ID: 1149546410

View in Genome Browser
Species Human (GRCh38)
Location 17:57506970-57506992
Sequence ATGTGTTTAACCAAGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149546410_1149546412 12 Left 1149546410 17:57506970-57506992 CCCTGCTGCTTGGTTAAACACAT 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1149546412 17:57507005-57507027 AATTTTGTTGTACATTGACATGG 0: 1
1: 0
2: 1
3: 33
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149546410 Original CRISPR ATGTGTTTAACCAAGCAGCA GGG (reversed) Intronic
907070694 1:51531968-51531990 ATGTGTTTCAGGAAGGAGCAAGG + Intergenic
912415854 1:109508026-109508048 AAGTGTGACACCAAGCAGCAAGG - Exonic
918828024 1:189352719-189352741 ATGTGTATATCAAAACAGCATGG - Intergenic
921005916 1:211093584-211093606 ATGTGTTTAATCAGGGAACATGG - Intronic
922122102 1:222681700-222681722 AAGTGTCTAACCTAGCAACAGGG + Intronic
924915698 1:248566109-248566131 GTGGGATTAACCAAGAAGCAAGG - Intergenic
1064743187 10:18453945-18453967 CTGTTTTTAAACAAGTAGCATGG + Intronic
1065796663 10:29314321-29314343 ATGTGTTTAGCACTGCAGCAGGG - Intronic
1066643123 10:37576370-37576392 ATGTGTTTCATAAAGTAGCATGG - Intergenic
1067700684 10:48569169-48569191 CTGTGCTCAACTAAGCAGCATGG - Intronic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1072788676 10:98302057-98302079 AGTTGTTTAACCAAGCTGCCTGG - Intergenic
1078022704 11:7668883-7668905 ATGTGAGTAACCAAGGAGCATGG + Intronic
1080826280 11:35851831-35851853 AAGTGTTTTATCAAGCAGCCAGG + Intergenic
1081144978 11:39552194-39552216 GTGTTTTTAAGCCAGCAGCATGG + Intergenic
1085963574 11:81494044-81494066 AGGGGCTTAACCAGGCAGCAAGG + Intergenic
1089036900 11:115403983-115404005 GTGTGTTTTTCAAAGCAGCATGG + Intronic
1091367399 11:135033593-135033615 ATGTATTTAAGCACTCAGCATGG + Intergenic
1093625237 12:21338500-21338522 AGATTTTTAGCCAAGCAGCAGGG - Intronic
1095453936 12:42362559-42362581 AGGTGTTTCTCCAAGGAGCACGG + Intronic
1103890132 12:124232337-124232359 AGGTGGGTAACCAAGCAGCAGGG - Intronic
1104677190 12:130719398-130719420 ATGTATTCAACCCAGCAGGAAGG + Intergenic
1106625163 13:31413134-31413156 ATCTGTCTCACCAAGTAGCAAGG - Intergenic
1109392432 13:61709975-61709997 ATGTGTTTCACCATGCAGAGAGG - Intergenic
1109942757 13:69393015-69393037 ATGGGTTTCACCATGCAGGATGG - Intergenic
1110453018 13:75658121-75658143 ATATTTTTAAGGAAGCAGCAAGG - Intronic
1113297301 13:108973100-108973122 ATGTCTTTCACCGAGAAGCAAGG + Intronic
1114910721 14:27192391-27192413 ATGTGATTAGCCAAGAAGCCAGG - Intergenic
1123776772 15:23588407-23588429 AAATGTTTAAACAAGCAGAATGG - Intronic
1128637786 15:69314258-69314280 GTGGGCTTAACCAAGCAGGAAGG + Intronic
1137655523 16:50154562-50154584 ATGTGTTTAACTAAGGGGGATGG - Intronic
1138517956 16:57548153-57548175 ATGTGTATAGCCAGGCACCATGG - Intronic
1138921558 16:61536336-61536358 ATTAGTTCAGCCAAGCAGCATGG - Intergenic
1145040660 17:19575863-19575885 ATGTATTTAACCATGCAAAAGGG + Intronic
1146527893 17:33582404-33582426 ATGTGTTCAACCGAGAGGCAAGG + Intronic
1149546410 17:57506970-57506992 ATGTGTTTAACCAAGCAGCAGGG - Intronic
1151126952 17:71855504-71855526 CTGTTATTAACAAAGCAGCATGG + Intergenic
1152805572 17:82354248-82354270 ATGTGTTTGACAGAACAGCAAGG + Intergenic
1157904815 18:51560407-51560429 AGGTGTTAAACCATGAAGCAAGG - Intergenic
1158132200 18:54164569-54164591 ATGTGTTAAGCCAAACAGCAGGG + Exonic
1159235274 18:65663537-65663559 AGATTTTTAACCAAGAAGCAGGG + Intergenic
1163065522 19:14790328-14790350 ATTTGTAAAAACAAGCAGCAGGG + Intergenic
1163437581 19:17304523-17304545 ATGTGAGTGGCCAAGCAGCAAGG - Intronic
1167025471 19:46913508-46913530 ATTTGTTTAACCAAGACACAAGG - Intergenic
926239259 2:11072407-11072429 AGGTGAATAACCAAGGAGCAAGG - Intergenic
931852981 2:66272014-66272036 ATGTGTCTATCCCAGAAGCAAGG + Intergenic
933544144 2:83688612-83688634 AAGTGCTTCAGCAAGCAGCATGG - Intergenic
935411744 2:102771616-102771638 CTGTGATTATCCCAGCAGCATGG + Intronic
936562622 2:113554762-113554784 ATGTGGTTATCCAAACATCAAGG - Intergenic
937390872 2:121485260-121485282 ATGCCTTTGACTAAGCAGCAGGG + Intronic
942295019 2:174508453-174508475 CTGTGTTTACTCAAGCACCAAGG - Intergenic
943066721 2:183094800-183094822 ATCTGTTTAAATAATCAGCAAGG - Intronic
943078283 2:183225146-183225168 ATGTGCTAAGCCAGGCAGCAAGG + Intergenic
946148431 2:217748171-217748193 ATGTCTGTACCCCAGCAGCAGGG - Intronic
948619160 2:239223182-239223204 ATGTGTTTCACCTAACAGCTGGG + Intronic
1168791376 20:578689-578711 ATGTGATTAACCAAACATCATGG + Intergenic
1169689258 20:8312010-8312032 ATCTGTATATGCAAGCAGCATGG - Intronic
1170421121 20:16194313-16194335 TTGTGTTTCTACAAGCAGCAAGG + Intergenic
1172019991 20:31907386-31907408 ATGTGTGTATCCATGCATCATGG - Intronic
1172260097 20:33556812-33556834 ATTTTTTTAACCAATCAACAAGG - Intronic
1176977116 21:15334859-15334881 GTGTGTTTAAGCCAGCAACAGGG - Intergenic
1178485280 21:33015568-33015590 ATGGCTTTAACAAAGCAGAAGGG + Intergenic
1178485435 21:33016921-33016943 ATAGGTTTAACAAAGCAGAAGGG - Intergenic
1182889404 22:33804529-33804551 GTGTGTTTTACTGAGCAGCAGGG - Intronic
954774041 3:52999734-52999756 ATGTTTCCACCCAAGCAGCAGGG + Intronic
956979457 3:74618369-74618391 ATGTGTTTAACTTAGTAGCTTGG - Intergenic
958536946 3:95415977-95415999 ATGAGTTTAGCAAAGCAGCAGGG + Intergenic
959334941 3:105052319-105052341 CTGTTTTTAACATAGCAGCAAGG + Intergenic
960163070 3:114371461-114371483 ATATCTTTAACCACGCTGCATGG + Intronic
960363516 3:116743215-116743237 ATGTATTTAACCAATCATAATGG + Intronic
961409985 3:126713381-126713403 ATGCCTTTAACCAAGAGGCAAGG - Intronic
971612030 4:28737903-28737925 ATGTGTTCTTCCAGGCAGCAAGG - Intergenic
972757467 4:42063352-42063374 AAGATTTTAACCAAGGAGCAGGG - Intronic
972797521 4:42436692-42436714 CTGTGTTTAGCCAAGTAGCCTGG - Intronic
974652486 4:64773432-64773454 ATGTGTTTAATCAGACAGAAAGG - Intergenic
975655925 4:76641262-76641284 ATGTGTTTATCCATTCATCAAGG - Intronic
976234567 4:82882569-82882591 ATGTGTTTATCCAACTAGGATGG + Intronic
980789540 4:137602222-137602244 ATGTGATTAACAAAGAGGCATGG - Intergenic
980852549 4:138400632-138400654 ATGTGTTTGTTCAATCAGCATGG - Intergenic
984791473 4:183618840-183618862 TAGTGTTTAACCAAGCAGCTGGG + Intergenic
986360906 5:6977169-6977191 ATGTGTGTACCCTAGCAGTATGG - Intergenic
986854269 5:11850882-11850904 ATGTGCTTGACCAAACAGCTGGG - Intronic
988916834 5:35903097-35903119 AGGTATTTCACCCAGCAGCAAGG + Intergenic
989849008 5:46184579-46184601 ATGTGTTCATTCAAGTAGCAGGG + Intergenic
991307981 5:65201492-65201514 ATGTGTTAAACCAAGAAGGATGG + Intronic
994060163 5:95466713-95466735 CTGTATTTAAGCAAGAAGCAAGG - Intronic
994238000 5:97388028-97388050 ATTTTTTTAATCAAGAAGCAGGG - Intergenic
994580737 5:101638859-101638881 ATGTGTTTTTCACAGCAGCAAGG + Intergenic
994876881 5:105435383-105435405 ACATGTTTAACCAAGAAGCTGGG + Intergenic
997975818 5:138440721-138440743 TTGTGTGTAACCAAGGATCATGG + Intronic
998594106 5:143510096-143510118 ATCTGTTTGACTAACCAGCAAGG + Intergenic
999529373 5:152445559-152445581 AAGTGTCTTACAAAGCAGCATGG - Intergenic
1000383656 5:160652040-160652062 GTGTGATTAAACAGGCAGCAGGG - Intronic
1007115189 6:39338442-39338464 ATTTGTTTAATTAAACAGCAAGG - Intronic
1012470416 6:99567738-99567760 ATTTGTTTAAGCAGGCAGGAAGG - Intronic
1014137430 6:117906561-117906583 ATGAGGTAAACCACGCAGCAGGG - Intergenic
1018304992 6:162445529-162445551 ATTTTTTTAAACAATCAGCAGGG + Intronic
1018342332 6:162864193-162864215 ATATTTTTATTCAAGCAGCATGG - Intronic
1019990625 7:4688025-4688047 ATGTATTTAAAAAAGCAGCTGGG - Intronic
1020379776 7:7530639-7530661 GTGTGTTTTACAAAGCAGCAAGG + Intronic
1021665821 7:22978601-22978623 ATGTGTTTTACCAGGAAGAAAGG - Intronic
1022292730 7:29019885-29019907 GAGTGTTTTACCACGCAGCAAGG - Intronic
1022872143 7:34490684-34490706 ATGTGTTTTAACAAGCATCCTGG - Intergenic
1023564792 7:41513434-41513456 ATTTGTATTACCAAGGAGCATGG - Intergenic
1025925696 7:65958196-65958218 AAATGTTTAACCAAGTAGCCGGG - Intronic
1028245749 7:88474820-88474842 ATGTGGGTAACCAGGCAGTATGG - Intergenic
1030358713 7:108571088-108571110 AAATGTTTAACCAGGAAGCATGG - Intronic
1031208922 7:118796929-118796951 ATCTGTTTACCCAACCAGCTAGG - Intergenic
1032454805 7:132065257-132065279 ATGTCTTTAACCAGCCAGCCTGG - Intergenic
1034789362 7:153954116-153954138 AAGTGTTTGACCAAACAGCTGGG + Intronic
1039583684 8:38687457-38687479 TTTTAATTAACCAAGCAGCACGG + Intergenic
1041291298 8:56310802-56310824 ATGAGTATAAGCAAGCACCAAGG + Intronic
1041765673 8:61415688-61415710 ATGTGTGAAAGCAAACAGCATGG - Intronic
1045126369 8:99094619-99094641 AGGTGTTTTACAAAACAGCATGG - Intronic
1046274683 8:111942774-111942796 ATGAGTTTTCCTAAGCAGCATGG - Intergenic
1046693154 8:117308653-117308675 ATGTTTTCTACCATGCAGCAAGG - Intergenic
1049890111 9:60935-60957 ATGTGGTTATCCAAACATCAAGG + Intergenic
1051538360 9:18185893-18185915 ATGTGTTTGACCATGGAACATGG + Intergenic
1053731582 9:41062202-41062224 ATGTGGTTATCCAAACATCAAGG + Intergenic
1054696925 9:68369885-68369907 ATGTGGTTATCCAAACATCAAGG - Intronic
1057195477 9:93113900-93113922 CTGTGATGACCCAAGCAGCAGGG - Intergenic
1058077092 9:100662113-100662135 ATGTTTTCTACCAAGCAGGAAGG + Intergenic
1061657266 9:132102056-132102078 TTGGGTTTAATCAAACAGCAAGG - Intergenic
1186633900 X:11381075-11381097 ATGTATTTAATCAAGTGGCATGG + Intronic
1188843341 X:35043226-35043248 ATGTGTTTCACCTAGCATTATGG + Intergenic
1191994872 X:67082492-67082514 ATGGGTTTAACCAACCACCATGG - Intergenic
1192320769 X:70088895-70088917 ATGTGATTAACCAAGCAAACAGG - Intergenic
1192725114 X:73741777-73741799 ATGTGTTTAGAGAACCAGCATGG - Intergenic
1196241415 X:113346717-113346739 ATCTGTTTAAAAAAGCAGCCTGG + Intergenic
1197521422 X:127502476-127502498 GTGTATTTCACCAAGAAGCAAGG + Intergenic
1201617112 Y:15912855-15912877 ATGTGATTCCCCCAGCAGCATGG + Intergenic