ID: 1149546543

View in Genome Browser
Species Human (GRCh38)
Location 17:57508137-57508159
Sequence AGGATGGCTTTCCTCTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149546543_1149546546 9 Left 1149546543 17:57508137-57508159 CCAGGACAGAGGAAAGCCATCCT 0: 1
1: 0
2: 3
3: 6
4: 180
Right 1149546546 17:57508169-57508191 GTCACCCATTCCCTTGCCTGTGG 0: 1
1: 0
2: 1
3: 23
4: 252
1149546543_1149546551 20 Left 1149546543 17:57508137-57508159 CCAGGACAGAGGAAAGCCATCCT 0: 1
1: 0
2: 3
3: 6
4: 180
Right 1149546551 17:57508180-57508202 CCTTGCCTGTGGCCCGCTATTGG 0: 1
1: 0
2: 0
3: 2
4: 69
1149546543_1149546552 24 Left 1149546543 17:57508137-57508159 CCAGGACAGAGGAAAGCCATCCT 0: 1
1: 0
2: 3
3: 6
4: 180
Right 1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149546543 Original CRISPR AGGATGGCTTTCCTCTGTCC TGG (reversed) Intronic
900034314 1:394282-394304 TGTAGTGCTTTCCTCTGTCCTGG - Intergenic
900055148 1:624174-624196 TGTAGTGCTTTCCTCTGTCCTGG - Intergenic
900465441 1:2822981-2823003 AGGACAGCTTGCCTCAGTCCTGG - Intergenic
900625986 1:3608816-3608838 AGGATGGCTGGCCTCCTTCCTGG - Intronic
903779553 1:25812653-25812675 ATGATGGCTTCGCTCTGTCTCGG + Intronic
905637450 1:39564354-39564376 AGGATGACTAGGCTCTGTCCTGG - Intronic
906417712 1:45634176-45634198 AGGATCCCTTTCCTCTAGCCGGG - Exonic
907045487 1:51297704-51297726 GGGATGTCTTTCTGCTGTCCTGG + Intronic
910400806 1:86836160-86836182 TGGATGTCTTTCTTCTGTGCTGG + Intergenic
912274888 1:108245853-108245875 AGGAGGGCACACCTCTGTCCTGG - Intergenic
912286377 1:108373939-108373961 AGGAGGGCACACCTCTGTCCTGG + Intergenic
912293331 1:108448504-108448526 AGGAGGGCACACCTCTGTCCTGG + Intronic
912389030 1:109288946-109288968 AGTAGGGCTTCCCTCTCTCCAGG + Intergenic
914433684 1:147641517-147641539 AGCCTGGCTCTCCTCCGTCCTGG + Intronic
916848127 1:168674230-168674252 AGGATGGTTTTCCTTTGTCATGG + Intergenic
917669565 1:177260175-177260197 AGGATGTCTTTCCTCAGTGGAGG + Intronic
922325253 1:224522415-224522437 AGGATGGTTGTCATCTGTCCTGG - Intronic
924337875 1:243001332-243001354 TGTAGTGCTTTCCTCTGTCCTGG - Intergenic
1067217537 10:44315633-44315655 AGGATGGTTTTGCTCAATCCTGG + Intergenic
1067286856 10:44913175-44913197 AGGGTGGCCTTCCTCTCCCCAGG - Intronic
1067756349 10:49008729-49008751 AGGATGGCTTTCTTCTCTCCTGG - Intergenic
1072805634 10:98422553-98422575 GGGACGGCCTGCCTCTGTCCTGG + Intronic
1074185969 10:111099687-111099709 AGGAAGGCTTTCCTGAGCCCCGG + Intergenic
1076084087 10:127610036-127610058 AGGAAGGATAACCTCTGTCCTGG + Intergenic
1076311646 10:129511960-129511982 AGTCTGGCTGTCCTCTTTCCAGG + Intronic
1076511339 10:131015822-131015844 AGGAGGGCTGGGCTCTGTCCTGG + Intergenic
1081456608 11:43229566-43229588 AAGATGGCCCTGCTCTGTCCAGG - Intergenic
1082279064 11:50250853-50250875 AAGATGGCTCTCCTCTTACCGGG + Intergenic
1082998269 11:59269541-59269563 AGGATGGTTTTCCTGTTTCTGGG + Intergenic
1087442095 11:98199309-98199331 ATGATTGCTTTGCCCTGTCCCGG + Intergenic
1090265438 11:125350549-125350571 AGGAGGACTTTCCTCAGTCTTGG - Intronic
1091119025 11:133041520-133041542 AGGATGCCTTTCTCCTTTCCTGG - Intronic
1104875237 12:132029402-132029424 AGAATGGCTTATCTCTGACCTGG + Intronic
1107784005 13:43936046-43936068 AGAATGTCTTTCCTCCATCCAGG - Intergenic
1110519624 13:76459871-76459893 AAAATGGCCTTCCTCTTTCCTGG - Intergenic
1110660388 13:78053853-78053875 AGAATAGCTTTCCTCAGTCAAGG + Intergenic
1115936128 14:38554794-38554816 AAGATGACTTTCCTATGTCGAGG + Intergenic
1118463614 14:66010817-66010839 GAGATGGCTTTCCTCTGTTATGG + Intergenic
1118862280 14:69673737-69673759 CGGATGCCTTTCCTCAGTCTGGG + Intronic
1121631097 14:95422556-95422578 AGGATGGGTGTGCTCTGACCTGG + Intronic
1122127423 14:99586836-99586858 GGTAGGGCTTTCCTCTGGCCGGG - Intronic
1122230191 14:100303126-100303148 AGGATGGATTTCCTGTTTCCAGG - Intronic
1126432277 15:48598727-48598749 AGGCTGCCTCTCCTCTCTCCAGG + Intronic
1126455946 15:48862231-48862253 AGCATGGCCTTCCTATATCCAGG + Intronic
1126864943 15:52926041-52926063 TGGCTGACATTCCTCTGTCCAGG + Intergenic
1127399392 15:58571208-58571230 AGGGTGCCCTTCCTCTTTCCTGG - Intergenic
1127554483 15:60073882-60073904 AGGCTGGCTTCCCTCTGTTATGG - Intergenic
1128450772 15:67804831-67804853 GGGAAGGATTTCCTCTGTCTAGG + Intronic
1128504136 15:68254572-68254594 AGCGTGGCTTTGATCTGTCCTGG - Intronic
1129192250 15:73944351-73944373 AGGCAGCCTGTCCTCTGTCCTGG + Intronic
1129959114 15:79667288-79667310 GTGATGCCTTTCCTCTGGCCTGG + Intergenic
1136022491 16:27449001-27449023 GGGGTGGCTTTAGTCTGTCCAGG - Exonic
1137945306 16:52728411-52728433 AGGAGTGCTTTGCTCTTTCCTGG + Intergenic
1138534837 16:57654260-57654282 AGGATGGCTATCCTCGGGCCTGG - Intronic
1138740772 16:59307140-59307162 AGAATAGCTTTTCTCTCTCCCGG - Intergenic
1139415838 16:66809075-66809097 AGAATATCTTTCCTCTGTTCAGG - Exonic
1143247567 17:5499722-5499744 AGGATGGCTTCGTTCTGGCCCGG - Intronic
1144161565 17:12565526-12565548 AGGAAGGCTTTCATTTTTCCTGG - Intergenic
1146150473 17:30464663-30464685 AGGATGGCTTTCATCGGCTCAGG + Exonic
1146716816 17:35093080-35093102 ATGACAGCTTTCTTCTGTCCAGG - Intronic
1148346494 17:46907077-46907099 AAGATGGCTTTCCTCTCCACCGG + Intergenic
1149546543 17:57508137-57508159 AGGATGGCTTTCCTCTGTCCTGG - Intronic
1150291794 17:63986606-63986628 AGGATGGCTTTGTTCAGTTCTGG - Intergenic
1151408741 17:73906892-73906914 CGAATGGCTTCCCTCTATCCAGG - Intergenic
1152075665 17:78158250-78158272 AGGCTGGCTTGGCTCTGCCCTGG + Intronic
1152793781 17:82296646-82296668 AGGATGGCTTTCTGGTCTCCTGG + Intergenic
1155437150 18:25825399-25825421 AGTTTTGCTTTCCTGTGTCCTGG - Intergenic
1158638600 18:59182832-59182854 AGGAATGCTTTCCTCTGGCTGGG + Intergenic
1160045345 18:75381482-75381504 GACATGGCTTTCCTCTCTCCAGG + Intergenic
1162413037 19:10517765-10517787 CGGAGGGGTCTCCTCTGTCCTGG + Intronic
1164526619 19:29017823-29017845 AGGATGGCCTGGCTCTGGCCAGG - Intergenic
1166742980 19:45125476-45125498 AGCTTGGCTTTCCTCTGAGCTGG + Intronic
924983011 2:240227-240249 AGCTTGGCTTGCCTCTGTCAGGG - Intronic
925691054 2:6523646-6523668 GGGAGTGCTTTCCTCTGTCTTGG - Intergenic
925992255 2:9263122-9263144 ATGCTGGCTTTCCACTGTCTCGG + Intronic
926280082 2:11438906-11438928 ACTTTGGCTTTCCTCTGTTCGGG - Intergenic
930051576 2:47220087-47220109 AGAATGCCTTTCCTCCATCCTGG - Intergenic
932347080 2:71002412-71002434 TGAATGGCTTTCTGCTGTCCTGG - Intergenic
934122430 2:88853287-88853309 AGGATGGGTATCCTTTCTCCAGG - Intergenic
936388043 2:112047942-112047964 AGGGTTGGTTTCCTCTCTCCTGG + Intergenic
937338588 2:121076799-121076821 AGTCTGGCTTCCATCTGTCCTGG + Intergenic
940239320 2:151546094-151546116 AGCAGGGCTTTCATGTGTCCTGG + Intronic
942220090 2:173760388-173760410 GAGATGGCTTTGCACTGTCCGGG - Intergenic
944799672 2:203227311-203227333 AGGATGGCCTTTCTCTTTCTGGG - Intergenic
946455783 2:219824915-219824937 AGGAGGGCTTTCCTGAGGCCTGG + Intergenic
946986762 2:225282126-225282148 ATGCTGGGCTTCCTCTGTCCTGG + Intergenic
947223754 2:227820501-227820523 AGGATGCCTTTGCTCTCCCCTGG + Intergenic
947704203 2:232261230-232261252 AGGCTGGGCTTCCTCTGTCCAGG + Intronic
948391680 2:237616018-237616040 AGGAGGGCTGTCCTCTTTCTCGG + Intergenic
948800590 2:240431691-240431713 AGGCTTGCTCTCCTCTGACCTGG + Intergenic
1168948944 20:1783342-1783364 AGGCTGGCTTTTCTTTTTCCAGG + Intergenic
1171499341 20:25581103-25581125 TAGATAGCTTTCCTCTTTCCTGG - Intronic
1172334703 20:34105447-34105469 AGGCTGGGTTTCCTCTGTTTGGG + Exonic
1173165118 20:40682668-40682690 AGGCAGGCTTCCCTCAGTCCCGG - Intergenic
1173290262 20:41708711-41708733 ACGTTGGCTTGCCTTTGTCCTGG + Intergenic
1174603016 20:51739852-51739874 AGGATGTCTGTCCCCTGCCCAGG - Intronic
1175068250 20:56308899-56308921 GGGATGGCATTGCCCTGTCCTGG + Intergenic
1181027736 22:20135474-20135496 AGGCTGGCTTATCTCTGTCTGGG + Intronic
1181266048 22:21631590-21631612 AGGGTGACTTGCCTCTGTTCTGG + Intergenic
1182508734 22:30803568-30803590 AAGATGGCTGGCCTCTGTCTGGG - Intronic
1183640959 22:39092160-39092182 CTGATGCCTTCCCTCTGTCCTGG + Intergenic
1184113968 22:42411395-42411417 AGGAAGCCTTACCTCTGACCAGG + Exonic
1184229385 22:43150633-43150655 AGTATGGCTTTCCTAGGACCTGG - Intergenic
1184641030 22:45870227-45870249 TGGCTTGCTTGCCTCTGTCCAGG + Intergenic
1184683343 22:46084872-46084894 AGGGTGGTTTTCCCCAGTCCAGG + Intronic
1185060991 22:48606909-48606931 ACGCTGGCTTGCTTCTGTCCAGG + Intronic
952357815 3:32601010-32601032 AGGATCGCTTGCCTCAGCCCGGG - Intergenic
952577158 3:34789154-34789176 AGGTTGCCTTTCTTCTTTCCTGG - Intergenic
953451205 3:43007956-43007978 AGGATGGCTTCCAGCTCTCCGGG + Intronic
954083273 3:48224759-48224781 AGGAGGGGCTTTCTCTGTCCTGG - Intronic
954395944 3:50293364-50293386 AGAAAGGCTTCCATCTGTCCTGG + Exonic
954718436 3:52539034-52539056 ATGATGACTTTCCTCTGTGAAGG + Intronic
955350374 3:58189128-58189150 TGGGTGCCTTTCCTCTTTCCGGG + Intergenic
956202336 3:66719462-66719484 AGGAGGGTTTTCTTCTGTCAGGG - Intergenic
959176038 3:102911980-102912002 AGGATGTCTCTCCTGTGGCCTGG + Intergenic
960041080 3:113150367-113150389 GGGATGTCTTTCCTGTGCCCTGG + Intergenic
961104692 3:124231090-124231112 AGCATGGCTTTCCTTTTGCCTGG - Intronic
961106631 3:124248339-124248361 AGGTTCTCTTTCCTCTGTCCGGG + Intronic
961456684 3:127028090-127028112 AGCGTGGCTGCCCTCTGTCCTGG + Intronic
961834783 3:129648461-129648483 AGGAAGGCTTTCCACTCTACTGG - Exonic
964452609 3:156826384-156826406 ACGATGGCTTTCCTCAGCCTGGG + Exonic
964550385 3:157878742-157878764 AGGATGGCTTTGTACTGTCTGGG - Intergenic
969710638 4:8841053-8841075 GGGTTGGCTTTTCTCAGTCCTGG + Intergenic
972332212 4:38074442-38074464 AGGATCGATTTCCCCTGTGCTGG + Intronic
974151464 4:58015544-58015566 AAAATGGTTTTCCTCTCTCCAGG - Intergenic
976371489 4:84293695-84293717 AGTATGCCTTTCCTCTTTTCTGG + Intergenic
976701115 4:87969537-87969559 AGATTGGCTTGCCTCTTTCCTGG - Intergenic
978374428 4:108060128-108060150 AGGATGGCTACCTTGTGTCCTGG - Intronic
979239262 4:118434000-118434022 TGTAGTGCTTTCCTCTGTCCTGG + Intergenic
979667399 4:123327494-123327516 AGCATTTCTTTCCTCTCTCCAGG + Intergenic
979801449 4:124914104-124914126 AAAATGGCCTTCCTCTGTCTTGG + Intergenic
985083814 4:186293016-186293038 GGGAGGGCTTCCCTTTGTCCAGG + Intergenic
985667064 5:1186835-1186857 AGGATGTCTCTGCCCTGTCCTGG + Intergenic
985859115 5:2456391-2456413 AGGAAGTCTTCCCTCTGGCCAGG + Intergenic
991506800 5:67333431-67333453 AGGAGGGTTATCCTCTCTCCAGG - Intergenic
992094947 5:73354126-73354148 AGGCAGGCTCTCCTCTGTGCAGG + Intergenic
992754202 5:79889036-79889058 AGGAAGGGATTCCTGTGTCCTGG - Intergenic
993306425 5:86280696-86280718 AGGAGGGCACACCTCTGTCCTGG + Intergenic
995516627 5:112960596-112960618 AGGAAGGATTTCCTCTTTCTAGG - Intergenic
997633760 5:135389741-135389763 AGGAGGGTTTTCCTCTGGACTGG - Intronic
999459426 5:151745211-151745233 AGTGTGGCTAGCCTCTGTCCAGG + Intronic
1001115299 5:168934305-168934327 AGTCTGGCTTTCCTCTTTGCTGG + Intronic
1001548278 5:172584123-172584145 TGGACGTCTTCCCTCTGTCCTGG - Intergenic
1002739506 5:181424586-181424608 TGTAGTGCTTTCCTCTGTCCTGG + Intergenic
1003868517 6:10383719-10383741 TGGATCGCTTTCCTCGGCCCAGG - Intergenic
1006592723 6:35170107-35170129 AGGATGGCTTCCCTTTCTCAGGG - Intergenic
1006697451 6:35943291-35943313 AGGCTGGCTTACCTTTGGCCTGG + Intergenic
1006939201 6:37740492-37740514 AGGATAGCTTTCCTGGGTCTTGG + Intergenic
1008120149 6:47605434-47605456 AGGCTGGCTGACCTCTGACCTGG - Intronic
1013166657 6:107600090-107600112 CTAATGTCTTTCCTCTGTCCTGG + Intronic
1014231085 6:118903331-118903353 AGGCTGGCTGTCCCCTATCCTGG + Intronic
1015262816 6:131257749-131257771 AGGCTTACTTTCCTCTGTGCTGG - Intronic
1015621401 6:135135720-135135742 GGGATGGCTGTGCTCAGTCCAGG + Intergenic
1016008182 6:139110831-139110853 AAGAGGGCCATCCTCTGTCCAGG + Intergenic
1016909732 6:149186039-149186061 AGGATGGCTGTCCTGTGTGGAGG + Intergenic
1019244622 6:170700157-170700179 TGTAGTGCTTTCCTCTGTCCTGG + Intergenic
1022965473 7:35467640-35467662 AGCAGGGCTCTCCTCTGACCAGG - Intergenic
1024460929 7:49658687-49658709 AGGAGGGCTCCCCTGTGTCCTGG + Intergenic
1032524721 7:132571357-132571379 AGGATGGCTATCCCCTGACATGG + Intronic
1034068688 7:148161584-148161606 AAGATGGCTGTCCCCTGTCTAGG - Intronic
1034949048 7:155284717-155284739 AGCCTGGCTGTCCTCAGTCCAGG - Intergenic
1035038593 7:155911388-155911410 AGGATTGCTTTAGTCAGTCCAGG - Intergenic
1035503504 8:108019-108041 TGTAGTGCTTTCCTCTGTCCTGG - Intergenic
1035827451 8:2659926-2659948 AGGATGGCCCTTCACTGTCCTGG + Intergenic
1036054253 8:5232759-5232781 AGGATATCTTTCCTATGGCCTGG - Intergenic
1036646643 8:10615042-10615064 AAGATGGCTTTGCCCAGTCCTGG + Intronic
1036728241 8:11239446-11239468 AGGTTGACTCTCCTCAGTCCTGG + Intergenic
1037736143 8:21567865-21567887 AGAATGCCTATTCTCTGTCCTGG + Intergenic
1037973760 8:23193903-23193925 AGGATGGAGTTCCTGTATCCAGG + Intronic
1045906669 8:107354127-107354149 AGAATGACTTTCCTGGGTCCTGG - Intronic
1047605693 8:126472040-126472062 AGGAGGGCTTCCCTTTGTACTGG + Intergenic
1049493414 8:142916906-142916928 AGGATGGCCGTCCTCTGGGCCGG + Intronic
1049662246 8:143824679-143824701 AGGATGGCTTTCTTTTGCCTGGG - Intronic
1052122009 9:24729736-24729758 AGGATGCCTTACCTTTGCCCTGG + Intergenic
1055407458 9:75989558-75989580 ATGATGGCTTTCCTCTGTTCTGG + Intronic
1055725661 9:79225613-79225635 AGCATGGGTTTCCTTTGTCTAGG - Intergenic
1060221723 9:121767657-121767679 AGGATGGCCTTCCTCTGTTCTGG + Intronic
1203604812 Un_KI270748v1:49387-49409 TGTAGTGCTTTCCTCTGTCCTGG + Intergenic
1186311138 X:8320324-8320346 GGGATGGCTGTACTCTGTCGAGG - Intergenic
1189624810 X:42885330-42885352 AAGAAGGCTTTCTTCTGACCTGG + Intergenic
1190997327 X:55622867-55622889 CAGCTGGCTTTCCTCTCTCCAGG - Intergenic
1191955071 X:66635276-66635298 AGGATGGCTATACTTTGTCTTGG - Intronic
1193916484 X:87370771-87370793 AAGATAGCTCTACTCTGTCCAGG - Intergenic
1197446499 X:126556320-126556342 AGAATGGGTTTACTCTGTCTTGG - Intergenic
1197950429 X:131890160-131890182 AACATGGTTTTCCCCTGTCCAGG + Intergenic
1198313088 X:135438746-135438768 AGGAGGGCCCTCCCCTGTCCCGG - Intergenic
1199736183 X:150688884-150688906 AGGAGGCCTTTCCTGTTTCCTGG + Intergenic
1199844185 X:151678911-151678933 AGGAAGGCTTTCCTGGGGCCTGG - Intergenic
1200805905 Y:7433609-7433631 ATGTTCGCTTTCCTGTGTCCAGG - Intergenic
1201978518 Y:19880912-19880934 AGGATGGCCAGCCTCTGTGCAGG - Intergenic