 CTGCAGAGCAGAAGAACCACTGG - Intergenic
1044501343 8:92962378-92962400 CTACATAGAAGAATGTCCACTGG + Intronic
1049694964 8:143978782-143978804 CGGCATAGCAGGAGCTCCACCGG + Intronic
1052047585 9:23812416-23812438 TTGCACAGTAGAAGCTCCACGGG + Intronic
1054259352 9:62846355-62846377 CTACATAGCAAAAGCTGAAATGG - Intergenic
1185907821 X:3953039-3953061 ATTCATGGCAGCAGCTCCACGGG - Intergenic
1193427251 X:81354979-81355001 CTACTTTGCAGAAGCAACACAGG + Intergenic
1194756122 X:97741871-97741893 CCACATTGGAGAAGCTCTACTGG + Intergenic
1194958402 X:100207889-100207911 CTGCATAGCTGAATCTCCAGGGG - Intergenic
1197170139 X:123424353-123424375 CTACAGGGAAGAAGCTCCATAGG - Intronic
1200690767 Y:6305252-6305274 CTACCTGGCACAAGCTCCAAGGG - Intergenic
1201044505 Y:9869464-9869486 CTACCTGGCACAAGCTCCAAGGG + Intergenic