ID: 1149553088

View in Genome Browser
Species Human (GRCh38)
Location 17:57554481-57554503
Sequence GTGTGCACACGCGCTTGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 69}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149553084_1149553088 3 Left 1149553084 17:57554455-57554477 CCTCTCCTCCTCAGCAAGTAGTC 0: 1
1: 0
2: 0
3: 13
4: 159
Right 1149553088 17:57554481-57554503 GTGTGCACACGCGCTTGTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 69
1149553081_1149553088 6 Left 1149553081 17:57554452-57554474 CCCCCTCTCCTCCTCAGCAAGTA 0: 1
1: 0
2: 2
3: 24
4: 339
Right 1149553088 17:57554481-57554503 GTGTGCACACGCGCTTGTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 69
1149553085_1149553088 -2 Left 1149553085 17:57554460-57554482 CCTCCTCAGCAAGTAGTCAATGT 0: 1
1: 0
2: 1
3: 5
4: 104
Right 1149553088 17:57554481-57554503 GTGTGCACACGCGCTTGTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 69
1149553080_1149553088 7 Left 1149553080 17:57554451-57554473 CCCCCCTCTCCTCCTCAGCAAGT 0: 1
1: 1
2: 0
3: 48
4: 600
Right 1149553088 17:57554481-57554503 GTGTGCACACGCGCTTGTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 69
1149553078_1149553088 20 Left 1149553078 17:57554438-57554460 CCTGAGACACCATCCCCCCTCTC 0: 1
1: 0
2: 1
3: 22
4: 299
Right 1149553088 17:57554481-57554503 GTGTGCACACGCGCTTGTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 69
1149553086_1149553088 -5 Left 1149553086 17:57554463-57554485 CCTCAGCAAGTAGTCAATGTGTG 0: 1
1: 0
2: 1
3: 15
4: 114
Right 1149553088 17:57554481-57554503 GTGTGCACACGCGCTTGTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 69
1149553079_1149553088 11 Left 1149553079 17:57554447-57554469 CCATCCCCCCTCTCCTCCTCAGC 0: 1
1: 1
2: 18
3: 238
4: 2376
Right 1149553088 17:57554481-57554503 GTGTGCACACGCGCTTGTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 69
1149553082_1149553088 5 Left 1149553082 17:57554453-57554475 CCCCTCTCCTCCTCAGCAAGTAG 0: 1
1: 0
2: 0
3: 20
4: 325
Right 1149553088 17:57554481-57554503 GTGTGCACACGCGCTTGTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 69
1149553083_1149553088 4 Left 1149553083 17:57554454-57554476 CCCTCTCCTCCTCAGCAAGTAGT 0: 1
1: 0
2: 1
3: 24
4: 237
Right 1149553088 17:57554481-57554503 GTGTGCACACGCGCTTGTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149553088 Original CRISPR GTGTGCACACGCGCTTGTTT GGG Intronic
900814840 1:4835764-4835786 GTGTGCACACAGGCATGTTGTGG + Intergenic
900883148 1:5396485-5396507 GTGTGCACACATGTTTGTATGGG + Intergenic
905638599 1:39573486-39573508 GTGTACACACGGACTTGGTTGGG - Intronic
910485258 1:87706007-87706029 GTGTGGACAGGGGCTTGCTTGGG + Intergenic
919502196 1:198350886-198350908 GTGTGCACATGCGTGTGTTTTGG - Intergenic
1065063959 10:21939976-21939998 GTATACACACACGTTTGTTTTGG - Intronic
1067706045 10:48607187-48607209 GGGTCCACTCACGCTTGTTTTGG + Intronic
1068519797 10:58065621-58065643 GTGTGTGCGCGCGCGTGTTTAGG + Intergenic
1072276352 10:93827101-93827123 GTGTGCATGCGCGCATGTTTTGG + Intergenic
1076361470 10:129892294-129892316 GTGTGCACATGCCCCTGCTTTGG + Intronic
1084445521 11:69201386-69201408 GTGTGCACACACGTGTGTCTGGG + Intergenic
1090939164 11:131372468-131372490 GTGTGCACCCCTGCTTGTTCTGG + Intronic
1092567577 12:9685000-9685022 GTCTGGACATGGGCTTGTTTTGG + Intronic
1098796120 12:74889997-74890019 GTGTGCACACACACATGTTTAGG - Intergenic
1099887804 12:88553317-88553339 GTGTGCACACCCACATATTTAGG - Intronic
1102180162 12:110906618-110906640 GTGTGCACGTGTGCTTGTTGGGG - Intronic
1106493776 13:30254935-30254957 TTGTGCACACGTACTTATTTAGG - Intronic
1107553115 13:41495147-41495169 CTGTGCACACGTGCTTGGTAAGG - Intergenic
1113459939 13:110474927-110474949 GTGTGCACAGGCACGTGTGTGGG - Intronic
1113459942 13:110474971-110474993 GTGTGCACAGGCACGTGTGTGGG - Intronic
1113825076 13:113246296-113246318 ATGAGCACAGGCACTTGTTTTGG + Intronic
1120818813 14:88892748-88892770 GTGTGCACACGAGCACGTGTAGG + Intergenic
1121073154 14:91043501-91043523 GTGTGCTCACCGGCTTGTTCAGG - Intronic
1122244227 14:100390427-100390449 GCATGCACACGCCCTTGTGTGGG + Intronic
1124637400 15:31373868-31373890 GTGAGCACACACGCGTGTGTTGG + Exonic
1128074086 15:64815566-64815588 GTGCACACACGTGTTTGTTTAGG - Intergenic
1133595904 16:7291625-7291647 ATGTGCAGATGCGTTTGTTTGGG + Intronic
1133924259 16:10181170-10181192 GTGTGCACGCGCGCGTGTAGGGG - Intronic
1149553088 17:57554481-57554503 GTGTGCACACGCGCTTGTTTGGG + Intronic
1152882695 17:82828673-82828695 GTGTGCACACTCGATTCTGTGGG - Intronic
1159142647 18:64416307-64416329 GTGTGCACACGTGTGTTTTTTGG + Intergenic
1159943731 18:74428174-74428196 GTGTGCACACTGGCTTGGTTGGG - Intergenic
1162807151 19:13143938-13143960 GTGTGCACATGTGCGTGTTCCGG - Intergenic
1166051421 19:40262983-40263005 GTGTGCACAAGCGTGTGTGTAGG + Intronic
925691567 2:6529378-6529400 GTGTGCACATGCGCATGTGCTGG + Intergenic
926140989 2:10368134-10368156 GTGTGCACACGTGCATGTGTAGG + Intronic
927164402 2:20302571-20302593 GTGTGCATGCATGCTTGTTTAGG - Intronic
930417573 2:51108170-51108192 GTGTGCACACGTGCATGTAGGGG - Intergenic
935506235 2:103907389-103907411 GTGTGCACGGGCGCATGTGTGGG - Intergenic
935690669 2:105728545-105728567 GCGTGCACACGTGCATTTTTGGG + Intergenic
936268722 2:111032060-111032082 GTGTGCACACCCTCCCGTTTAGG - Intronic
937711128 2:124981313-124981335 GTGTGCACACGTGTGTGTTTAGG + Intergenic
939830007 2:147060351-147060373 GTGTGCACACACGCATGATCTGG + Intergenic
939862333 2:147435191-147435213 GTGTGTACACACACATGTTTTGG - Intergenic
947794623 2:232886461-232886483 GTGTGCACAGGCGTCTGTTTAGG + Intronic
1174396640 20:50250856-50250878 GTGTGCACATGGGCGTGTGTGGG - Intergenic
1176185933 20:63779050-63779072 GTGTGCTCACGAGCGTGTTCAGG + Intronic
949513105 3:4783636-4783658 CTGTGCACAGGCGCTATTTTGGG - Intronic
949886584 3:8699909-8699931 GGGTACACACGCCTTTGTTTAGG + Intronic
956174974 3:66464414-66464436 GTCTGCACTGGCCCTTGTTTCGG - Intronic
956991198 3:74767797-74767819 GGGTGAACTCTCGCTTGTTTGGG + Intergenic
964596708 3:158440585-158440607 GTGTGCACACGTGCATGTGTGGG - Intronic
966929971 3:184670155-184670177 GTGTGCACAACCACTTGGTTTGG + Intronic
969450823 4:7272018-7272040 GTGTGCACACTCACATGCTTGGG + Intronic
977114385 4:93004503-93004525 GTGTGCACACACACTTGTAGGGG - Intronic
985863531 5:2493468-2493490 GTGTGCACATGTGCCTGTTTGGG + Intergenic
986866385 5:11994084-11994106 CTGTGCAGAAGCTCTTGTTTAGG + Intergenic
991113396 5:62926840-62926862 GTGTGCACGCGCGTGTGTGTTGG + Intergenic
1001425944 5:171622720-171622742 GTGTGCACACGTGCATGTTCAGG + Intergenic
1001433822 5:171683972-171683994 ATGGGAACATGCGCTTGTTTGGG + Intergenic
1002559739 5:180072914-180072936 GTGTGCGCGCGCGCGCGTTTCGG - Intergenic
1004444314 6:15684254-15684276 GTGTGCACACACTCCTGTTGAGG - Intergenic
1005527962 6:26670152-26670174 GTGTGCACACAGGCATGTGTAGG - Intergenic
1005542836 6:26831523-26831545 GTGTGCACACAGGCATGTGTAGG + Intergenic
1009013647 6:57873691-57873713 GTGTGCACACATGCATGTGTAGG + Intergenic
1016564497 6:145438089-145438111 GTGTGCACACGTGTGTGTGTGGG + Intergenic
1018975148 6:168558769-168558791 GTGTGCACATGCGTATGTGTGGG + Intronic
1019183150 6:170205167-170205189 GTGTGCACATGCGCGTGCATAGG - Intergenic
1019468577 7:1204629-1204651 GAGTGCACACGTGCTGTTTTGGG - Intergenic
1019520065 7:1456797-1456819 GTGGGGACATGCGCTTGTATGGG - Intronic
1026488963 7:70846313-70846335 GTGTGCACAAGCTTTTGCTTAGG - Intergenic
1032758136 7:134911398-134911420 GTGTGCACATGCTTTGGTTTTGG + Intronic
1034720415 7:153287027-153287049 CTGTGCACATGGCCTTGTTTGGG - Intergenic
1052206118 9:25842909-25842931 GTGTGCTCACTAGCTTGCTTAGG - Intergenic
1053271624 9:36753902-36753924 ATGTGCACAAGAGCTTGTGTTGG - Intergenic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1060252810 9:121999735-121999757 GTGTGCACGCGCACGTGTGTGGG - Intronic
1186349899 X:8731008-8731030 GTGTGCGCGCGCGCTTGTGTGGG - Intronic
1196514997 X:116599907-116599929 CTTTGCACACTAGCTTGTTTGGG + Intergenic
1200338075 X:155373462-155373484 GTGTGCACGCGCACGTGCTTAGG - Intergenic
1200348394 X:155467232-155467254 GTGTGCACGCGCACGTGCTTAGG + Intergenic