ID: 1149546544

View in Genome Browser
Species Human (GRCh38)
Location 17:57508153-57508175
Sequence GGGTGACGAAGCACTCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149546544_1149546546 -7 Left 1149546544 17:57508153-57508175 CCATCCTGAGTGCTTCGTCACCC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1149546546 17:57508169-57508191 GTCACCCATTCCCTTGCCTGTGG 0: 1
1: 0
2: 1
3: 23
4: 252
1149546544_1149546552 8 Left 1149546544 17:57508153-57508175 CCATCCTGAGTGCTTCGTCACCC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 48
1149546544_1149546551 4 Left 1149546544 17:57508153-57508175 CCATCCTGAGTGCTTCGTCACCC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1149546551 17:57508180-57508202 CCTTGCCTGTGGCCCGCTATTGG 0: 1
1: 0
2: 0
3: 2
4: 69
1149546544_1149546556 17 Left 1149546544 17:57508153-57508175 CCATCCTGAGTGCTTCGTCACCC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1149546556 17:57508193-57508215 CCGCTATTGGCTGGCAGCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 71
1149546544_1149546557 22 Left 1149546544 17:57508153-57508175 CCATCCTGAGTGCTTCGTCACCC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1149546557 17:57508198-57508220 ATTGGCTGGCAGCTCTGGACAGG 0: 1
1: 0
2: 0
3: 11
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149546544 Original CRISPR GGGTGACGAAGCACTCAGGA TGG (reversed) Intronic
900564276 1:3324718-3324740 GGGTGACGACGGAATCAGGGGGG - Intronic
901317887 1:8321443-8321465 GAGAGATGAAGCCCTCAGGAAGG - Intronic
902239010 1:15075910-15075932 GGGTGATGAAGTGCTCTGGAGGG - Intronic
904863247 1:33556490-33556512 AGGTGAAGATGCACTCAAGAGGG - Intronic
905389022 1:37624417-37624439 GGGTGCTGAAGAAGTCAGGAAGG - Intronic
905490332 1:38338393-38338415 GGGTGCTGAAGCCCTCAGGAGGG - Intergenic
910477855 1:87625902-87625924 GGGTGACAAAGCTCTCTGGGTGG - Intergenic
912132413 1:106619385-106619407 GGCTGAAGATGCACCCAGGAGGG - Intergenic
915740324 1:158113966-158113988 GGGTGAGGAAGGAGGCAGGAGGG + Intergenic
916509303 1:165457104-165457126 GGGTGGGGATGCACACAGGATGG + Intergenic
917140201 1:171827666-171827688 AGGTGACAAAGCATTCAAGAGGG - Intergenic
918245144 1:182652754-182652776 GGGTCATGAAGGACCCAGGAGGG + Intronic
920364061 1:205438824-205438846 GGGGGAGGAAGCTCTCTGGATGG + Intronic
921341520 1:214138948-214138970 GGATGAAGAATCCCTCAGGAAGG + Intergenic
1064019776 10:11799633-11799655 GGGTTACCAAGCACCCAGGCTGG + Intergenic
1064270516 10:13861123-13861145 GGGTCACGAAGGACGCAGGGTGG - Intronic
1077160782 11:1111930-1111952 ATGTGACGAAACCCTCAGGAGGG + Intergenic
1083471926 11:62889760-62889782 GAGTGACTCAGAACTCAGGAAGG + Intergenic
1088889283 11:114032034-114032056 GGGAGACAAAGCCCTGAGGAGGG - Intergenic
1093506970 12:19878955-19878977 GAGGGAAGAAGCAATCAGGAAGG + Intergenic
1098030822 12:66252026-66252048 CACTGACGAAGCACTCAGGATGG + Exonic
1100291733 12:93221726-93221748 GGGTCAGGAAGCAATCATGACGG - Intergenic
1102083398 12:110116379-110116401 GGGTGACCAAGCAGTCACTAGGG - Intergenic
1106146523 13:27054232-27054254 GGCTGTGGAAACACTCAGGAGGG + Intergenic
1106163460 13:27220549-27220571 GGGGGACGAACAACTCTGGATGG + Intergenic
1114709987 14:24768321-24768343 GGGTGTCGCCTCACTCAGGAAGG + Intergenic
1115319030 14:32058371-32058393 GTGTGAAGATGCACTGAGGAAGG - Intergenic
1118381169 14:65218540-65218562 GGGTTAATAAGCACTCAGAATGG + Intergenic
1118888904 14:69890583-69890605 GGGTGACTCAGGAATCAGGATGG - Intronic
1120618690 14:86736841-86736863 GGGTCACGAGGTGCTCAGGAGGG - Intergenic
1121154837 14:91673301-91673323 GGGTGAAGAAGCAATCATGATGG - Intronic
1127927010 15:63556540-63556562 GCCTGACGAAGCAGTCAGGGAGG + Intronic
1129244426 15:74270944-74270966 GGGTGACAGAGGACTGAGGAGGG + Intronic
1132639622 16:971607-971629 GGGGGACTCAGGACTCAGGAGGG + Intronic
1134085967 16:11357717-11357739 GGGAGACGAACTGCTCAGGATGG - Intergenic
1134599183 16:15520023-15520045 AGGGGACGTAGCACTCAGGGTGG - Intronic
1137708998 16:50553762-50553784 GGCTGGAGAAGGACTCAGGATGG + Intronic
1139663302 16:68437019-68437041 GCGTGAGGAAGCACCCAGAAGGG + Intronic
1141095352 16:81159190-81159212 AGGCGACGAATGACTCAGGAAGG - Intergenic
1142221240 16:88856305-88856327 GGGCGACGCAGCTCTCAGGCAGG + Intronic
1142230893 16:88899820-88899842 GGGGGAGGAAACGCTCAGGACGG - Intronic
1143576947 17:7799271-7799293 GGGTGAGGGAGCACACAGAAGGG - Intronic
1145006907 17:19343429-19343451 GGGTGACAAAGCCCTGAGAACGG + Exonic
1145963178 17:28899188-28899210 GGGTGAACAAGCAGTCTGGATGG - Intronic
1146624326 17:34424367-34424389 GGGGGAGGCAGCACTCAGGGAGG - Intergenic
1147118726 17:38322388-38322410 GGGTGATGCACCACCCAGGAAGG + Intronic
1149546544 17:57508153-57508175 GGGTGACGAAGCACTCAGGATGG - Intronic
1150533761 17:66013975-66013997 TGGTGTGAAAGCACTCAGGAAGG - Intronic
1151280770 17:73072595-73072617 GGGTAGCAAAACACTCAGGAAGG - Intronic
1151328646 17:73394014-73394036 GGGTGAGGAGGCACCCAGAAAGG - Intronic
1153556732 18:6322755-6322777 GGGTGATGCAGAACTGAGGATGG + Intronic
1156591132 18:38489915-38489937 GGGTGACAAGGCACTCAGTGGGG - Intergenic
1156715633 18:40006528-40006550 GGGTAACGAAGTTCTCAGTAAGG + Intergenic
1157608468 18:48940873-48940895 GGGTGAGGAGGCACTCAGGCTGG + Intronic
1158227091 18:55212792-55212814 GGGTGACCAGGCACTGAGGAAGG - Intergenic
1161459833 19:4390026-4390048 AGGGGACGAAGCACCCAGCAGGG - Intronic
1167109491 19:47450681-47450703 TGGTGATGGAGCACCCAGGAGGG + Intronic
929460095 2:42097074-42097096 GGGTTAGGAAGCAGTCAGGGTGG - Intergenic
930313742 2:49772474-49772496 GGGTGTGCATGCACTCAGGATGG - Intergenic
930622053 2:53653561-53653583 GGGTAAGGAAGTCCTCAGGAAGG - Intronic
931319083 2:61158706-61158728 GGGTAAGGAAGCAGTCAGGATGG + Intronic
931846955 2:66213861-66213883 GGATGAGGAAGCACTATGGAGGG + Intergenic
931991649 2:67796490-67796512 TGGTGAAGAGGAACTCAGGAAGG - Intergenic
936073131 2:109384472-109384494 GGGTGACCAAGCAGGCAGGTGGG + Intronic
939775577 2:146383545-146383567 GGGTGGCGAAGCACACCTGATGG + Intergenic
940241036 2:151563467-151563489 GGGTGAGGAAAATCTCAGGAAGG + Intronic
947810502 2:233001065-233001087 GGGGGAAGTGGCACTCAGGATGG - Intronic
1173106897 20:40145241-40145263 GGGGGCCGAGGCACTTAGGATGG - Intergenic
1175899552 20:62354631-62354653 GGGTCCCGAGGCACACAGGAGGG + Intronic
1181308507 22:21930805-21930827 GGGTGAGGAAGGCCTCAGGGAGG - Intronic
1182317327 22:29456699-29456721 GGATACTGAAGCACTCAGGAGGG - Intergenic
1184144200 22:42599057-42599079 GGGTTACGAAGCATGCAGAATGG + Intronic
949168729 3:972331-972353 GGGTAAGGAAGCAATCATGATGG - Intergenic
949545179 3:5066450-5066472 GAGTGAAGAAGCAGTTAGGAGGG - Intergenic
953665369 3:44922348-44922370 GGGTGAAGAAGCAGCCCGGAAGG - Intronic
953705694 3:45228201-45228223 AGGTGACGGAGTCCTCAGGACGG - Intergenic
955125101 3:56103372-56103394 GCGAGAAGAAGCACTCAGCAAGG + Intronic
956719803 3:72107800-72107822 GGGTGAAGGAGCAGGCAGGAAGG + Intergenic
968947920 4:3675262-3675284 GAGTGGCGCAGCTCTCAGGAGGG - Intergenic
975855795 4:78622790-78622812 GGGTGAGAAAGCACACTGGAGGG + Intergenic
985545755 5:508183-508205 GGGAGACGCAGGCCTCAGGATGG + Intronic
985548536 5:521868-521890 GGGGGAGGAAGCACACAGGGAGG + Intronic
985808418 5:2065482-2065504 GGCTCAGCAAGCACTCAGGAGGG + Intergenic
990508375 5:56467212-56467234 AAGAGAAGAAGCACTCAGGACGG - Intronic
1003200020 6:3950825-3950847 GGGTAAGGAAGCAATCACGATGG - Intergenic
1006439402 6:34043737-34043759 GGGTCACGAAGCCATCAGTATGG + Intronic
1007590849 6:43020203-43020225 GGGTGGGGAAGGCCTCAGGAAGG + Intronic
1012916859 6:105179936-105179958 GGGCGGCGAGGCACTCACGAGGG - Intronic
1016895098 6:149043576-149043598 GGGAGAGGAAGCACTCTGGTGGG + Intronic
1024116919 7:46203279-46203301 GTGGGACCCAGCACTCAGGACGG + Intergenic
1024362225 7:48480156-48480178 GGGTAAGGAAGCAATCATGATGG - Intronic
1039107721 8:34007168-34007190 GGGTAAAGAAGCAGTCATGATGG + Intergenic
1041257981 8:55995725-55995747 GGGTGTAGAAGCACAAAGGAGGG + Intronic
1042411690 8:68473643-68473665 GGGTAAGGAAGCCCTCAGTAAGG - Intronic
1042949146 8:74182962-74182984 GGGTAACGAAGTCCTCAGTAAGG - Intergenic
1044656942 8:94558134-94558156 GGGTGAGGAAGTTCTCAGTAAGG - Intergenic
1047115036 8:121832480-121832502 GGGTGACAAAAATCTCAGGATGG - Intergenic
1049029700 8:140025074-140025096 GGGTGGCGCTGCACTCAGGATGG + Intronic
1056823575 9:89861230-89861252 GGGTGACAAAGCCCTGAAGAGGG + Intergenic
1058306977 9:103455792-103455814 TGGTGAGAAAGCACTCAGGCTGG + Intergenic
1060403559 9:123361887-123361909 TGGTGACAAGGCTCTCAGGAAGG + Intronic
1061035971 9:128114584-128114606 GGGAGATGAAGCTGTCAGGATGG - Intergenic
1061039378 9:128131032-128131054 GGGTGACAAAGCCCTGAAGAGGG - Intergenic
1194450330 X:94037994-94038016 GGGTAAGGAAGCAATCATGATGG + Intergenic
1197700024 X:129592571-129592593 TGGTGAGGAAGCACTCAGAAGGG + Intergenic
1198563863 X:137883022-137883044 GGCTGATGAAGCACAGAGGAAGG - Intergenic
1200049127 X:153419410-153419432 GGGGGCCGGAGCACTCAGGAAGG + Intronic
1200136032 X:153875284-153875306 GGGTGACCAAGGGCCCAGGAGGG + Intronic