ID: 1149551334

View in Genome Browser
Species Human (GRCh38)
Location 17:57542430-57542452
Sequence GTGACCAATGCTAAGGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149551334_1149551339 15 Left 1149551334 17:57542430-57542452 CCCACAGCCTTAGCATTGGTCAC 0: 1
1: 0
2: 1
3: 10
4: 98
Right 1149551339 17:57542468-57542490 ATTAATGTCATGTTAGATGTTGG 0: 1
1: 1
2: 3
3: 35
4: 305
1149551334_1149551341 29 Left 1149551334 17:57542430-57542452 CCCACAGCCTTAGCATTGGTCAC 0: 1
1: 0
2: 1
3: 10
4: 98
Right 1149551341 17:57542482-57542504 AGATGTTGGAATTGGATCGATGG 0: 1
1: 0
2: 0
3: 4
4: 114
1149551334_1149551340 21 Left 1149551334 17:57542430-57542452 CCCACAGCCTTAGCATTGGTCAC 0: 1
1: 0
2: 1
3: 10
4: 98
Right 1149551340 17:57542474-57542496 GTCATGTTAGATGTTGGAATTGG 0: 1
1: 0
2: 0
3: 5
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149551334 Original CRISPR GTGACCAATGCTAAGGCTGT GGG (reversed) Intronic
903672777 1:25046326-25046348 GTGTCCAAAGCAAAGGCGGTGGG - Intergenic
907564410 1:55421420-55421442 GTGACCAAAGCACAGGCTTTGGG + Intergenic
1064646494 10:17465032-17465054 CAGAGCAATGCTAAGGATGTAGG - Intergenic
1071181438 10:82988931-82988953 GTGCCCATGGCTAAGGCTATCGG + Intergenic
1072430023 10:95362659-95362681 GTGAGCAATGATAAGGCGGGAGG - Intronic
1076277865 10:129220141-129220163 CTGGCCAATGCTCTGGCTGTTGG - Intergenic
1076491261 10:130863129-130863151 GTGACCAATGCTGTGGCAGAGGG - Intergenic
1079535864 11:21514722-21514744 GTCATCTATGCTAAGGCTGTGGG + Intronic
1081413440 11:42786081-42786103 GTGACCACAGCTAAGGCTTGAGG - Intergenic
1085689312 11:78652482-78652504 GTGACCAGTCCTGAGGCTGATGG + Intergenic
1088047707 11:105473600-105473622 GTGACCAAGGGGAAGACTGTAGG + Intergenic
1090722967 11:129493759-129493781 CTGCCCATTGCTAAGACTGTGGG - Intergenic
1093626935 12:21360703-21360725 GTGCCATTTGCTAAGGCTGTTGG - Intronic
1094383959 12:29873452-29873474 GTGCCCATTTCTAAGGCTGTAGG - Intergenic
1098947624 12:76606253-76606275 GTGACCTCAGCTAAGGCTTTTGG + Intergenic
1099573748 12:84357092-84357114 GTGACAACTGCTATGGCTGGTGG + Intergenic
1103707620 12:122887035-122887057 GTGGCAAATGTTAAGACTGTGGG - Intronic
1104572146 12:129934754-129934776 GTGACACAGGCTAAGGCTGCTGG + Intergenic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1106928442 13:34637405-34637427 GTGCCCTATGCAGAGGCTGTTGG + Intergenic
1108107592 13:47028329-47028351 GTAACGAATGACAAGGCTGTGGG - Intergenic
1109862131 13:68213676-68213698 GTGAGAAATGCTAAGGTTGTAGG - Intergenic
1110434393 13:75463270-75463292 GTGGCAAATCCTAAGGCTCTTGG + Intronic
1111375154 13:87368558-87368580 GTGCCATTTGCTAAGGCTGTTGG + Intergenic
1112118572 13:96384508-96384530 GTGTCCATTGCTGTGGCTGTGGG + Intronic
1112696694 13:101957500-101957522 CTGACCAATGGCAATGCTGTTGG - Intronic
1113770897 13:112908157-112908179 GTGTCCAATGCCAAGGGTGTGGG + Intronic
1114968021 14:27988236-27988258 GTGCCCAATGATATGGATGTAGG + Intergenic
1115238322 14:31229948-31229970 CTGACTAATCCTAAGGCTGGCGG - Intergenic
1117054091 14:51892725-51892747 GTAACCAATGTTAATGCTTTGGG + Intronic
1121649969 14:95550633-95550655 GTGACCAAGGAAAAGGCTGGGGG - Intergenic
1121771387 14:96545429-96545451 GTCACCAATGCTAACGCTGCTGG - Intronic
1123122673 14:105925291-105925313 GTGACCAATGATGTGACTGTGGG + Intronic
1123405320 15:20016717-20016739 GTGACCAATGATGTGACTGTGGG + Intergenic
1123514650 15:21023365-21023387 GTGACCAATGATGTGACTGTGGG + Intergenic
1134254729 16:12601651-12601673 GTGAGCAATGCTCAGGCAGAAGG + Intergenic
1134555663 16:15161804-15161826 GTGGCCAAAGCTAAGGCTGTAGG + Intergenic
1134740127 16:16535635-16535657 TTGGCCAAAGCTAAGGCTGCAGG + Intergenic
1134927374 16:18176530-18176552 TTGGCCAAAGCTAAGGCTGCAGG - Intergenic
1135988173 16:27199811-27199833 ATGGCCAATTCTAAGGCTGCTGG + Intergenic
1138140447 16:54563810-54563832 GAGTCCACTGCTAAGGCTCTTGG - Intergenic
1140189757 16:72805338-72805360 GTGAGCAATGCCAAGGCGGTAGG - Intronic
1140399389 16:74658356-74658378 GTGACCTCAGCTAAGCCTGTTGG + Intronic
1140701301 16:77583946-77583968 GTGACCAGTGGAAAGACTGTAGG + Intergenic
1146069615 17:29668173-29668195 GCAACCAGTGATAAGGCTGTAGG - Intronic
1147315650 17:39618876-39618898 GAGGCCAATGCCAAGGCTTTGGG + Intergenic
1147537658 17:41331529-41331551 CTGCCCAATGCAAAGGCTATGGG + Intergenic
1147902513 17:43798317-43798339 GTGCCGTTTGCTAAGGCTGTTGG + Intergenic
1149551334 17:57542430-57542452 GTGACCAATGCTAAGGCTGTGGG - Intronic
1152089017 17:78236830-78236852 GTGACCAATACCAAGGCTGCTGG - Intronic
1155706498 18:28822119-28822141 GTGTCCAATGCTAAGCATGGGGG + Intergenic
925161996 2:1692070-1692092 GTGACCTTTTCCAAGGCTGTCGG - Intronic
925420765 2:3709446-3709468 GTGAACAATGCTGGGGCTGCTGG - Intronic
927823538 2:26290566-26290588 GTGGTCAATGCTGAGGCTGCTGG + Intergenic
930516907 2:52420019-52420041 GTGCCGTTTGCTAAGGCTGTTGG - Intergenic
930893693 2:56421347-56421369 GTGCCCTTTGCTAAGACTGTTGG - Intergenic
930962335 2:57276662-57276684 GTGCCATTTGCTAAGGCTGTTGG + Intergenic
931986199 2:67744797-67744819 GTGCCATTTGCTAAGGCTGTTGG + Intergenic
937775015 2:125765981-125766003 GGGACCAGTGCTCATGCTGTAGG + Intergenic
938217459 2:129532189-129532211 GTGCCGTTTGCTAAGGCTGTTGG - Intergenic
941645520 2:168036268-168036290 GTGAAGAAGGCTAAGGCAGTGGG + Intronic
944613022 2:201430653-201430675 GTGCCCTTTGCTAAGACTGTTGG + Intronic
1173813113 20:45968329-45968351 GTGACCAGTGCTGAGGATGGCGG - Exonic
1175506347 20:59487660-59487682 GAGACTAATGATAAGGCTGCAGG - Intergenic
1179194809 21:39155178-39155200 GTCACCACTGCAAACGCTGTGGG - Intergenic
1180186245 21:46140814-46140836 GTGAGCAATGTGAAGGCTGACGG - Intronic
1181595295 22:23910576-23910598 AAGGCCAATGCTAAGGCTGATGG + Intergenic
1182318235 22:29462061-29462083 GTGACCAGTGCTTACCCTGTAGG + Intergenic
950343496 3:12270672-12270694 GGCACTAATGCTAGGGCTGTGGG - Intergenic
957544374 3:81618306-81618328 GTAATCTATTCTAAGGCTGTAGG - Intronic
958255496 3:91320453-91320475 GTGCCCTTTGCTAAGACTGTCGG + Intergenic
962914110 3:139883273-139883295 GTGCCCTTTGCTAAGACTGTTGG + Intergenic
963347616 3:144114601-144114623 GTGGCCATTTATAAGGCTGTGGG - Intergenic
964260092 3:154825799-154825821 GTGCCGTTTGCTAAGGCTGTTGG + Intergenic
967959219 3:194907061-194907083 GTGACTAAACCTATGGCTGTGGG + Intergenic
969695068 4:8729633-8729655 GTGACCACTGCCAAGGCCATGGG + Intergenic
975034286 4:69661459-69661481 GTGCCATTTGCTAAGGCTGTTGG + Intergenic
978926335 4:114250191-114250213 CTGACAAATGCTAGGACTGTAGG + Intergenic
979439331 4:120733001-120733023 ATAACAATTGCTAAGGCTGTAGG - Intronic
983027868 4:162759300-162759322 GTCACCATTGCTATTGCTGTTGG - Intergenic
990175543 5:53103885-53103907 GTGGCCAATGCCAAGGCACTGGG + Intronic
992031701 5:72727908-72727930 GTGCCATTTGCTAAGGCTGTTGG - Intergenic
992488208 5:77215988-77216010 GTGACCAATCGGAGGGCTGTAGG + Intronic
994087035 5:95770433-95770455 GTGACCACTGCTAAGAATGCAGG + Intronic
994350256 5:98737497-98737519 GTGCCCTTTGCTAAGACTGTTGG - Intergenic
997137736 5:131344316-131344338 GTGCCTTTTGCTAAGGCTGTTGG - Intronic
1006150714 6:31986582-31986604 TTGACCATTGTTAAGGTTGTTGG + Intronic
1006157015 6:32019320-32019342 TTGACCATTGTTAAGGTTGTTGG + Intronic
1008999850 6:57700716-57700738 GTGCCCTTTGCTAAGACTGTTGG - Intergenic
1012203871 6:96437281-96437303 GTGCCCTTTGCTAAGGCTGTTGG - Intergenic
1014787332 6:125633891-125633913 GTGACCAGTGATAAGGGTTTGGG - Intergenic
1023357606 7:39382735-39382757 GTGCCCTATTCTAAGGCTCTAGG - Intronic
1024803961 7:53114310-53114332 ACGATCAATGCTAAGGCTGAAGG + Intergenic
1028991070 7:97049511-97049533 GTGCACACTGCTAGGGCTGTGGG - Intergenic
1029449332 7:100632176-100632198 GTGACCAATGCTCAGGACTTCGG - Exonic
1030142597 7:106320459-106320481 GTGCCATTTGCTAAGGCTGTTGG - Intergenic
1032220378 7:129989908-129989930 GTGATCAATCCTAAGACTCTGGG + Intergenic
1035190945 7:157167877-157167899 ATGACCAGTGCTACTGCTGTTGG - Intronic
1044224974 8:89708486-89708508 GTGCCCTTTGCTAAGACTGTTGG - Intergenic
1046857906 8:119055435-119055457 GTGACCCATGCTAACCTTGTGGG - Intronic
1052637023 9:31119787-31119809 CTGACCATTCCTAAGGTTGTTGG + Intergenic
1054749667 9:68892385-68892407 GTAACTAATGTTAAGGATGTAGG + Intronic
1058243866 9:102600676-102600698 GTGCCATTTGCTAAGGCTGTTGG + Intergenic
1193855020 X:86590029-86590051 GTTACCACCGCTAAGGCTGGGGG + Intronic
1193916796 X:87374994-87375016 TTGAACAATGCAAAGGTTGTAGG - Intergenic
1195603167 X:106771578-106771600 GTGCCATTTGCTAAGGCTGTTGG + Intronic
1197432455 X:126383450-126383472 GTGCCGTTTGCTAAGGCTGTTGG - Intergenic
1198281776 X:135149729-135149751 ATGACCAATCCTAATGCTGTGGG + Intergenic
1198289183 X:135222793-135222815 ATGACCAATCCTAATGCTGTGGG - Intergenic
1202034747 Y:20620643-20620665 GTGCCATTTGCTAAGGCTGTTGG + Intergenic