ID: 1149546552 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:57508184-57508206 |
Sequence | GCCTGTGGCCCGCTATTGGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 53 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 4, 4: 48} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1149546545_1149546552 | 4 | Left | 1149546545 | 17:57508157-57508179 | CCTGAGTGCTTCGTCACCCATTC | 0: 1 1: 0 2: 0 3: 7 4: 129 |
||
Right | 1149546552 | 17:57508184-57508206 | GCCTGTGGCCCGCTATTGGCTGG | 0: 1 1: 0 2: 0 3: 4 4: 48 |
||||
1149546544_1149546552 | 8 | Left | 1149546544 | 17:57508153-57508175 | CCATCCTGAGTGCTTCGTCACCC | 0: 1 1: 0 2: 0 3: 9 4: 98 |
||
Right | 1149546552 | 17:57508184-57508206 | GCCTGTGGCCCGCTATTGGCTGG | 0: 1 1: 0 2: 0 3: 4 4: 48 |
||||
1149546543_1149546552 | 24 | Left | 1149546543 | 17:57508137-57508159 | CCAGGACAGAGGAAAGCCATCCT | 0: 1 1: 0 2: 3 3: 6 4: 180 |
||
Right | 1149546552 | 17:57508184-57508206 | GCCTGTGGCCCGCTATTGGCTGG | 0: 1 1: 0 2: 0 3: 4 4: 48 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1149546552 | Original CRISPR | GCCTGTGGCCCGCTATTGGC TGG | Intronic | ||