ID: 1149546552

View in Genome Browser
Species Human (GRCh38)
Location 17:57508184-57508206
Sequence GCCTGTGGCCCGCTATTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 48}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149546544_1149546552 8 Left 1149546544 17:57508153-57508175 CCATCCTGAGTGCTTCGTCACCC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 48
1149546543_1149546552 24 Left 1149546543 17:57508137-57508159 CCAGGACAGAGGAAAGCCATCCT 0: 1
1: 0
2: 3
3: 6
4: 180
Right 1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 48
1149546545_1149546552 4 Left 1149546545 17:57508157-57508179 CCTGAGTGCTTCGTCACCCATTC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149546552 Original CRISPR GCCTGTGGCCCGCTATTGGC TGG Intronic
900387398 1:2416847-2416869 GCCTGTGTCCCTGTGTTGGCCGG + Intergenic
905932645 1:41800443-41800465 GCCTGGTGCCAGCTCTTGGCTGG - Intronic
912434000 1:109645559-109645581 ACCTTTGGCCAGCTATTGGAAGG - Intergenic
919922031 1:202171713-202171735 GCCTGGGGCCCGCTACTGTGTGG + Intergenic
922791497 1:228313708-228313730 GCCGGAGGCCCGCTGGTGGCTGG + Intronic
923000766 1:230004826-230004848 GCCAGTGGCCTGCAATTGGCAGG + Intergenic
923740597 1:236651403-236651425 GCCTTTGGCCCACATTTGGCAGG + Intergenic
1070844392 10:79510084-79510106 GCCTGTGCTCCGCTATTCACAGG + Intergenic
1070929405 10:80250224-80250246 GCCTGTGCTCCGCTATTCACAGG - Intergenic
1072436190 10:95416436-95416458 GCATGTGGCCTGCTACGGGCTGG - Intronic
1073379811 10:103069535-103069557 GCCTGTGGCCGGCTCTTGTCTGG + Intronic
1079338188 11:19589679-19589701 GGCTGTGGCTCTCTCTTGGCTGG - Intronic
1088637055 11:111832149-111832171 GCTTGTGGCCTGGTATTGGAAGG - Intronic
1091085782 11:132720286-132720308 GGCTGTGGCCAGGTCTTGGCCGG - Intronic
1101330205 12:103751344-103751366 GGCTGTGACCCCCTAGTGGCAGG + Intronic
1105541333 13:21319761-21319783 GCCTGTGGCCCGCACCTGGCAGG - Intergenic
1119910457 14:78345145-78345167 GCCTGTGGCCCACACTTGGGGGG + Intronic
1132024274 15:98391743-98391765 GCCTGTGGGCCGTTGTTTGCTGG - Intergenic
1137601973 16:49762410-49762432 GCCTGTGGCCAGCCCTTCGCAGG + Intronic
1142222734 16:88863607-88863629 GCCACTGGCCCCCTCTTGGCGGG - Exonic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1154441444 18:14393182-14393204 CCCTGTGACCCGCTCCTGGCCGG + Intergenic
1156480323 18:37432258-37432280 GCCTGTGCCCCCACATTGGCGGG - Intronic
1157357186 18:46946725-46946747 TTCTGTGGCCAGCGATTGGCGGG + Intronic
1157452197 18:47797180-47797202 CCCTGTGGCCTGCTTCTGGCTGG + Intergenic
1160622213 18:80179432-80179454 GCCAGTGGCCCGCTGAGGGCAGG - Intronic
1160922044 19:1525548-1525570 GCCTGTGCCCCGCTGCAGGCGGG + Intronic
927467355 2:23347507-23347529 GCCTGTTCCCGGCCATTGGCGGG - Intergenic
927946015 2:27135690-27135712 GCCTATCGCCCACTTTTGGCAGG + Intergenic
928378510 2:30798638-30798660 GCCTGCGGCCCTCTCCTGGCTGG + Intronic
929484142 2:42339750-42339772 GCCTGTGACCCGCTCCTGTCAGG + Intronic
931309577 2:61065810-61065832 GGCGCTGGCCCGCGATTGGCCGG + Intergenic
937904109 2:127043635-127043657 GCCCTAGGCCCGCTATAGGCTGG + Intergenic
946339428 2:219058406-219058428 GCATGTGGCCCCCCATTGGGCGG - Intronic
946420174 2:219560549-219560571 GCCTCTGGCCCCCTGGTGGCTGG + Intronic
1183314680 22:37130326-37130348 GCCTGTGGCCAGCTACTTCCTGG + Intronic
949596465 3:5553088-5553110 GCCAGTGCCCTGCTACTGGCTGG - Intergenic
950657871 3:14448434-14448456 GGGTTTGGCCGGCTATTGGCTGG + Intronic
954693178 3:52406639-52406661 GCCTGTGGCCTGCTCCTGGGTGG - Intronic
960048998 3:113222962-113222984 GCCTGTGGCTCTCCAATGGCAGG - Intronic
962745038 3:138390643-138390665 GCCTGTGGCCGGGCATTTGCAGG + Intronic
967833699 3:193943344-193943366 GCCTGTGGGCCACTTTGGGCCGG + Intergenic
997953094 5:138257676-138257698 GCCTGTGGCCCCCAACTGCCTGG - Exonic
999843033 5:155449540-155449562 CCCTGTGGCAGGCTTTTGGCTGG + Intergenic
1002181563 5:177433543-177433565 ACCTGTGGCCCGCACCTGGCAGG - Exonic
1006418564 6:33919525-33919547 GCCTGTTGCCCCCTCTAGGCTGG - Intergenic
1007257845 6:40541157-40541179 GCCTGGGACCCGCTGATGGCTGG - Intronic
1012709678 6:102582799-102582821 GCGCCTGGCTCGCTATTGGCAGG + Intergenic
1019634864 7:2070129-2070151 CCCTGAGGCCCGCTACTGCCAGG - Intronic
1029604062 7:101588022-101588044 GCCTGTGACCTGCTCTGGGCTGG + Intergenic
1036645849 8:10611214-10611236 GGCTGTGGTCCGCGAATGGCTGG - Exonic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1200150939 X:153951150-153951172 GACTGTGGCCCGGTACTGGCGGG + Intronic