ID: 1149544897

View in Genome Browser
Species Human (GRCh38)
Location 17:57496259-57496281
Sequence CTGTGGCTCTGTAGGGCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 278}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149544897_1149544904 3 Left 1149544897 17:57496259-57496281 CCGTGTGCCCTACAGAGCCACAG 0: 1
1: 0
2: 3
3: 34
4: 278
Right 1149544904 17:57496285-57496307 TGGATCCCTTTGGCCATCTGTGG 0: 1
1: 0
2: 1
3: 17
4: 192
1149544897_1149544907 11 Left 1149544897 17:57496259-57496281 CCGTGTGCCCTACAGAGCCACAG 0: 1
1: 0
2: 3
3: 34
4: 278
Right 1149544907 17:57496293-57496315 TTTGGCCATCTGTGGCTATGTGG 0: 1
1: 0
2: 4
3: 19
4: 170
1149544897_1149544902 -7 Left 1149544897 17:57496259-57496281 CCGTGTGCCCTACAGAGCCACAG 0: 1
1: 0
2: 3
3: 34
4: 278
Right 1149544902 17:57496275-57496297 GCCACAGGAATGGATCCCTTTGG 0: 1
1: 0
2: 2
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149544897 Original CRISPR CTGTGGCTCTGTAGGGCACA CGG (reversed) Intronic
900173476 1:1281703-1281725 CTGAGGCCCTGCAGGGCATACGG + Intronic
900962858 1:5936830-5936852 CTGTGGCTTTGTTGGAAACAAGG + Intronic
901000841 1:6148068-6148090 CTGTGTCTGTGTAGGGGCCAGGG - Intronic
902134775 1:14295595-14295617 GTGTGGCTCTTTGGTGCACATGG - Intergenic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903032417 1:20473355-20473377 GTGGGACTCTGCAGGGCACATGG - Intergenic
903664958 1:25000671-25000693 CTTTGGCTCTCGAGGGCAGAGGG + Intergenic
903743800 1:25573517-25573539 TTGCGGCTCAGGAGGGCACAGGG + Intergenic
904812624 1:33173195-33173217 GTGTGGCTCAGAAGTGCACAGGG - Intronic
905004317 1:34697947-34697969 CTGAGGCCCTGGAGGGGACATGG + Intergenic
905166543 1:36086471-36086493 CTGCGGGTGTGTAGGGCACGTGG + Intronic
905789097 1:40780982-40781004 CTGAGGCTCTGAGAGGCACAGGG - Intergenic
906326742 1:44850905-44850927 CTGTGGCTTTGGAGGCCAAAAGG + Exonic
906519608 1:46459307-46459329 CTGGGGCTCTGTGGAGGACAAGG - Intergenic
910357528 1:86377355-86377377 CTGTGGCTCTTCCAGGCACATGG + Intronic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
916186898 1:162142237-162142259 CAGTGGCTCTGTAAGGAAGATGG + Intronic
916533778 1:165683398-165683420 CTGAGGCTCTGAAAGTCACAGGG + Intronic
916711786 1:167417131-167417153 CTGTGGCTCTCTAGAGGAAAAGG - Exonic
918117733 1:181511195-181511217 CTGTGACTCAGGAGTGCACAGGG - Intronic
919473752 1:198010056-198010078 CTGTGGCTTTTTCAGGCACATGG + Intergenic
919515958 1:198523396-198523418 TGGTGGCTCTGTAGTTCACATGG + Exonic
922795392 1:228337187-228337209 CTCTGGCTCTCCAGGGCTCAGGG - Intronic
1062902766 10:1158308-1158330 CTGTGGCTGTGCAGGTCACGTGG - Intergenic
1063481452 10:6380250-6380272 CTGTGGCTTTTCAAGGCACATGG + Intergenic
1063987483 10:11520817-11520839 CTTTGGCTTTGTAGGTCATACGG - Intronic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067942484 10:50668346-50668368 CTGTGTCACTATAGGGCACCAGG + Intergenic
1067956319 10:50795347-50795369 CTGTGGCTTTTTCAGGCACACGG - Intronic
1069522034 10:69129950-69129972 TTGTGGCTATGTAGGGCACAAGG - Intronic
1070681376 10:78451623-78451645 CTGCTGCTCTGCAGGGCCCAGGG + Intergenic
1070719103 10:78744279-78744301 CTGTGGCACTGAAGGTCCCAAGG + Intergenic
1070863729 10:79693304-79693326 CTGTGTCACTATAGGGCACCAGG + Intergenic
1071815887 10:89232502-89232524 CTGTGCCTCTGTAGTTAACACGG + Intronic
1072568947 10:96641948-96641970 CAGTGGCTCTGTAGGTGACAAGG - Intronic
1072628706 10:97131165-97131187 GTGTGGCTCTTTAGGGCAGAAGG - Intronic
1073120922 10:101122180-101122202 CTGGGGCTCTGTTGGCCACTGGG + Intronic
1075540034 10:123304716-123304738 CTCTGTCTTTGTAAGGCACAGGG - Intergenic
1075713308 10:124542205-124542227 CAGTGGCTCTGGTGGGCACGGGG + Intronic
1075743916 10:124713079-124713101 GTGTGGCTGTGTGGGGCACATGG - Intronic
1076037587 10:127213752-127213774 CTTTGGCTGTGTAGCGCACAAGG + Intronic
1076600968 10:131656751-131656773 GTGTGACTCTGCATGGCACATGG - Intergenic
1076768837 10:132651918-132651940 CTCACGCTCTGTGGGGCACACGG + Intronic
1076863750 10:133157133-133157155 CTGTGGCTCTGGCGGAAACACGG - Intergenic
1077298173 11:1835648-1835670 CTGTGGCTCCCTCGGGCCCATGG - Intronic
1077478126 11:2800516-2800538 CTGAGGCTGTGTAGGGCCCAGGG + Intronic
1077579027 11:3405048-3405070 ATGTGGCTCTGGAGGCCACTTGG + Intergenic
1079088150 11:17461818-17461840 ATGTATCTCTGTGGGGCACATGG + Exonic
1080793100 11:35538674-35538696 CTGTGACTCTTGAGGGCACAAGG - Intergenic
1080958573 11:37130621-37130643 CTGTGGCTCTTCCAGGCACACGG - Intergenic
1081702524 11:45161194-45161216 CTGTGTGTCTGCATGGCACATGG - Intronic
1083254080 11:61485732-61485754 CTGAGCCTCTGGAGGACACATGG + Intronic
1083535706 11:63464896-63464918 CTGTGGCTTTGCAGGGGATAAGG - Intronic
1083747107 11:64742769-64742791 GAGTGGCTCGGGAGGGCACACGG - Intronic
1085414439 11:76310894-76310916 CTGTGCCTCTGAAGGGCACGGGG + Intergenic
1085415887 11:76318767-76318789 CTGTGGCTCTGTAAAGCAAGTGG + Intergenic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1086701234 11:89902093-89902115 CTGCAGTTCTGGAGGGCACAGGG + Intergenic
1086704933 11:89942434-89942456 CTGCAGTTCTGGAGGGCACAGGG - Intergenic
1087091343 11:94276547-94276569 GTGAGGCACTGTATGGCACAGGG - Intergenic
1087908572 11:103727009-103727031 CTGTGGCTTTCCAAGGCACATGG + Intergenic
1088728484 11:112659915-112659937 GTGTGGCTCTGTAGACCAAAGGG - Intergenic
1090639259 11:128716620-128716642 CAGCGGCTCTGATGGGCACACGG - Intronic
1090930776 11:131296181-131296203 CAGTGCCTATGTTGGGCACACGG + Intergenic
1092902327 12:13071546-13071568 GTGTGGCTCAGGAGGACACAGGG - Intronic
1093034215 12:14317877-14317899 CAGTGGCTCTGGAGGGAGCATGG - Intergenic
1094653570 12:32399937-32399959 CTGTGGCTCCTGAGGGCACCTGG - Intronic
1100524236 12:95405061-95405083 CTGTGGCTCTCTAGAGCAGAGGG - Intergenic
1101083807 12:101214998-101215020 CTGTGGCTTTCTCAGGCACATGG - Intergenic
1102612509 12:114124852-114124874 CTGAGGCTCAGAAGGGCAGATGG - Intergenic
1104512106 12:129390328-129390350 CTGGGGCTTTGTGGGGCACGTGG - Intronic
1104950712 12:132438715-132438737 CTGTGGCTGTGCAGGAAACAGGG - Intergenic
1107379880 13:39845399-39845421 GTGTGGATCTGTAGGGAAAATGG + Intergenic
1109941250 13:69368835-69368857 CTGTGACTCTGTCTTGCACAGGG - Intergenic
1111245705 13:85537123-85537145 CTGTGCCTTTGTATGGCAGAAGG + Intergenic
1112107882 13:96261764-96261786 CTGTGGCTCTGTAGAGAATATGG + Intronic
1113905966 13:113819320-113819342 CTGTGGCTTTGAAGGCCACAGGG - Intergenic
1114339319 14:21726641-21726663 CAGTGTGTCTGTAGGGCACATGG + Intergenic
1115191771 14:30754458-30754480 CAGTGGCTGTGTTGTGCACATGG - Intergenic
1115404797 14:33002548-33002570 CTCTAATTCTGTAGGGCACAGGG - Intronic
1118433503 14:65747205-65747227 CTGTGGCTCCTTTGGGCCCATGG + Intergenic
1118539431 14:66805837-66805859 CTGTGGCTTTTTCAGGCACACGG + Intronic
1121471212 14:94155835-94155857 CTGTGGCTTTTCAAGGCACATGG - Intronic
1122383999 14:101331578-101331600 CTTCGGCTGTGTAAGGCACACGG - Intergenic
1123401501 15:19991239-19991261 CTGTGGGTCTGTAACTCACAGGG - Intergenic
1123907271 15:24933314-24933336 CTGTGGCTCTGGAGGGCGGCTGG + Intronic
1123921782 15:25075283-25075305 CTGTACCTGTGTAGTGCACATGG + Intergenic
1125755574 15:42062373-42062395 CTGTGGATCTCTCGGTCACAGGG + Intergenic
1126117723 15:45224141-45224163 CTGTGGCTCAGAAAGCCACAAGG + Intergenic
1127711663 15:61604988-61605010 CTGAGGCTGTGTATTGCACAGGG + Intergenic
1128087964 15:64898691-64898713 CTGGGGATCTGGAGGGCAAATGG + Intronic
1128302077 15:66572315-66572337 CTGTGGCTCTGTGGGGAGCCAGG + Intergenic
1128758035 15:70196451-70196473 TGGTTGCTCTGAAGGGCACACGG - Intergenic
1129517355 15:76164861-76164883 GGATGGCTCTGCAGGGCACAGGG + Intronic
1129826148 15:78636334-78636356 CTCTGGCACTGTATGGTACATGG - Intronic
1130990083 15:88870991-88871013 CTGTGGCTCTGGGGGGCTCCAGG - Intronic
1131198765 15:90378906-90378928 CTGTGGCTTTGCCAGGCACAGGG + Intergenic
1132256938 15:100384238-100384260 TTGAGGCTCTGAAGGGGACATGG + Intergenic
1132607022 16:797825-797847 CTGTGGCCCCGCAGGGGACACGG + Exonic
1132868387 16:2104797-2104819 CTGTGGCTCTGCATGACCCAGGG + Intronic
1134146981 16:11773027-11773049 TTTAGGCTCTGTAGGCCACACGG + Intronic
1134523344 16:14928204-14928226 CTGTGGCTCTGCATGACCCACGG - Intronic
1135505656 16:23033848-23033870 CAGTGGGTCTGAAAGGCACATGG - Intergenic
1135720028 16:24808494-24808516 CTCAGGCTCTGTGGGCCACATGG - Intronic
1135877557 16:26217308-26217330 CTTTCTCTCTGCAGGGCACAAGG - Intergenic
1136559592 16:31031295-31031317 CTGTGTCTCTGAGTGGCACACGG - Intergenic
1137579374 16:49623870-49623892 CTGTGGCTAGGTAGGGACCAGGG + Intronic
1137716548 16:50601748-50601770 CTGTGGCTGTGGTGGGCTCAGGG + Intronic
1138316918 16:56078224-56078246 CTGGAGCTCTCCAGGGCACAAGG - Intergenic
1138712583 16:58986355-58986377 CTCAGGCTCTGGAGAGCACATGG - Intergenic
1140440665 16:74985086-74985108 CTCTGGCTGTGTGGGGCGCACGG - Exonic
1140472856 16:75224885-75224907 CTGAGGCTCTGTGGGGAGCAGGG - Exonic
1140730637 16:77852731-77852753 TTGTGGATCTGTAGGCCAAAAGG - Intronic
1141137915 16:81478630-81478652 CTGCGGCTCTGCAGGGCACCAGG - Intronic
1142348203 16:89567607-89567629 CTGTGCCTCTGAAGGGCGGACGG + Intergenic
1143150794 17:4806954-4806976 CCGCGGCCCTGCAGGGCACAGGG + Intergenic
1143976112 17:10831159-10831181 CTGCAGCTCTGTCGGGGACAAGG + Intronic
1144653430 17:17020947-17020969 CTGTGGCCCTGCAGGGCACCCGG - Intergenic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1145997654 17:29113770-29113792 CTGTGGCTCCCCAGGGCACCAGG + Intronic
1146596843 17:34176825-34176847 CTGTGGCACTGCTGGGCAAAAGG - Intergenic
1146963526 17:37005241-37005263 CTGTGGGTCTGTACGACAAAAGG + Intronic
1147533169 17:41298995-41299017 CTGGGGCTCTGTTTGGCTCATGG - Intergenic
1148320716 17:46749859-46749881 CTGTGGCAATGTTGGGCACGTGG - Exonic
1149544897 17:57496259-57496281 CTGTGGCTCTGTAGGGCACACGG - Intronic
1149667622 17:58376789-58376811 GTGTGGCTGTGGAGGGCTCATGG + Intronic
1151150609 17:72082610-72082632 CTGTGCCTTTGTTGGGTACAAGG + Intergenic
1151902076 17:77022928-77022950 CTGTGGCTTTTTCAGGCACAGGG - Intergenic
1152016728 17:77755900-77755922 CTGTGGCTCTGGTGGGGACAGGG - Intergenic
1152800636 17:82329206-82329228 CTGTGGCTGTGCAGGGCCCAGGG - Intronic
1154161877 18:11986514-11986536 CTCTGGCTCTTCAGGGCAGAAGG + Intronic
1154217054 18:12423142-12423164 TTGTGGCTCTCTAAGGCTCAAGG - Intronic
1155017077 18:21854270-21854292 TTTTGGCTTTGTAGGCCACATGG + Intronic
1155067463 18:22280081-22280103 CTCTGGCCCTGAAGGGGACAGGG + Intergenic
1155168236 18:23248107-23248129 CTGCGGCTCTGGAGGGGGCAAGG - Intronic
1156956263 18:42968207-42968229 CAGTGGCTCTGTACTGTACATGG - Intronic
1157528946 18:48406110-48406132 CTGTGCCTGTGTAGGGCTGAAGG - Intronic
1159883778 18:73885066-73885088 CTCAGGCTCTGCAGGGAACAGGG - Intergenic
1160266138 18:77341971-77341993 CTGTGGCCCTTTAGGGCTCTGGG - Intergenic
1160385290 18:78493056-78493078 CTGTGGCTGAGGAGGGCACGGGG + Intergenic
1160504252 18:79418124-79418146 CTGTGGGTCTGCAGGGCTCGGGG + Intronic
1160967483 19:1753071-1753093 CTGGGGGTCTGTAGGGAACGGGG + Exonic
1161684658 19:5696816-5696838 CTGTGGCCCTGGAGGGTGCATGG - Intronic
1161822209 19:6536705-6536727 CTCTGCCTCTGTTGGTCACATGG + Intergenic
1163427747 19:17248280-17248302 CTGGGGCTCGGCAGGGTACAGGG + Intronic
1164723185 19:30446602-30446624 GTGGGGCTCTTTAGGTCACACGG - Intronic
1164811610 19:31161791-31161813 TTTTGGCTCTGCAGGCCACACGG + Intergenic
1165987062 19:39778700-39778722 CTGATGCTGTGTAGGGCACTGGG - Intronic
1166749507 19:45158327-45158349 CTCTGGCTCAGCAGGGTACAGGG - Intronic
1166764056 19:45242108-45242130 CTGTGGCTCTGCAGGGCTCTTGG - Intronic
1167262299 19:48465958-48465980 GTGAGACCCTGTAGGGCACAGGG + Exonic
1167373934 19:49101375-49101397 ATGTGTATCTGTGGGGCACATGG - Exonic
1168175612 19:54625478-54625500 CTGTGCCTCTGTAGGCCAAGGGG + Intronic
1168561517 19:57388177-57388199 CTGTGGCTCTGCTGGACACTTGG - Intronic
925084991 2:1100952-1100974 ATGAGGCTCGGGAGGGCACACGG - Intronic
925393096 2:3512432-3512454 CTGAGGCTCTGTAGGGCAGAGGG - Intronic
926045083 2:9704206-9704228 GTGTGACTCTCTAGGGTACATGG + Intergenic
926870274 2:17408221-17408243 CTGTGGCTTTTTCAGGCACATGG - Intergenic
927100358 2:19783349-19783371 CTGTGGCTTTTTTGGGCACGTGG - Intergenic
927170822 2:20367899-20367921 CTGTGGCTTTGCAGGGTACACGG + Intergenic
927640660 2:24843583-24843605 CTTTGGCTCTGTGGGCCATACGG - Intronic
928244667 2:29616840-29616862 ATTTGGCTCTTTAGGGCAAAAGG - Intronic
929467666 2:42159763-42159785 CTATGGATGTGTAGGGCAGAGGG - Intergenic
931557298 2:63519245-63519267 CAGTGGCTCTGCAGGGCAGAGGG - Intronic
933668984 2:84988827-84988849 ATGTGGCTTTGTAGGCCACATGG + Intronic
934692534 2:96372609-96372631 GTGTGGATCTGTTGGACACAGGG - Intronic
936097667 2:109545126-109545148 GTGTTGCTCTGTGGGGAACATGG + Intronic
936492601 2:112985280-112985302 CTGGTGCTGTGTAGGCCACAAGG + Exonic
937855345 2:126668371-126668393 CTCTGGCTCTGGAAGGCACCAGG - Intronic
938804654 2:134795097-134795119 GTGTGGCTCTGCAGCCCACAGGG - Intergenic
939344965 2:140952033-140952055 CTGTGCCTTTGTAGAGAACAGGG - Intronic
944546009 2:200799636-200799658 CTGTGACTATGTAGGTTACATGG + Intergenic
944907387 2:204276119-204276141 CAGTGGCTCTGCAGAGCACATGG + Intergenic
946127092 2:217572461-217572483 CTAAGGGTCTGGAGGGCACAGGG + Intronic
946317101 2:218923609-218923631 CTGTGGCTTTTCTGGGCACATGG + Intergenic
946515352 2:220405342-220405364 CTGTGGCTTTTTGAGGCACATGG + Intergenic
947940643 2:234051957-234051979 CTGCTACTCTGTAGAGCACATGG + Intronic
948089838 2:235283474-235283496 GTTTGGCTCTGTGGGCCACATGG - Intergenic
948747210 2:240105622-240105644 CTCTGCCTCTATAGGGCACCAGG - Intergenic
1169105168 20:2988323-2988345 CTGGGGCTCTGCAGTACACAAGG - Exonic
1170254803 20:14328826-14328848 CTGTTACTATGTAGGACACATGG + Intronic
1174951082 20:55041958-55041980 CTGTGGCTTTTTTAGGCACATGG - Intergenic
1175247444 20:57590415-57590437 CTCTGGCTCTGGAAGGAACATGG - Intergenic
1175335213 20:58191468-58191490 CTGTGGCTCTGTAGGATGGAGGG - Intergenic
1175477920 20:59290051-59290073 CTGTTGCTCTGTAGTGAACAAGG + Intergenic
1175653198 20:60746776-60746798 CTGTGGCTTCATAGGGCAAATGG - Intergenic
1175825644 20:61935097-61935119 CTGTGGCTCTGCAGGGATCACGG + Intronic
1175907824 20:62390231-62390253 CCGTCGGTCTGTAGGACACAGGG + Exonic
1177054207 21:16279906-16279928 CTGTGGCTCTCTAGTTCATATGG + Intergenic
1177529465 21:22340962-22340984 CTGAGGCTGTGTAGGGCAGTGGG + Intergenic
1179266754 21:39810325-39810347 CTGGGGGTTGGTAGGGCACAGGG - Intergenic
1179405473 21:41122143-41122165 TTGTGGCCCTGCAGAGCACAGGG - Intergenic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1180875990 22:19175502-19175524 CTGTGCCTCTGCAGGGGACCAGG - Intergenic
1181001123 22:19988219-19988241 CTGAGGCTCAGAGGGGCACATGG - Intronic
1182279386 22:29209163-29209185 CTTTGTCTCTGTAGGGCCCAGGG - Intronic
1182692793 22:32175709-32175731 ATGTGGCTGCGTGGGGCACAAGG - Intergenic
1182742776 22:32580789-32580811 TTGAGGCTTTGCAGGGCACATGG - Intronic
1183498270 22:38162911-38162933 CTGAGGCTCTGGAGGACACACGG + Intronic
1183668493 22:39258306-39258328 CTGTGCACGTGTAGGGCACAGGG + Intergenic
1183722678 22:39571612-39571634 CTGAGGCTCAGAAGAGCACAGGG - Intronic
1183876744 22:40789283-40789305 CGGTGTCTCTGTAGGACGCAGGG - Intronic
1184502588 22:44882881-44882903 CTGTGAATTTGGAGGGCACAGGG + Exonic
1184522527 22:45003560-45003582 CTGTGGCTCTGCAGGCCCCTGGG + Intronic
1184851285 22:47122717-47122739 CTGGGTCTCTGCAGAGCACAGGG - Intronic
949676677 3:6462668-6462690 CTGTGTGTGTGTAGGGAACATGG - Intergenic
954219371 3:49143670-49143692 CTGTGGCTATTTTGGGCACCTGG - Intergenic
954375429 3:50191937-50191959 CTGTGACAGAGTAGGGCACAGGG + Intronic
954640638 3:52095762-52095784 CTGTGGCTCTGGAGAGGCCATGG - Intronic
954899068 3:54003439-54003461 CTGTGGAGCAGCAGGGCACATGG + Intergenic
955568197 3:60272455-60272477 CTGGGGCTATCTGGGGCACAGGG + Intronic
960167541 3:114420640-114420662 CTTAGGGTCTCTAGGGCACAGGG + Intronic
962120263 3:132553770-132553792 CTTTGGCTCTGAGGTGCACATGG - Intergenic
965371269 3:167864612-167864634 CTCTTGCTCTGTGGGGCTCATGG - Intergenic
967527887 3:190514849-190514871 TAGTGGCCCTGTGGGGCACAGGG + Intronic
968280335 3:197472275-197472297 CTGTGGCCCTGTGGGTCCCATGG - Intergenic
968789905 4:2652460-2652482 CTGTGGCTGTGTAGGAAGCATGG + Intronic
968929816 4:3572920-3572942 CTGTGGCACTGCAGGTCGCAAGG + Intergenic
969237045 4:5872915-5872937 CTGAGGCTCGGTAAGTCACATGG - Intronic
969315890 4:6381147-6381169 CTGTGGCACTGTTGAGCACCCGG - Intronic
971627771 4:28945079-28945101 CTGTGGCTCTATAAAACACATGG + Intergenic
974666496 4:64969236-64969258 CTGTGGCTTTGTAGGGTACAGGG + Intergenic
976831179 4:89316415-89316437 ATGAGACTCTATAGGGCACAGGG + Intergenic
977549099 4:98421765-98421787 CTGTGCCGCTGTCTGGCACATGG + Intronic
977821002 4:101472474-101472496 CTGTGGCTTTTCTGGGCACATGG - Intronic
978479636 4:109174568-109174590 CTGTGGCACTGCAGGGCATATGG + Intronic
979984322 4:127295618-127295640 CTGTGGTTTTGCAGGGTACAGGG + Intergenic
980426209 4:132630719-132630741 CTGTGGCTCTTCCTGGCACATGG - Intergenic
983301989 4:165937324-165937346 CTTTGGCTCTCAAGGACACAGGG + Intronic
984436669 4:179718640-179718662 CTGTGGCTTTTTCAGGCACATGG + Intergenic
984750328 4:183266603-183266625 CAGTGACTCTGAAGGGCTCATGG + Intronic
985627489 5:997138-997160 ATGAGGCTCTGTAGGTCAAAAGG - Intergenic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
986214679 5:5708285-5708307 CTGTGACTATGTAGGTTACATGG - Intergenic
986963371 5:13242095-13242117 CAGGGGCTCTGTCGGGAACATGG - Intergenic
987983863 5:25121490-25121512 CTGTGGCTTTTTTAGGCACACGG + Intergenic
990264816 5:54063382-54063404 GTGTGGCTCTGGTGGACACAGGG - Intronic
990429204 5:55717907-55717929 CTGTGGCTTTTTCAGGCACATGG - Intronic
990636188 5:57730410-57730432 CTGTGACTTTGTTGGGGACAGGG - Intergenic
990743770 5:58937582-58937604 CTGTGGCTGCTTAGGGCTCAGGG + Intergenic
991030775 5:62080119-62080141 ATGGGCCTCTGTAGGGCCCAAGG - Intergenic
994808300 5:104479695-104479717 CTGTGGCTCAGCAGGGTACAAGG - Intergenic
995629920 5:114121682-114121704 CTGTGGCTCTGCAGTGCCAATGG + Intergenic
995925592 5:117369699-117369721 CTGTGGCTTTGTAGGGTGCAGGG - Intergenic
997359622 5:133286574-133286596 CTGTGGCTCTCTGGAGCCCATGG + Intronic
1000523260 5:162323731-162323753 CTGTGGCTCTGTCGTGCCTAAGG - Intergenic
1001317052 5:170651072-170651094 CTCTGCCTCTGAAGGGCAGAGGG + Intronic
1001454274 5:171848702-171848724 GCCTGGCTCTGGAGGGCACATGG - Intergenic
1002360078 5:178663479-178663501 CTGAAGCTCAGCAGGGCACAGGG - Intergenic
1003880676 6:10477075-10477097 CTCTGCTTCTGTGGGGCACATGG + Intergenic
1006105476 6:31713760-31713782 CTGTTCCTCTGTGGGGCACTGGG - Exonic
1006986313 6:38178023-38178045 CTGTGGCTCTGCAAGGAACTGGG + Intronic
1007402441 6:41611160-41611182 CTGTAGCTCAGTAGGGCTCCAGG - Intergenic
1009395092 6:63190410-63190432 CTGTGGCTCTGCAAGGCTCCAGG + Intergenic
1010731366 6:79394955-79394977 CCGTGACTCTGTTAGGCACAAGG - Intergenic
1011218842 6:85033305-85033327 CTGTGGCTTTTTCAGGCACATGG + Intergenic
1014940975 6:127438023-127438045 CTCTGGCTCTGTGGGCTACATGG + Intergenic
1016126364 6:140408703-140408725 CTGTGGCTTTTCTGGGCACATGG - Intergenic
1017690157 6:156956127-156956149 CTCTGCTTCTGTAGTGCACAGGG + Intronic
1018575731 6:165258520-165258542 CTGTGGCTTTTTCAGGCACAGGG + Intergenic
1020098597 7:5382036-5382058 CTGGGGCCCTGCTGGGCACAGGG - Intronic
1020149742 7:5672829-5672851 CTGGGGCTTTCTAGGACACAGGG + Intronic
1020809492 7:12833839-12833861 CTGTGGCTTTTTCAGGCACATGG + Intergenic
1021305321 7:19024750-19024772 GTGTGGCTTTGTAGGTCCCAGGG - Intronic
1021762308 7:23913682-23913704 CTGTGGCTCTTCCAGGCACATGG - Intergenic
1022511638 7:30938570-30938592 CTGTGGCTCTGCAGGGCTGCAGG - Intergenic
1022612922 7:31895152-31895174 CTGTCCCTTTGCAGGGCACAGGG - Intronic
1022880997 7:34587256-34587278 CTGTTGATCTGAAGGGAACATGG - Intergenic
1024521746 7:50310853-50310875 CTGTGTCTCAGAAGGGCAAAGGG - Intronic
1026011738 7:66641622-66641644 CTGTGCCACTGTAGGACACAAGG + Exonic
1027411123 7:77918890-77918912 CTGGAGCTCTGTAGAGCATATGG + Intronic
1031117282 7:117681975-117681997 TTGTGACTCTGGAGGGCACAAGG + Intronic
1031433146 7:121697984-121698006 CTGTGTCTCTGGAGTACACATGG - Intergenic
1031618214 7:123905492-123905514 CTGTGGCTTTTCTGGGCACATGG + Intergenic
1033227241 7:139571780-139571802 CTGTCGCTCGGTAAGGCACTAGG + Exonic
1034743819 7:153504013-153504035 CTCTGACTCTGTAGGACCCAGGG + Intergenic
1035134059 7:156683425-156683447 CTGTGGCTCTCTAAGGCTCCAGG + Exonic
1035309059 7:157953294-157953316 CTGTGTCTCTGGAGTGCACGAGG + Intronic
1035673660 8:1439391-1439413 CAGAGGCTCCGGAGGGCACAGGG - Intergenic
1035938229 8:3866714-3866736 CTGTGGCTTTGTAGTGGCCAAGG - Intronic
1037031371 8:14109973-14109995 CTGAGACTCTGTAGGACATATGG + Intronic
1037318046 8:17617453-17617475 CACTGGCTCTGAAGGGCTCAGGG + Intronic
1038737278 8:30182395-30182417 GTGTGGCTCTGTAGGTCACGTGG + Intronic
1039805044 8:40990507-40990529 CCGTTGCCCTATAGGGCACAAGG + Intergenic
1040078020 8:43259932-43259954 CTGTGGATCTGCAGGATACATGG + Intergenic
1041005976 8:53497335-53497357 CTGAGGCTCTGCAGGGCAAAGGG - Intergenic
1043408849 8:79970631-79970653 CTGTGGTTCAGTAGTGCACAAGG - Intronic
1044944375 8:97377105-97377127 CTGTGGCTTGGTGTGGCACAGGG - Intergenic
1045239941 8:100391393-100391415 CTTGGTCTCTGTAGGGCACCTGG - Intronic
1045791304 8:105987886-105987908 CTGAGGCTGTGTAGGGCACCAGG - Intergenic
1047773464 8:128049453-128049475 CTGTGGCTCTGTAGGGTGAAGGG + Intergenic
1049498117 8:142946214-142946236 GAGTGGCTCTCTAGGGCCCAGGG - Intergenic
1049640619 8:143713512-143713534 CTGTGACACTGGAGGGGACAGGG + Intronic
1051633581 9:19162008-19162030 AAGTGTCTCTCTAGGGCACATGG - Intergenic
1052129252 9:24821782-24821804 CTCTGGCTCTGTAGGAAACTGGG - Intergenic
1052526900 9:29629899-29629921 CTGTGGCTATTTCAGGCACATGG - Intergenic
1053484529 9:38442041-38442063 CGGTGGCTCAGGAGGGCACCTGG + Intergenic
1054460463 9:65459552-65459574 CTGTGGCACTGCAGGTCGCAAGG - Intergenic
1055490899 9:76804554-76804576 GCCTGGCTCTGGAGGGCACATGG - Intronic
1055579257 9:77690833-77690855 CTGTGGCTTTTCTGGGCACATGG + Intergenic
1056116634 9:83447395-83447417 GTGTGGCCCTGTTGGGGACAGGG + Intronic
1056285462 9:85083271-85083293 TTTAGGCTCTGTAGGCCACATGG + Intergenic
1056899117 9:90582433-90582455 CTCTGGCCCTGCAGGGGACAGGG - Intergenic
1057029658 9:91765751-91765773 CTTTGGTTCTGTAGAGCCCATGG + Intronic
1059424121 9:114210289-114210311 CTTTGGCTCTGTGGGCCATACGG - Intronic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060890417 9:127184516-127184538 CTGTGGCTCTCCAGGACACTGGG - Intronic
1061289105 9:129640829-129640851 CCCTGGCTCTGTGGGTCACAGGG + Intronic
1061417975 9:130458332-130458354 CTGGGGCTCTGTATGCCAGATGG + Intronic
1062253545 9:135609957-135609979 CTGTGTCTCTCTAGGTCAGAAGG - Intergenic
1186173138 X:6898594-6898616 TTTTGGCTCTGTCGGCCACAGGG + Intergenic
1192503265 X:71666661-71666683 CTGTGGCCCTGTGGGGCTCCGGG + Intergenic
1199336946 X:146629437-146629459 CTGTGGCAGTGTAGGAAACATGG + Intergenic
1200067647 X:153511873-153511895 GAGTGGCTGTGGAGGGCACAGGG + Intergenic
1201400476 Y:13599229-13599251 CTGAGGCTCTGGAGGGCAACAGG - Intergenic