ID: 1149546552

View in Genome Browser
Species Human (GRCh38)
Location 17:57508184-57508206
Sequence GCCTGTGGCCCGCTATTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 48}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149546545_1149546552 4 Left 1149546545 17:57508157-57508179 CCTGAGTGCTTCGTCACCCATTC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 48
1149546544_1149546552 8 Left 1149546544 17:57508153-57508175 CCATCCTGAGTGCTTCGTCACCC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 48
1149546543_1149546552 24 Left 1149546543 17:57508137-57508159 CCAGGACAGAGGAAAGCCATCCT 0: 1
1: 0
2: 3
3: 6
4: 180
Right 1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149546552 Original CRISPR GCCTGTGGCCCGCTATTGGC TGG Intronic