ID: 1149550162

View in Genome Browser
Species Human (GRCh38)
Location 17:57533848-57533870
Sequence GTCCCCTCCAGGATTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149550162_1149550170 21 Left 1149550162 17:57533848-57533870 CCTGGGGAAATCCTGGAGGGGAC 0: 1
1: 1
2: 0
3: 10
4: 190
Right 1149550170 17:57533892-57533914 CAGCAGCACTCCCAGCCACTGGG 0: 1
1: 0
2: 10
3: 181
4: 4975
1149550162_1149550171 25 Left 1149550162 17:57533848-57533870 CCTGGGGAAATCCTGGAGGGGAC 0: 1
1: 1
2: 0
3: 10
4: 190
Right 1149550171 17:57533896-57533918 AGCACTCCCAGCCACTGGGAAGG 0: 1
1: 0
2: 7
3: 86
4: 2089
1149550162_1149550169 20 Left 1149550162 17:57533848-57533870 CCTGGGGAAATCCTGGAGGGGAC 0: 1
1: 1
2: 0
3: 10
4: 190
Right 1149550169 17:57533891-57533913 CCAGCAGCACTCCCAGCCACTGG 0: 1
1: 1
2: 8
3: 60
4: 450
1149550162_1149550172 28 Left 1149550162 17:57533848-57533870 CCTGGGGAAATCCTGGAGGGGAC 0: 1
1: 1
2: 0
3: 10
4: 190
Right 1149550172 17:57533899-57533921 ACTCCCAGCCACTGGGAAGGAGG 0: 1
1: 0
2: 13
3: 189
4: 1905

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149550162 Original CRISPR GTCCCCTCCAGGATTTCCCC AGG (reversed) Intronic
900156496 1:1205352-1205374 GGCACCTCCAGGACTTACCCTGG + Exonic
900583183 1:3419265-3419287 TTCCCATCCAGGCTGTCCCCGGG - Intronic
900616546 1:3568073-3568095 ATCGCCTGCAGGAATTCCCCAGG + Intronic
900833132 1:4979279-4979301 CACCCCATCAGGATTTCCCCGGG - Intergenic
901795046 1:11675163-11675185 CTCCTCCCTAGGATTTCCCCTGG - Exonic
902272789 1:15316678-15316700 GCTCCCTCAAGGGTTTCCCCTGG + Intronic
902364834 1:15965911-15965933 GTCCCCTCCCTGATCTCACCCGG - Intronic
903600278 1:24533154-24533176 CTCCCCTCCAGCCTCTCCCCCGG + Exonic
904033014 1:27544849-27544871 GTTCCCTGCTGGAATTCCCCAGG - Intronic
904600604 1:31670690-31670712 GTGCCCTCCAGGCTGTCCCAGGG - Intronic
905325542 1:37149257-37149279 CTTACCTCCAGGATTTCCCTGGG + Intergenic
907781595 1:57572021-57572043 GTCACCTCCAGGATTTGTCATGG - Intronic
908709171 1:66995687-66995709 GTCCCCGCCAGTATTTTCTCAGG + Intergenic
918496909 1:185150401-185150423 GTCACCTCCAGAATTTACACTGG - Exonic
918551249 1:185744948-185744970 GTCCCCTCAATGTTTCCCCCTGG - Intronic
921189731 1:212699266-212699288 AGCCCCTCCAGGATTCCCCCGGG - Intronic
922326148 1:224530176-224530198 GTCCCCTCCGGCATTCCTCCTGG - Intronic
1062866273 10:857797-857819 GTCCTCTCCAGGATCTATCCTGG + Intronic
1063371596 10:5525941-5525963 GCCCCCGCCAGGATTCCCGCAGG + Exonic
1071950989 10:90702359-90702381 GTCCCCTCCAGGAAGGACCCTGG - Intergenic
1075591643 10:123695903-123695925 AACCCCATCAGGATTTCCCCAGG + Intergenic
1077034078 11:486463-486485 TGCCCCACCAGGATTTCCCTGGG + Intronic
1077336774 11:2008786-2008808 CTCCACACCTGGATTTCCCCAGG - Intergenic
1078105887 11:8357720-8357742 TCCCCCTCCAGGAATCCCCCAGG + Intergenic
1079265996 11:18933838-18933860 GACAGCTCCAGGATTTCCTCAGG + Exonic
1079452682 11:20610770-20610792 GTCCCCTGCAAAATCTCCCCTGG - Intronic
1081711675 11:45220651-45220673 GTCCCCTCCTGGGTTCCTCCTGG + Intronic
1083622462 11:64055957-64055979 GTCCCTCCCAGGAGCTCCCCGGG - Intronic
1086338501 11:85823976-85823998 GTCCCATTCAGGGTTTCCCATGG - Intergenic
1088702025 11:112421954-112421976 GCCCCCAACAGGATTGCCCCAGG - Intergenic
1089386371 11:118070863-118070885 GCCCCCTCCAGGATCTACGCAGG + Intergenic
1090376648 11:126294187-126294209 GCCCATTCCAGGGTTTCCCCAGG - Intronic
1090442731 11:126737447-126737469 GTCCCCTCCACTCCTTCCCCAGG - Intronic
1202819758 11_KI270721v1_random:63968-63990 CTCCACACCTGGATTTCCCCAGG - Intergenic
1091493215 12:950267-950289 GTCCCCTCTAGAATGTCCCCTGG + Intronic
1091612532 12:2023474-2023496 CGAGCCTCCAGGATTTCCCCAGG + Intronic
1094741611 12:33296167-33296189 GTCCCCTCCTGTATTTCTCAAGG - Intergenic
1102426211 12:112846376-112846398 GTTTCCACCAGAATTTCCCCAGG + Intronic
1104765198 12:131325873-131325895 GTCCCCTCCTGGGTTTCCTGTGG + Intergenic
1104765219 12:131325939-131325961 GTTCCCTCCTGGATCTCCCATGG + Intergenic
1104765234 12:131325983-131326005 GTTCCCTCCTGGATCTCCCATGG + Intergenic
1104765256 12:131326049-131326071 GTCCCCTCCTGCATCTCCCATGG + Intergenic
1104814172 12:131636529-131636551 GTCCCCTCCTGGGTCTCCCGCGG - Intergenic
1108272667 13:48777376-48777398 GTCTCTCCCAGGATTTCCACAGG + Intergenic
1108635931 13:52334187-52334209 TCCCCCTCCATGGTTTCCCCAGG - Intergenic
1108651879 13:52489061-52489083 TCCCCCTCCATGGTTTCCCCAGG + Intergenic
1110356018 13:74568429-74568451 TTCCACTCCAAGATCTCCCCTGG - Intergenic
1113425899 13:110208184-110208206 ATCCTCTCCAGGAGTTTCCCTGG - Intronic
1120034855 14:79684999-79685021 GATCCCTTCAAGATTTCCCCAGG - Intronic
1120979963 14:90280609-90280631 GTCCCCACCAAGCTTTCACCTGG - Intronic
1121722578 14:96120706-96120728 TTCCCTTCCAGGATATCCCTTGG - Intergenic
1122824654 14:104363764-104363786 GTCCCCTGCACTATCTCCCCAGG + Intergenic
1123129098 14:105971692-105971714 AACCCCTCCAGGATTCCCGCAGG - Intergenic
1123409617 15:20047860-20047882 AACCCCTCCAGGATTCCCGCAGG - Intergenic
1123518948 15:21054568-21054590 AACCCCTCCAGGATTCCCGCAGG - Intergenic
1125014565 15:34919427-34919449 CTTCCCTAAAGGATTTCCCCAGG - Intronic
1125430604 15:39589510-39589532 TTCCCCTGCAGGATTTACCATGG - Intronic
1126755183 15:51918825-51918847 GCCTCCTCCAGGATGTCCTCTGG - Intronic
1129292195 15:74576922-74576944 GACCCATCCAGGATGGCCCCTGG - Intronic
1130224636 15:82047278-82047300 GCCCCCTCCCGGATCTCCCAGGG + Intergenic
1132300250 15:100770949-100770971 GTCTCCTCCAGGACTTGCCTTGG + Intergenic
1132319829 15:100918085-100918107 GTCCCCTCCAGCGTCTGCCCGGG + Intergenic
1133255576 16:4513944-4513966 GCCCACTCCAGGGTTACCCCTGG - Intronic
1133349818 16:5093953-5093975 GTCCCCTCCATCCTGTCCCCAGG - Intronic
1135527262 16:23223432-23223454 GTCCCCTCCAGGCCTACCTCTGG + Intergenic
1136230409 16:28882565-28882587 GCCACCTCCACGATGTCCCCAGG - Exonic
1136871184 16:33809175-33809197 AACCCCTCCAGGATTCCCGCAGG + Intergenic
1137231018 16:46568489-46568511 AACCCCTCCAAGGTTTCCCCAGG + Intergenic
1137249520 16:46731878-46731900 GTCCCCTGCAGGCTTGACCCAGG - Intronic
1137579669 16:49626361-49626383 GTCCCCTCCTAGGTCTCCCCAGG + Intronic
1139359374 16:66388065-66388087 GCCCCCTCCCTCATTTCCCCAGG + Intronic
1140700270 16:77575073-77575095 GTCCCCTCCAGGATTTCCCTGGG - Intergenic
1141811677 16:86380213-86380235 GGCCCCTCCAGGGCTGCCCCTGG - Intergenic
1141897009 16:86964702-86964724 GTCGTCTCCAGCATTTCCCCAGG - Intergenic
1141906078 16:87027940-87027962 GTCCCCCCCAGCCTCTCCCCAGG - Intergenic
1203100988 16_KI270728v1_random:1306883-1306905 AACCCCTCCAGGATTCCCGCAGG - Intergenic
1142752501 17:1997596-1997618 GTCCCCTCTAGGTATTCCCCAGG + Intronic
1142810022 17:2391491-2391513 GACCCCTGCAAGGTTTCCCCAGG + Intronic
1144023268 17:11255694-11255716 GTCCCTTCCAGGATGACCCACGG + Intronic
1144317486 17:14076425-14076447 ATCTCCTCCAGAATTTTCCCTGG - Intronic
1144955686 17:19017792-19017814 GTGCCCTCCAGCATCTCCCTGGG - Intronic
1145961419 17:28888491-28888513 GTCCCTGCCTGGATTACCCCAGG + Intronic
1145996708 17:29109042-29109064 GTCCCCTTCAGGCATTCCCATGG - Intronic
1147439165 17:40436929-40436951 GTCCTCTGCAAGATTTTCCCAGG + Intergenic
1149550162 17:57533848-57533870 GTCCCCTCCAGGATTTCCCCAGG - Intronic
1151541163 17:74765137-74765159 GACCCCTCCAGGTTTCCCACTGG + Intronic
1152300936 17:79495138-79495160 GTCCCCTCGAGGATCTCCACAGG + Intronic
1152677389 17:81648527-81648549 GTCAGCTTCAGGATTTCCTCCGG - Exonic
1153590841 18:6672843-6672865 GTGTCCTCCAGGTTTTCTCCTGG + Intergenic
1154000019 18:10474749-10474771 GTCCCCTCCTGGAGTACCCCTGG - Intronic
1156453181 18:37278218-37278240 CTCCCCATCTGGATTTCCCCAGG + Intronic
1160512031 18:79458172-79458194 TTCCCCTCCAGAATCTCCTCTGG + Intronic
1160832812 19:1111522-1111544 GACCCCTCCAGGGTATCCCTGGG + Exonic
1161167183 19:2794581-2794603 GTCCCCTCCAGGCTGGGCCCTGG - Intronic
1165949429 19:39465723-39465745 GCCCCCTCCAGGCTATTCCCGGG - Intronic
1166654005 19:44596822-44596844 GTCCTCTCCCGGATCTGCCCTGG - Intergenic
929967060 2:46543489-46543511 GTCCCCTCGAATATTTCCCCCGG - Intronic
931402954 2:61948839-61948861 GTCCCCTTCAAGATCTCCCTAGG + Intronic
932838689 2:75061181-75061203 CTCCCCTCCAGCCTCTCCCCTGG - Intronic
933574293 2:84049849-84049871 TTCCCATCCTGGATTTTCCCGGG + Intergenic
934079982 2:88459447-88459469 GTCTCACCCATGATTTCCCCAGG + Intergenic
934852536 2:97710648-97710670 GGCCCCTCCTGGATTCCCTCTGG - Intergenic
935713533 2:105919593-105919615 GTCCCCTGCTGCATTTCTCCTGG + Intergenic
937524579 2:122752331-122752353 GTTCTCTCCAGTACTTCCCCTGG - Intergenic
938304853 2:130246181-130246203 GTCCCCTCCTGGTTTTGCTCAGG + Intergenic
938449159 2:131401019-131401041 GTCCCCTCCTGGTTTTGCTCAGG - Intergenic
940847806 2:158660391-158660413 GGCACCTCCAGGAGTGCCCCAGG - Intronic
943528898 2:189053886-189053908 GTCACTTACAGGATTGCCCCGGG + Exonic
943725075 2:191245144-191245166 GTCCCATCCAGGCTCGCCCCGGG + Intergenic
944492805 2:200275450-200275472 GTCCCCACCAGGATTTGCAAAGG + Intergenic
947186546 2:227460389-227460411 GTCCAATCCTGGATCTCCCCTGG + Intergenic
948154338 2:235769232-235769254 GTGCCCTCCAGGAGTACTCCTGG + Intronic
1170614671 20:17939022-17939044 GTCCCCTCCAGGATTCCTGCGGG - Intergenic
1174138050 20:48393968-48393990 GTTCCCTCCAGGGGCTCCCCAGG - Intergenic
1175504541 20:59472283-59472305 CTCCCCTCGAGGAGTTGCCCGGG - Intergenic
1175801191 20:61801846-61801868 GGCCCATCCTGGATTTCCCAGGG - Intronic
1176206011 20:63888553-63888575 GTCCCCTACAGGGATACCCCGGG - Intronic
1176206050 20:63888719-63888741 GTCCCCTACAGGGATACCCCGGG - Intronic
1179821339 21:43939098-43939120 GTCCCCAGCAGGGTTTGCCCAGG - Intronic
1182996134 22:34814188-34814210 TTCCCCTCCAGGGATTCCTCTGG + Intergenic
1183362210 22:37388600-37388622 GACCCCTCCCCGACTTCCCCAGG - Intronic
1184092212 22:42298833-42298855 CTCCCCACCAGGCCTTCCCCAGG + Intronic
1184332676 22:43835974-43835996 GGCCCCTCCACGCTTTTCCCTGG + Intronic
949564812 3:5234867-5234889 GGCCCATCCAGCATTTCCACAGG - Intergenic
950610230 3:14122075-14122097 TTGCCCTCCAGGCTTTGCCCAGG - Exonic
950716747 3:14853219-14853241 AGTCCCTCCAGGACTTCCCCTGG - Intronic
952990394 3:38826521-38826543 GTCCCCTCCAGGAAGATCCCTGG - Intergenic
955768975 3:62371387-62371409 GTCCCTTCCAGGTGTTCCCGAGG - Intronic
959770508 3:110089917-110089939 GTCCTCTGCTGGCTTTCCCCTGG + Intergenic
962732110 3:138293036-138293058 CTCCCCTCCAGGCTTTGCCAGGG + Intronic
962957377 3:140278592-140278614 TTCCCCTCCAGGACTGGCCCAGG - Intronic
965648392 3:170908513-170908535 TTCCCCACCAGCTTTTCCCCAGG + Intronic
968758167 4:2427433-2427455 CAGCCCCCCAGGATTTCCCCTGG - Intronic
969251448 4:5971064-5971086 GTACCTTCCAGGAATACCCCTGG - Intronic
969477980 4:7432042-7432064 GCCCCCTCCAGGAGAGCCCCTGG - Intronic
969967853 4:11015027-11015049 GTAGCCTCCAGGATTCCCCTAGG - Intergenic
970726450 4:19051128-19051150 GTGCCCTCCAGAATTTCCAACGG + Intergenic
973815472 4:54615123-54615145 GGCCCCTGCATGCTTTCCCCAGG - Intergenic
976274600 4:83263393-83263415 GAACCCTCCAGGATCTCCCTAGG - Intronic
977882048 4:102216393-102216415 ATCCCCTCCAGGATATCTCTGGG + Intergenic
984749817 4:183261288-183261310 GTCTCCTCCAGGCTCTCCCTTGG + Exonic
985479659 5:101286-101308 CTCCCCTACAGGCTTTTCCCAGG - Intergenic
985479688 5:101445-101467 CTCCCCTACAGGCTTTTCCCCGG - Intergenic
985479698 5:101498-101520 CTCCCCTACAGGCTTTTCCCAGG - Intergenic
985699395 5:1361369-1361391 GTCCCCTCCAGTGTGCCCCCTGG - Intergenic
986710907 5:10487156-10487178 CTCCCCTCCAGGGTCTTCCCTGG + Intergenic
986976928 5:13405630-13405652 GTCACCTCCAGGATCTGCCAGGG + Intergenic
987001890 5:13668213-13668235 GTCCCCTCCACCATTCCCACTGG - Intergenic
990980454 5:61598251-61598273 GTCCCCTCCTGCACTTCCCTAGG - Intergenic
993281347 5:85928677-85928699 TGCCCCTCCACCATTTCCCCAGG + Intergenic
998134367 5:139666995-139667017 CTCACCTCCAGGATTTCCAGGGG + Intronic
1002534237 5:179867484-179867506 GTCCCTTCCAGCATCTCCTCTGG - Exonic
1003398758 6:5774769-5774791 GGCCTCTCCAGCATTTCCCGAGG - Intergenic
1004265244 6:14143804-14143826 GCCCCTCCCAGGATTTCCCTGGG + Intergenic
1007059782 6:38927447-38927469 GTCCATTCTAGGATTTCCCTGGG - Intronic
1007321393 6:41031017-41031039 GCCCCACCCAGGACTTCCCCTGG - Intronic
1007740949 6:44009180-44009202 GTCCCCTTGAGGAGGTCCCCAGG - Intergenic
1008010769 6:46465528-46465550 GTTCTCTCCAGAATATCCCCAGG - Intronic
1008035851 6:46744498-46744520 GAGGCCCCCAGGATTTCCCCAGG - Intergenic
1013077853 6:106787232-106787254 CTCTCCTCCAAGACTTCCCCTGG + Intergenic
1016894483 6:149038666-149038688 GGACCCTCCAGGTCTTCCCCTGG - Intronic
1017322348 6:153108453-153108475 CTTCCCTCCAGGAATTTCCCAGG - Intronic
1018901221 6:168052716-168052738 GTCCCCTCCTGGCTCTGCCCTGG - Intergenic
1019119373 6:169791007-169791029 GTCCCCCCCTGGATTTCCTAGGG + Intergenic
1019414860 7:922499-922521 GACCCCTCCCCGCTTTCCCCAGG + Intronic
1019588572 7:1817566-1817588 TGCCCCTCCAGGACATCCCCTGG - Intronic
1019683526 7:2366785-2366807 CTCCCATCCAGGACTTCCCACGG - Intronic
1019733833 7:2640978-2641000 ATCTCCTCCAGGATGTCCCCAGG - Intronic
1020113411 7:5461052-5461074 GTCCCCGCCAGCCTTTCTCCTGG + Intronic
1022380307 7:29853260-29853282 TTCTCCTCTAGGAGTTCCCCTGG + Intronic
1022486734 7:30784721-30784743 GAGCCCTTCAGAATTTCCCCAGG + Intronic
1022954891 7:35371890-35371912 GTCCCCACCAGGAATGACCCTGG - Intergenic
1023393683 7:39733222-39733244 GTCGCCTCCAGGGTGTCCCAAGG - Intergenic
1025164121 7:56695742-56695764 GTACCTGGCAGGATTTCCCCAGG - Intergenic
1025706159 7:63866329-63866351 GTACCTGGCAGGATTTCCCCAGG + Intergenic
1029207283 7:98877614-98877636 CTCCCCTCCAGGGTATCCACGGG + Intergenic
1029441807 7:100590858-100590880 TTCCCCTCCAGGGATCCCCCAGG + Intronic
1032467993 7:132158790-132158812 CTCCCCATGAGGATTTCCCCAGG + Intronic
1035601659 8:900571-900593 TTCCCCATCAGAATTTCCCCCGG + Intergenic
1039596580 8:38795603-38795625 ATACCCTCCAAGATTTCCTCTGG - Intronic
1042641547 8:70940866-70940888 GTCTTCTCCAGGGTTTTCCCTGG + Intergenic
1044124195 8:88437589-88437611 GTCGCCACCAGGACTTGCCCGGG - Intergenic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1049496749 8:142939219-142939241 CTCCCCACAAGGATGTCCCCAGG + Intergenic
1049784717 8:144444754-144444776 GTCCCCACCAGGCACTCCCCGGG - Intergenic
1052142892 9:25009267-25009289 GTGCCCACAAGAATTTCCCCTGG + Intergenic
1052861730 9:33441880-33441902 AGCCCCTTCAGGATTTCCACTGG - Exonic
1053157347 9:35790844-35790866 GTCCGTTACAGGCTTTCCCCAGG + Intergenic
1053347663 9:37389760-37389782 TTTCCCTCCAGAATTTTCCCTGG + Intergenic
1056137213 9:83642181-83642203 GTCCCGACCAGGATTTCCACTGG - Intronic
1056826641 9:89880418-89880440 CTCCCCACCAGGACTTCCCAGGG - Intergenic
1057207474 9:93182364-93182386 GTCCCATCCTGGTTTTCCCTTGG + Intergenic
1059102605 9:111484269-111484291 CCCGCCTCGAGGATTTCCCCCGG - Intronic
1060376232 9:123117238-123117260 CTCCCCTCCAGGATTACAGCAGG + Intronic
1061271380 9:129545408-129545430 TTCCTCACCAAGATTTCCCCAGG - Intergenic
1061381532 9:130261572-130261594 GTCCTCTCGAGCAATTCCCCAGG - Intergenic
1061749847 9:132770161-132770183 GACCCCCCCAGGCCTTCCCCTGG - Intronic
1062000531 9:134213682-134213704 GGCCCCTCCTGGACCTCCCCTGG - Intergenic
1062324464 9:136005474-136005496 GTCCCCACCAGGAATGCCCAAGG - Intergenic
1189310392 X:40013937-40013959 TGGCACTCCAGGATTTCCCCCGG - Intergenic
1189564989 X:42232391-42232413 GTTCCCACCAGCACTTCCCCTGG - Intergenic
1202196742 Y:22305695-22305717 GTCCCCTGCAGTACTTCTCCAGG - Intergenic