ID: 1149546545

View in Genome Browser
Species Human (GRCh38)
Location 17:57508157-57508179
Sequence GAATGGGTGACGAAGCACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149546545_1149546551 0 Left 1149546545 17:57508157-57508179 CCTGAGTGCTTCGTCACCCATTC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1149546551 17:57508180-57508202 CCTTGCCTGTGGCCCGCTATTGG 0: 1
1: 0
2: 0
3: 2
4: 69
1149546545_1149546556 13 Left 1149546545 17:57508157-57508179 CCTGAGTGCTTCGTCACCCATTC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1149546556 17:57508193-57508215 CCGCTATTGGCTGGCAGCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 71
1149546545_1149546552 4 Left 1149546545 17:57508157-57508179 CCTGAGTGCTTCGTCACCCATTC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 48
1149546545_1149546557 18 Left 1149546545 17:57508157-57508179 CCTGAGTGCTTCGTCACCCATTC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1149546557 17:57508198-57508220 ATTGGCTGGCAGCTCTGGACAGG 0: 1
1: 0
2: 0
3: 11
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149546545 Original CRISPR GAATGGGTGACGAAGCACTC AGG (reversed) Intronic
900750702 1:4395284-4395306 TAAGGGGTGAGGAAGCTCTCTGG - Intergenic
902038503 1:13475119-13475141 GAAGGGGTGAAGGAGCTCTCTGG + Exonic
907945306 1:59130673-59130695 GAATGGCTGAGCCAGCACTCTGG + Intergenic
918119649 1:181527273-181527295 GAAGGGGTGAGGGAGCTCTCTGG + Intronic
922815143 1:228443442-228443464 GAAGGGGTGAGGCAGCTCTCTGG - Intergenic
922824630 1:228509110-228509132 GAAGGGGTGAGGGAGCTCTCTGG - Intergenic
1063266300 10:4454755-4454777 GAATGGGTGAGGGAGATCTCTGG - Intergenic
1064318199 10:14277422-14277444 GAAGGGGTGAGGCAGCTCTCTGG - Intronic
1064742126 10:18444239-18444261 GAAAGGATGAGGAAGCTCTCTGG - Intronic
1067427774 10:46222544-46222566 GAAGGGGTGAGGCAGCCCTCTGG + Intergenic
1071536554 10:86437383-86437405 GAATGCATGACGAAGAAATCAGG + Exonic
1072764414 10:98084010-98084032 GAAGGGGTGAAGAAGCTCTCTGG + Intergenic
1076762967 10:132614816-132614838 GAAGGGGTGAGGCAGCACTCAGG - Intronic
1077637688 11:3855064-3855086 GCATGGGCGACGAAGCGCGCGGG + Intronic
1082742925 11:56930854-56930876 GACTTAGTGAGGAAGCACTCTGG - Intergenic
1088799301 11:113290736-113290758 GAATGGGTGAGGGAGCTCTCTGG - Intergenic
1090475171 11:127013765-127013787 GAGTGGGTGTTGAGGCACTCAGG + Intergenic
1090838534 11:130471003-130471025 GCATGGGTGCCCAAGTACTCCGG + Exonic
1095695985 12:45144507-45144529 GAAGGGGTGAGGCAGCTCTCTGG + Intergenic
1096965874 12:55627299-55627321 GAATGAGTGACAAGGCATTCTGG - Intergenic
1101314676 12:103618275-103618297 GAAGGGGTGAGGGAGCTCTCTGG - Intronic
1101646007 12:106631569-106631591 GAAGGGGTGAGGGAGCTCTCTGG - Intronic
1101762801 12:107672894-107672916 GAAGGGGTGAGGGAGCTCTCTGG - Intergenic
1104695693 12:130862123-130862145 GAATGGGTGAGGGAGCTCCCTGG + Intergenic
1109478098 13:62911524-62911546 GAAGGGGTGACCTAGCTCTCTGG + Intergenic
1113697315 13:112355403-112355425 GAACGGGTGAGGGAGCTCTCTGG + Intergenic
1113976338 13:114230595-114230617 TAATGGGTGACACAGCAGTCAGG - Intergenic
1116644582 14:47510171-47510193 GAAAGGGTGAGGGAGCTCTCCGG - Intronic
1119220993 14:72907288-72907310 GAAAGGATGTCCAAGCACTCTGG + Intergenic
1121788412 14:96680311-96680333 GAAAGGGTGAGGTAGCACTCTGG - Intergenic
1121914713 14:97827527-97827549 GAAGGGGTGAGGCAGCTCTCTGG + Intergenic
1123104772 14:105835820-105835842 GAAAGGGTGAGGGAGCTCTCTGG + Intergenic
1123469993 15:20542909-20542931 GACTGGGAGAAGAAGCACACAGG - Intergenic
1123648062 15:22457788-22457810 GACTGGGAGAAGAAGCACACAGG + Intergenic
1123730287 15:23137905-23137927 GACTGGGAGAAGAAGCACACAGG - Intergenic
1123748425 15:23335323-23335345 GACTGGGAGAAGAAGCACACAGG - Intergenic
1124280803 15:28359200-28359222 GACTGGGAGAAGAAGCACACAGG - Intergenic
1124301901 15:28552425-28552447 GACTGGGAGAAGAAGCACACAGG + Intergenic
1126360695 15:47842783-47842805 GAAGGGGTGAGGGAGCTCTCTGG - Intergenic
1128304584 15:66589611-66589633 TAATGGGTGAGGCAGCTCTCAGG - Intronic
1131454049 15:92569578-92569600 GAAAGGGTGAGGGAGCTCTCTGG - Intergenic
1132810208 16:1793606-1793628 GAGTGGGTGGCGGGGCACTCGGG + Intronic
1139314520 16:66056910-66056932 GAAGGGGTGAGGGAGCTCTCTGG - Intergenic
1139615265 16:68085009-68085031 GAAGGGGTGCTGAAGCACTGAGG - Intronic
1140957290 16:79877328-79877350 GAATGGGTGTTGGAGCACGCTGG - Intergenic
1141201571 16:81902447-81902469 GAAAGGGTGAGGCAGCTCTCTGG + Intronic
1143040546 17:4032788-4032810 GAAGGGGTGACCAGGCCCTCAGG + Intronic
1143739570 17:8942402-8942424 GAATGGGTGAGGCAGCAGTGGGG - Intronic
1149546545 17:57508157-57508179 GAATGGGTGACGAAGCACTCAGG - Intronic
1154095593 18:11412252-11412274 GAAAGGGTGAGGGAGCTCTCAGG - Intergenic
1156583566 18:38407671-38407693 GAGAGGGTGACGAGGCATTCGGG - Intergenic
1157423318 18:47563964-47563986 GAAGGGGTGAGGGAGCACCCTGG - Intergenic
1157546825 18:48552553-48552575 GAATGGGTGAGGACGTTCTCTGG + Intronic
1158390655 18:57042264-57042286 GAAGGGGTGAGGGAGCTCTCTGG + Intergenic
1161584820 19:5099748-5099770 GAAGGGGTGAGGGAGCTCTCTGG - Intronic
935540113 2:104338576-104338598 GAAAGGGAGACAGAGCACTCGGG + Intergenic
935730732 2:106063204-106063226 GAAGGGGTGAGGGAGCTCTCTGG - Intergenic
936450944 2:112633686-112633708 GAAGGGGAGAGGAAGCTCTCTGG - Intergenic
944005760 2:194903291-194903313 GAAGGGGTGAGGAAGCTCTGTGG - Intergenic
944217740 2:197272689-197272711 GAAGGGGTGAGGGAGCTCTCTGG - Intronic
945829225 2:214763119-214763141 GAATGAATGAAGAAGCAGTCTGG + Intronic
1170676321 20:18484485-18484507 GAAGGGGTGATGGAGCTCTCTGG - Exonic
1173559050 20:43989323-43989345 GAATGGGAGAGGAGGCAGTCGGG + Intronic
1174120415 20:48260650-48260672 TCATGGGTGACGAAGGACACGGG - Intergenic
1177472376 21:21575729-21575751 GAAGGGGTGAGGAATCTCTCTGG + Intergenic
1181886323 22:26024984-26025006 GAAGGGGTGAGGGAGCCCTCTGG + Intronic
950588509 3:13916256-13916278 GAAGGGGTGAGGAAGCTGTCTGG + Intergenic
957345700 3:78958791-78958813 GAAAGGGTGACCAAGCATCCTGG - Intronic
962948294 3:140194294-140194316 GAAGGGATGAGGAAGCTCTCTGG + Intronic
965797567 3:172457261-172457283 GAAGGGGTGAGGAAGCTTTCTGG + Intergenic
971118040 4:23670462-23670484 GAATGGATGAGGGAGCTCTCTGG + Intergenic
973916753 4:55641838-55641860 GAATGGGTAAGGGAGCTCTCTGG - Intergenic
974290112 4:59918851-59918873 GAAGGGGTGAGGGAGCTCTCTGG - Intergenic
975233375 4:71961110-71961132 GAAGGGATGAGGAAGCTCTCTGG - Intergenic
977537782 4:98276165-98276187 GAAGGAGTGAGGAAGCTCTCTGG + Intronic
982502496 4:156174205-156174227 GAAGGGGTGAGGGAGCTCTCTGG + Intergenic
982829191 4:160039797-160039819 TAATGTCTGACCAAGCACTCTGG - Intergenic
984260284 4:177436585-177436607 GAAGGGGCGAGGAAGCTCTCTGG - Intronic
987096189 5:14552570-14552592 GAAGGGGTGAGGGAGCTCTCTGG - Intergenic
994994123 5:107037672-107037694 GCATGGGTGACAAAGAACTGAGG + Intergenic
997455293 5:134012531-134012553 GAAAGGGTGAACAAGCTCTCAGG - Intergenic
997783071 5:136679335-136679357 GAGTGTGTGACTAAGCAATCTGG + Intergenic
1002449842 5:179312405-179312427 GAAAGGGTGAGGGAGCTCTCTGG - Intronic
1007193300 6:40038247-40038269 GAAGGGGTGAGGGAGCTCTCTGG - Intergenic
1008561197 6:52726663-52726685 CAACGGATGATGAAGCACTCTGG - Intergenic
1010784752 6:79987303-79987325 GAATGGGCAAAGAAGCTCTCTGG - Intergenic
1013955344 6:115834837-115834859 GAATGGGGGACTTAGCACCCGGG - Intergenic
1015534028 6:134248846-134248868 GAAAGGGAGAGGAAGCACTTTGG - Intronic
1017186973 6:151611482-151611504 GAAGGGGTGAGGCAGCTCTCTGG + Intronic
1017607685 6:156150893-156150915 GAAGGGGTGAGGGAGCTCTCTGG + Intergenic
1018016102 6:159713694-159713716 GATTGGGTATCGAAGCACACAGG - Intronic
1018202929 6:161411846-161411868 GAATGGGTGAGGAAGGAATGAGG - Intronic
1020555576 7:9665274-9665296 GAATGGGTGATGTAGAAATCTGG - Intergenic
1021333216 7:19365233-19365255 AAATGAGTGACGAGTCACTCAGG - Intergenic
1023407976 7:39856306-39856328 GAATGGGTGAATGAGCTCTCTGG + Intergenic
1024202040 7:47117587-47117609 GAAGGGGTGAGGAAGCTCTCTGG - Intergenic
1027617654 7:80443668-80443690 GAAGGGGTGAGGAATCTCTCTGG + Intronic
1027754064 7:82188053-82188075 GAATTGGTGAGGGAGCTCTCTGG + Intronic
1029664476 7:101986201-101986223 GAATTGGTAACGAGGCACTGGGG + Intronic
1032687925 7:134254531-134254553 GAAGGGGTGAGGGAGCTCTCTGG + Intronic
1034198544 7:149266364-149266386 GCAAGGGTGTCGAAGGACTCTGG - Exonic
1036180667 8:6581890-6581912 GAAGGGGTGAGGGAGCTCTCTGG + Intronic
1038855058 8:31321990-31322012 GAAAGGGTGACAGAGCACACTGG + Intergenic
1040056937 8:43067100-43067122 GAATGGGTTACAAGGCACACTGG - Intronic
1044818301 8:96135557-96135579 GAATGGCTCACTAAGGACTCAGG + Intergenic
1048929018 8:139296175-139296197 GAAGGGGTGAGGCAGCTCTCTGG - Intergenic
1050005800 9:1128971-1128993 GAAGGGGTGAACAAGCTCTCAGG - Intergenic
1050145158 9:2559865-2559887 GAATGGGTGCCTCAGGACTCTGG - Intergenic
1052100302 9:24437998-24438020 GAAGGGGTGAGGAAGCTCTTTGG + Intergenic
1057064771 9:92038517-92038539 GAAAGGGAAACGAGGCACTCTGG + Intronic
1057410056 9:94810100-94810122 GAATGGGTGAGAAAGCTCCCTGG + Intronic
1058281169 9:103116371-103116393 GAATGGGCAACGCAGCTCTCTGG + Intergenic
1060058397 9:120436340-120436362 GAAAGGGTGAGGAACTACTCCGG + Intronic
1185465008 X:349218-349240 GAAGGGGTGAGGGAGCTCTCTGG - Intronic
1185513572 X:681053-681075 GAAGGGGCGAGGAAGCTCTCTGG + Intergenic
1185636296 X:1554470-1554492 GAAGGGGTGAGGGAGCTCTCTGG - Intergenic
1185808308 X:3080679-3080701 GAAGGGGTGAGGGAGCTCTCTGG + Intronic
1185824612 X:3237898-3237920 GAAAGGGTGAGGGAGCTCTCTGG - Intergenic
1185855445 X:3530666-3530688 GAAGGGGTGAGGGAGCTCTCTGG + Intergenic
1185876333 X:3705260-3705282 GAAGGGGTGAGGGAGCTCTCTGG + Intronic
1185876754 X:3708170-3708192 GAAGGGGTGAGGGAGCTCTCTGG - Intronic
1186186101 X:7021090-7021112 GAATGCTTGATGAAGCTCTCAGG + Intergenic
1186228978 X:7432081-7432103 GAAGGGGTGAGGGAGCTCTCTGG - Intergenic
1186313904 X:8348542-8348564 GAAGGGGTGAGGGAGCTCTCTGG + Intergenic
1186408749 X:9327125-9327147 GAAGGGGTGAGGGAGCTCTCTGG - Intergenic
1188232434 X:27681402-27681424 GAATGGGTGACAAAGTAACCAGG + Intronic
1189298322 X:39934715-39934737 GGATGGGAGACAAAGCACCCAGG + Intergenic
1191768295 X:64726502-64726524 GAATGGATGATGAAGCATTCAGG + Intergenic
1191841293 X:65515141-65515163 GAATGTGTGGTGAAGCACTCTGG - Intronic
1192438453 X:71156971-71156993 GAGAGGGTGACTAAGCACACAGG + Intronic
1194445314 X:93980996-93981018 GAATGGGTGAGGAGGCTCCCTGG + Intergenic
1194992711 X:100562280-100562302 GAAGGGGTGAGGGAGCTCTCTGG + Intergenic
1200049126 X:153419406-153419428 GGATGGGGGCCGGAGCACTCAGG + Intronic
1200788609 Y:7280240-7280262 GAAGGGGTGAGGGAGCCCTCTGG + Intergenic
1201250502 Y:12052945-12052967 GAAAGGGTGAGGGAGCTCTCTGG + Intergenic
1201495694 Y:14590022-14590044 CAATGGGGGACTTAGCACTCGGG - Intronic
1201626272 Y:16018143-16018165 GAAGGGGTGAGGGAGCTCTCTGG + Intergenic