ID: 1149553304

View in Genome Browser
Species Human (GRCh38)
Location 17:57555706-57555728
Sequence CCTATTATGTCCCAGGTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 901
Summary {0: 1, 1: 3, 2: 22, 3: 132, 4: 743}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149553304_1149553309 13 Left 1149553304 17:57555706-57555728 CCCAGTACCTGGGACATAATAGG 0: 1
1: 3
2: 22
3: 132
4: 743
Right 1149553309 17:57555742-57555764 CTTATTAACCAGAAGAGTGATGG 0: 1
1: 0
2: 0
3: 17
4: 187
1149553304_1149553311 30 Left 1149553304 17:57555706-57555728 CCCAGTACCTGGGACATAATAGG 0: 1
1: 3
2: 22
3: 132
4: 743
Right 1149553311 17:57555759-57555781 TGATGGTGTTTATCCTCACCAGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149553304 Original CRISPR CCTATTATGTCCCAGGTACT GGG (reversed) Intronic
901371625 1:8803342-8803364 CCTGTAAGGTCCCAGCTACTCGG + Intronic
901667321 1:10833717-10833739 CCTACTATGTGCCAGGCATTGGG + Intergenic
901681748 1:10916788-10916810 CCTACTATGTGCCAGGTGCCAGG - Intergenic
902533594 1:17106077-17106099 CCTGTTAGGACCCAGGCACTGGG - Intronic
902642226 1:17774358-17774380 CCTACTATGTGCCTGGTGCTGGG - Intronic
902711816 1:18245697-18245719 CCTACTATGTGCCAGGCACTGGG + Intronic
902784865 1:18726453-18726475 CCTTCTGTGTCCCAGGCACTGGG + Intronic
903038268 1:20508756-20508778 CCTATTATGTGTCAGGTTCGAGG + Intergenic
903093581 1:20946600-20946622 CTTATTATGTGCCAGGAACTGGG + Intronic
903117381 1:21189385-21189407 CTTCCTATGTGCCAGGTACTAGG - Intergenic
903254340 1:22083477-22083499 CCTGTTAAGTCCCAGCTACTTGG + Intronic
903374204 1:22855504-22855526 CCCAGTAGGTGCCAGGTACTGGG - Intronic
903643206 1:24874539-24874561 CCTGTTAAGTTCCAGTTACTTGG + Intergenic
903773089 1:25776425-25776447 CCTATAATTACCCAGCTACTTGG + Intronic
903994829 1:27299216-27299238 CCTACTATGTGCTAGGTACTAGG + Intronic
904040351 1:27580710-27580732 CTTATTATGTGCCAGGCACTGGG - Intronic
904094231 1:27965336-27965358 GCTGTTATGTGCCAGGTACTGGG + Intronic
904117863 1:28175642-28175664 CCTATCAGGTCCCAGGTGCTGGG - Intronic
904232880 1:29091516-29091538 CCTATAATGTCCTAGGGTCTGGG - Intronic
904312683 1:29639535-29639557 CCTACTATGTGCCAGGCACAAGG + Intergenic
904321402 1:29699758-29699780 CCTGCTCTGTGCCAGGTACTGGG + Intergenic
904356796 1:29945481-29945503 CCTATTACGTGCCAGGTTCTGGG - Intergenic
904413457 1:30339978-30340000 CCTATTTTGTGCCAGATACAGGG - Intergenic
904581819 1:31549275-31549297 CCTACTATGTGCTAGGTGCTGGG + Intergenic
905016725 1:34782932-34782954 CCTACTATGTGCCAAGCACTGGG + Intronic
905071526 1:35229999-35230021 CCTACAATGTCCCTGGAACTAGG + Intergenic
905220453 1:36442716-36442738 CTTTCTATGTCCCAGGCACTGGG + Intronic
905346728 1:37316262-37316284 CCTACTATGTACCAGGCACCGGG - Intergenic
905618384 1:39417897-39417919 CCTACTCTGTGCCAGGTACTAGG + Intronic
905847723 1:41246673-41246695 CCTATTATGTGCCAGGAACTGGG + Intergenic
906804566 1:48767923-48767945 CCTACTATGTGCCAGGCTCTGGG + Intronic
907249990 1:53131710-53131732 CCTACTATGTGCCTGGCACTTGG + Intronic
907324442 1:53627802-53627824 CCTGTTGTGTGCCAGGCACTGGG + Intronic
907564140 1:55418987-55419009 CATACTATGTGCCAGGCACTAGG + Intergenic
907807328 1:57834463-57834485 CCTACCATGTACCAGGCACTAGG + Intronic
908228339 1:62078798-62078820 CCTACTATGTTCCAGGCACTGGG + Intronic
908285995 1:62602440-62602462 CCTCTTATGGACCAGGTATTAGG + Intronic
908348253 1:63258344-63258366 CCTAATGTGTGCCTGGTACTGGG + Intergenic
908548669 1:65187695-65187717 CATACTATGTCCCAGGCACTGGG - Intronic
909102371 1:71365210-71365232 CCCACTATATGCCAGGTACTTGG - Intergenic
909257557 1:73443852-73443874 GCTTTTATGTCCAAGGTAATGGG + Intergenic
909281040 1:73753963-73753985 CATATTATGTCACAGTTAATTGG - Intergenic
909391024 1:75122254-75122276 CCTACTATGTACCAGGAACTGGG - Intergenic
909547608 1:76865289-76865311 CCTACTATGTGCCAGGTATTAGG - Intergenic
910691230 1:89967611-89967633 CCTGTAAAGTCCCAGCTACTTGG + Intergenic
911230868 1:95360311-95360333 CTTACTATGTGCCAGGAACTAGG + Intergenic
911636954 1:100246699-100246721 CCTACAATGTGCCAGGCACTTGG + Intronic
911712498 1:101090369-101090391 CCTACTATGTACCAGGTCTTGGG - Intergenic
912033616 1:105282276-105282298 CCTGTAATATCCCAGCTACTCGG + Intergenic
912560327 1:110546938-110546960 CCTACTCTGTGCCAAGTACTAGG - Intergenic
912664025 1:111562932-111562954 CTTACTATGTACCAGGTACTGGG + Intronic
912710464 1:111946065-111946087 CCTACTATGTGCCAAGCACTGGG - Intronic
912858280 1:113191314-113191336 ACTACTGTGTCCCAGGCACTGGG + Intergenic
912918210 1:113839338-113839360 CCTGTAGTGTCCCAGCTACTTGG - Intronic
912934170 1:113988313-113988335 CCTACTGTGTGCCAGATACTGGG - Intergenic
912962345 1:114207421-114207443 TCTTTTAAGTCCCAGGCACTGGG - Intergenic
913489408 1:119364896-119364918 CCTACTATGTACCAGGCTCTGGG + Intergenic
913570469 1:120114967-120114989 CCTACTATGTGCTAGGCACTGGG - Intergenic
913685707 1:121230045-121230067 CTCATTATGTGCCAAGTACTGGG + Intronic
914037554 1:144017648-144017670 CTCATTATGTGCCAAGTACTGGG + Intergenic
914151900 1:145050284-145050306 CTCATTATGTGCCAAGTACTGGG - Intronic
914214315 1:145610723-145610745 CCTAATATGTGCCAGGTCCAAGG - Intronic
914291274 1:146275945-146275967 CCTACTATGTGCTAGGCACTGGG - Intergenic
914461241 1:147887352-147887374 CCTACTACGTGCCAGGCACTGGG - Intergenic
914466254 1:147931122-147931144 CCTAATATGTGCCAGGTCCAAGG - Intronic
914552318 1:148726728-148726750 CCTACTATGTGCTAGGCACTGGG - Intergenic
914936729 1:151988162-151988184 TCTATTAAGTACCACGTACTGGG - Intronic
914984341 1:152443147-152443169 CCTACTGTGTACCAGGCACTGGG + Intergenic
915375770 1:155393894-155393916 TCTATTATGTACCAGGTGCTGGG + Intronic
915523973 1:156464999-156465021 CCTACTATGTGCCAGGCACTGGG + Exonic
917067097 1:171108718-171108740 CCTACTATGTGCCAGGCACTGGG + Intronic
917589010 1:176457964-176457986 CCTACTATGCTCCAGGTACTAGG - Intergenic
917654251 1:177110589-177110611 CCTACTATGTGCAAGGTACATGG + Intronic
917798597 1:178550667-178550689 CTAATTATGTGCCAGGCACTGGG + Intergenic
918126704 1:181590227-181590249 CCTTTAAGGTGCCAGGTACTAGG + Intronic
918256272 1:182751394-182751416 CCTATTAGGTGTCAGGTACCAGG + Intergenic
918267819 1:182862863-182862885 ATTACTATGTACCAGGTACTGGG - Intronic
918718987 1:187828166-187828188 CCTCTGTTGTCCCAGCTACTCGG + Intergenic
919781134 1:201221879-201221901 CCTACTAGGTGCTAGGTACTGGG + Intronic
920050171 1:203159743-203159765 CCTATCAGGTGCCAGGTTCTAGG - Intronic
920057098 1:203200806-203200828 CCTATTAGGTGCCAAGTCCTGGG + Intergenic
920103565 1:203534159-203534181 CCTTTCATGCACCAGGTACTGGG + Intergenic
920162475 1:204010007-204010029 CCTATTTAGTCCCAGCTGCTTGG - Intergenic
920194289 1:204216607-204216629 CTTACTATGTGCCAGGTACCTGG - Intergenic
920418797 1:205816150-205816172 CCTACTATGTGCCAGGAGCTGGG - Intergenic
920473027 1:206248602-206248624 CTCATTATGTGCCAAGTACTGGG + Intronic
920568082 1:206992258-206992280 CCTGTCAAGTCCCAGCTACTCGG - Intergenic
920607834 1:207407241-207407263 CATATGAGGTCCCAGCTACTGGG + Intergenic
920825935 1:209424244-209424266 CCTATTACATGCTAGGTACTAGG + Intergenic
920855079 1:209655396-209655418 CCTACTATGTGCCAGGCACTTGG - Intergenic
922129266 1:222760710-222760732 TTTATTATGTGCTAGGTACTGGG + Intergenic
922282772 1:224142013-224142035 CCTGTAGAGTCCCAGGTACTTGG - Intronic
922367037 1:224875738-224875760 CCTATTTTGTTCCACGTCCTGGG + Intergenic
923117236 1:230953468-230953490 CTTACTATGTGCCAGGCACTGGG + Intronic
923328385 1:232900206-232900228 CTTTCTATGTTCCAGGTACTGGG - Intergenic
924153053 1:241148520-241148542 CCTATTTTGTGTCAGGCACTGGG - Intronic
1063474124 10:6313737-6313759 CCCATTATGTGCCAGGGATTAGG - Intergenic
1063828554 10:9926126-9926148 CCTACTATGTGACAGGTTCTGGG - Intergenic
1063877699 10:10497381-10497403 TCAATTATGTGCCAGGCACTAGG + Intergenic
1064057132 10:12107108-12107130 CCTATGTAGTCCCAGCTACTCGG - Intronic
1066504883 10:36031172-36031194 CCTTTTATTTGCCAGGCACTGGG + Intergenic
1068345089 10:55765902-55765924 TCTATTATTTGCCAGGCACTAGG - Intergenic
1068650094 10:59513111-59513133 TCTATTATATGCCAGATACTTGG + Intergenic
1068775855 10:60867044-60867066 CTTATTATGTCCAAGGTACTTGG + Intergenic
1069225776 10:65942401-65942423 CCTATAGTGTCCCAACTACTCGG + Intronic
1069628456 10:69882498-69882520 CCTATTATGTGACAGGTGCCTGG - Intronic
1069881992 10:71598907-71598929 CATATTATGTCCCAAGCCCTTGG - Intronic
1069906805 10:71736715-71736737 CCTGCTGTGTCCCAGGCACTAGG + Intronic
1070236838 10:74636575-74636597 CCTACTATGTTCTATGTACTTGG + Intronic
1070286074 10:75084904-75084926 CCTACTATGTGCCAGGCACTGGG + Intergenic
1070372955 10:75802686-75802708 CTTATTATGTGCCAGGTACTGGG - Intronic
1070640320 10:78164220-78164242 CCTAGTGTGTCCCAGGCACCTGG + Intergenic
1070735760 10:78862543-78862565 CCTATTTTGTACCAGGTATTGGG + Intergenic
1070861474 10:79669035-79669057 TCTATTATTTGCCAGGCACTGGG + Intergenic
1071048978 10:81422602-81422624 GATTTTATGTTCCAGGTACTAGG + Intergenic
1071145542 10:82566104-82566126 CTTATTAAGTGCCACGTACTGGG - Intronic
1071146301 10:82576796-82576818 CCTATTATGTCTCAAACACTGGG - Intronic
1071710301 10:88043157-88043179 CCTACTATGTGCCAGGCACTAGG + Intergenic
1072119241 10:92391762-92391784 CGTCTGTTGTCCCAGGTACTTGG + Intergenic
1072177896 10:92947042-92947064 CCTATTATGTGCTAGGCTCTGGG - Intronic
1072222028 10:93334751-93334773 CCTACTATGTGCCAGGTACTAGG + Intronic
1072306510 10:94112937-94112959 CCTACTATGTGCCTGGTCCTAGG + Intronic
1072419234 10:95275441-95275463 CCTACTATGTTCCAGTTATTGGG - Intronic
1072445864 10:95497894-95497916 CCTACTATGTGCCAGGCTCTGGG - Intronic
1072637632 10:97187798-97187820 CCTACTAAGTGCCAGGTGCTGGG - Intronic
1073258323 10:102169850-102169872 CCTATATAGTCCCAGCTACTCGG + Intergenic
1073460774 10:103664598-103664620 CCCATTACATCCCAGGTACCTGG + Intronic
1073495199 10:103884592-103884614 CCTTTTGTGTGCCAGATACTGGG - Intronic
1073619120 10:105028733-105028755 CTTATTATGTGTCAGGTGCTAGG - Intronic
1073667088 10:105545746-105545768 CCTATTATGTGACAAGCACTAGG - Intergenic
1074273085 10:111974233-111974255 CTTATTATGTGTCAGGTTCTTGG + Intergenic
1074738435 10:116460259-116460281 CCTAGTATGTGCCAGGAACTAGG - Intronic
1075113952 10:119610419-119610441 CCTATATAGTCCCAGCTACTTGG - Intergenic
1075130476 10:119733882-119733904 CCTGTTATGGGCCAGGTGCTAGG - Intronic
1075934549 10:126328227-126328249 CCTATTATGTGCCAGGTGCTAGG - Intronic
1076200059 10:128551026-128551048 CCTATTATGGGCCAGGGGCTTGG + Intergenic
1077999462 11:7481938-7481960 CCTAGTGTGTTCCAGGAACTGGG - Intergenic
1078320486 11:10330092-10330114 CCTATTACGTGCAAGATACTGGG - Intronic
1078423643 11:11232265-11232287 CCTACTATGCACCAGGCACTAGG + Intergenic
1078613108 11:12839523-12839545 GTTATTATGTCCCAGGTGCTAGG + Intronic
1078647671 11:13156978-13157000 CCTACTATGTATCAGGCACTAGG - Intergenic
1078806138 11:14706957-14706979 CCTGGTATGTACCAGGTGCTGGG + Intronic
1078806719 11:14713056-14713078 CCAATTATGTGTAAGGTACTAGG + Intronic
1079247528 11:18763707-18763729 CCTACTAGGTCTCAGGTACTAGG - Intronic
1079258062 11:18849813-18849835 CCTAATATGTGCCAGGAAATAGG - Intergenic
1079487251 11:20948166-20948188 CCTGTGAAGTCCCAGCTACTTGG - Intronic
1079493002 11:21010476-21010498 TCTATTATGCCCCAGGCATTGGG - Intronic
1080043948 11:27788883-27788905 CCTACTATATGCTAGGTACTTGG - Intergenic
1080117096 11:28633344-28633366 CCTACTGTGTGCCAGGCACTGGG - Intergenic
1080194399 11:29591939-29591961 CCTATTATATGCCAGGCACTCGG - Intergenic
1080409276 11:32008539-32008561 CCTGTTATATGCCAGGCACTGGG - Intronic
1080432764 11:32213940-32213962 TCTACTATGTGCCAGGCACTAGG + Intergenic
1080499831 11:32860090-32860112 CCTATCATGTGCCAGTTTCTAGG + Intergenic
1080971779 11:37286304-37286326 CCTATTATGTCCCAGGCACTAGG + Intergenic
1081603542 11:44512204-44512226 CTCAATATGTGCCAGGTACTGGG - Intergenic
1081729839 11:45363052-45363074 CATACTATGTGCCAGGCACTAGG - Intergenic
1081756071 11:45545451-45545473 CCTATTATGTGCCAGGCACTGGG + Intergenic
1081768103 11:45626601-45626623 CCTACTATGTGCTAGGTAATAGG + Intergenic
1083252716 11:61478550-61478572 CCTACCGTGTGCCAGGTACTGGG + Intronic
1083294026 11:61705701-61705723 CCTACTATGTGCCAGGGATTGGG - Intronic
1083718916 11:64594408-64594430 CCTACTATGTGCCAGGTGCTCGG - Intronic
1084084439 11:66848558-66848580 TCTAAGATGTCCCAGGTCCTGGG - Exonic
1085107270 11:73856036-73856058 CCTACTGTGTGTCAGGTACTTGG - Intronic
1085212512 11:74794029-74794051 CCTAGTATGTGCTAGGCACTGGG + Intronic
1085267581 11:75246419-75246441 CCTACTATGTGCCAGGGTCTGGG + Intergenic
1085749400 11:79147680-79147702 CTTTCTATGTACCAGGTACTAGG + Intronic
1085854179 11:80157593-80157615 CTTAATATGTGCCAGGTGCTAGG + Intergenic
1086540072 11:87898562-87898584 CCTAGTATGTGCCAGGTGTTAGG - Intergenic
1087079020 11:94152053-94152075 CCTTTTATGTGCCAGGGATTAGG + Intronic
1087268463 11:96086223-96086245 CCTACAATGTGCCAGGAACTGGG - Intronic
1087727123 11:101733158-101733180 CTTATAATGTGTCAGGTACTAGG - Intronic
1088297825 11:108319677-108319699 CCTATTATGTGCCAGGCACTAGG - Intronic
1088562386 11:111128492-111128514 TCTACTATGTGCCAGGCACTGGG - Intergenic
1089343403 11:117774938-117774960 CTTACTATATCCCAGGTACAGGG - Intronic
1089417982 11:118308742-118308764 CCTACTATGTGCCAGACACTGGG - Intronic
1089564931 11:119365794-119365816 CTTATTAGATCCCAGGCACTGGG + Intronic
1089625354 11:119747771-119747793 CCTACTATGTGCCAGGCCCTAGG + Intergenic
1089756835 11:120693554-120693576 CCTAGTATGTGTCAGATACTGGG + Intronic
1089947713 11:122494885-122494907 TCTACTATATGCCAGGTACTGGG + Intergenic
1091081808 11:132677562-132677584 TCTATTCTGTCCCATTTACTTGG - Intronic
1091372207 11:135070426-135070448 CCTATTATGTACCAGGCACTGGG - Intergenic
1091495829 12:972164-972186 CCTATTACGTTCCAAGCACTAGG + Intronic
1091593495 12:1859231-1859253 CCTGTACTGTCCCAGGTACTCGG + Intronic
1091629074 12:2145599-2145621 CCTACTGTGTACCAGGCACTGGG + Intronic
1092963577 12:13619621-13619643 CCGATTCTGTGCCAGGCACTGGG + Intronic
1093372133 12:18377980-18378002 CCTGTTATATCCCAGCTACTTGG - Intronic
1093583429 12:20808514-20808536 TCTATAATGTGCCAGGTACTGGG + Intergenic
1094093601 12:26678048-26678070 CCTGGTATGTGCCAGGCACTTGG - Intronic
1094352770 12:29545036-29545058 CCTACTATGTGCCAGACACTCGG - Intronic
1094642168 12:32286789-32286811 CCTAAAATGTACCAGGTATTAGG + Intronic
1095226369 12:39681764-39681786 CCTACTCTGTTCCAGGTACTAGG - Intronic
1095721506 12:45406178-45406200 CCTGTCATATGCCAGGTACTGGG - Intronic
1095818009 12:46445971-46445993 CCTATTATGTGCCAGGTTCTAGG + Intergenic
1096217493 12:49806087-49806109 CCTGCTATGTGCCAGGCACTGGG + Intronic
1096634903 12:52952011-52952033 CCTGCTATGTGCCAAGTACTGGG - Intronic
1096766316 12:53893164-53893186 CTTATGATGTGCCAGGCACTGGG - Intergenic
1096968147 12:55645036-55645058 CCTACTATGTGCCAGGCACTAGG + Intergenic
1097545552 12:60996343-60996365 CCTCTGAAGTCCCAGCTACTCGG + Intergenic
1097841308 12:64324208-64324230 CCTAGTATGTACCAAGCACTGGG + Intronic
1098083816 12:66819501-66819523 ACTATTATGTACCAGGAATTGGG + Intergenic
1098184985 12:67886919-67886941 CCTAATGTGTGTCAGGTACTGGG + Intergenic
1098405217 12:70117878-70117900 TCTATTATGTGCCAGGCACTAGG - Intergenic
1099029500 12:77507738-77507760 CCTATTGTGTGTCAGGTACCAGG + Intergenic
1099616358 12:84940459-84940481 CCTATCATGTTCCAGATATTAGG - Intergenic
1099978666 12:89572871-89572893 CTTACTATGTGCCAAGTACTTGG - Intergenic
1100132515 12:91513754-91513776 CCTATTATGGTCCAGGGACGTGG + Intergenic
1100620890 12:96271758-96271780 CCTAAAATGTATCAGGTACTAGG + Intergenic
1100736009 12:97532273-97532295 CCTATTATGTGCCAGACATTGGG - Intergenic
1100850353 12:98703744-98703766 CCTAACATGTGCCAGGAACTGGG + Intronic
1100888042 12:99094122-99094144 TTTATTATGTGCCAGGCACTGGG + Intronic
1101003450 12:100379030-100379052 CCTACTGTGTCTCAGGTACTGGG - Intronic
1101019552 12:100539666-100539688 CCTATTATGTGCCAGGAACTGGG + Intronic
1101323364 12:103693309-103693331 CCTATGTGGTCCCAGCTACTAGG + Intronic
1101359259 12:104010616-104010638 TCTACTATGTGCCAGGCACTGGG - Intronic
1101513362 12:105412200-105412222 CCTACTATGAGCCAGGCACTTGG - Intergenic
1101582416 12:106053562-106053584 CCTACTGTGTACCAGGCACTAGG - Intergenic
1101593979 12:106147475-106147497 CCTACTATATAGCAGGTACTAGG - Intergenic
1101734673 12:107454095-107454117 CCTACTATGTGCCAGGCACAGGG - Intronic
1101801246 12:108023851-108023873 GCTATTATGTGACAGGCACTAGG - Intergenic
1101845225 12:108358171-108358193 CTTATTATGTGCCAGGCACTGGG + Intergenic
1101873875 12:108586271-108586293 CCTACTATGTGCCGGGTATTGGG - Intergenic
1101946639 12:109142359-109142381 ACTAATATTTCTCAGGTACTTGG + Intronic
1101963837 12:109268678-109268700 CCTTTTATGACCTAGGTCCTTGG + Intergenic
1102069912 12:110009988-110010010 CCTATATTGTCCCAGCTACTCGG - Intronic
1102225565 12:111225844-111225866 CTTATTATGTACCAAGTTCTGGG - Intronic
1102232015 12:111269252-111269274 CCTACTGTGTACCAGGTTCTGGG - Intronic
1102324758 12:111970383-111970405 CCTTTTATTACCCAGGTATTAGG - Intronic
1102415131 12:112755057-112755079 CCTACTAAGTGCCAGGCACTAGG - Intronic
1102426731 12:112849683-112849705 CCTATTATGTACCAGGCTTTGGG - Intronic
1102432393 12:112893854-112893876 CCTACTATGTGCCAGACACTGGG + Intronic
1102452641 12:113053321-113053343 CCTCCTATGTGCCAGGCACTGGG - Intergenic
1102633836 12:114305135-114305157 CCTACTATGTGCCAGGCAGTAGG - Intergenic
1102742632 12:115221815-115221837 CTTACTATGTCCCAGGTGTTGGG + Intergenic
1103046162 12:117736405-117736427 CTTATTATGGGCCAGGCACTGGG - Intronic
1103206755 12:119135630-119135652 CCTACTATGCACCAGGTGCTAGG + Intronic
1103468185 12:121158882-121158904 CCTACTATTTGCCAGGCACTTGG + Intronic
1103616451 12:122155946-122155968 GCTTCTATGTCCCAGGCACTTGG + Intergenic
1103716504 12:122948434-122948456 CCTGCTATGTCCCAGGCACTGGG - Intronic
1103824881 12:123729938-123729960 CCTATATAGTCCCAGCTACTCGG - Intronic
1104109540 12:125691655-125691677 CGTCTGAAGTCCCAGGTACTTGG + Intergenic
1105288717 13:19031144-19031166 ACTATTATGTCTCAGGGACTAGG + Intergenic
1105504753 13:20999902-20999924 CCTATATAGTCCCAGCTACTAGG + Intronic
1106196990 13:27502449-27502471 CATTTTCTGTGCCAGGTACTTGG + Intergenic
1106773268 13:32983594-32983616 CCTACCATGTGCCAGATACTGGG + Intergenic
1108400455 13:50036881-50036903 CCTATTATGTGCCTGGTAGTGGG + Intergenic
1108711135 13:53033558-53033580 CCTACTCTGTGCCAGGGACTTGG + Intronic
1109204003 13:59461666-59461688 CCTATTATGTTCAAGGCACTGGG - Intergenic
1109813310 13:67544735-67544757 CCTACTATGTGCTAAGTACTAGG + Intergenic
1110620026 13:77584980-77585002 CCTACTAGGTGCCAGGTACTTGG - Intronic
1110703274 13:78574679-78574701 CCTAAGATGTGCCAGGCACTGGG + Intergenic
1110863838 13:80373093-80373115 CCTGTAGTGTCCCAGCTACTTGG - Intergenic
1111937810 13:94574541-94574563 CCTATTATTTCCTAGTTTCTAGG + Exonic
1111957931 13:94778753-94778775 CCCATTATTTGCCAGGCACTGGG + Intergenic
1112703734 13:102042138-102042160 CCTATCATGTGCTAGGTAGTAGG - Intronic
1113417558 13:110140168-110140190 CTTATTATTTCCCAAGTACTAGG - Intergenic
1113782587 13:112985221-112985243 CGTACTCTGTCCCAGGTAGTGGG + Intronic
1114334041 14:21669311-21669333 CTTATTATGTACCAGATACTAGG - Intergenic
1115738641 14:36363345-36363367 CCTACTATGTGTCAGGCACTAGG - Intergenic
1116722605 14:48519042-48519064 CATATTTTGTACCAGGTAATGGG + Intergenic
1117032870 14:51693005-51693027 CCCACTAGGTACCAGGTACTGGG - Intronic
1117211323 14:53503442-53503464 CCTACCATGTGCTAGGTACTAGG + Intergenic
1117391093 14:55263658-55263680 CCTATTATGTACCAGGCATGAGG + Intergenic
1117663354 14:58031076-58031098 TCTAATAGGTACCAGGTACTGGG + Intronic
1117983960 14:61368939-61368961 TCTAATATGTGCCAGGCACTGGG + Intronic
1118397842 14:65352811-65352833 GATGTTATGTCCCAGCTACTTGG + Intergenic
1118752984 14:68819952-68819974 CCTGCTATGTGCCAGGCACTGGG + Intergenic
1118779555 14:68998046-68998068 CTTACTGTGTGCCAGGTACTGGG - Intergenic
1118904304 14:70012343-70012365 TCTACTATGTGCCAGGCACTGGG + Intronic
1119513801 14:75232347-75232369 CCTATTAGCTCCCAGATACTTGG + Intergenic
1119531059 14:75361686-75361708 CCTATTATGTGTGAGGCACTGGG + Intergenic
1119678487 14:76574315-76574337 CCTACTATGTGCCAGGCATTTGG - Intergenic
1119828257 14:77676336-77676358 CCTGTTATATAACAGGTACTTGG - Intronic
1119954547 14:78782574-78782596 CCTAATATGTGACAGGGACTGGG + Intronic
1120885224 14:89446724-89446746 CCTACTATGTGCCAGGCACCTGG - Intronic
1121242186 14:92438990-92439012 CCTATTATGCCCGAGGTTCCGGG + Intronic
1121540092 14:94719109-94719131 TCTACTTTGTGCCAGGTACTGGG - Intergenic
1121758026 14:96419506-96419528 CCTATATAGTCCCAGCTACTTGG + Intronic
1121779670 14:96614156-96614178 CCTACTGTGTGCCAGGCACTGGG - Intergenic
1121816268 14:96931503-96931525 CCTGTGATGTGCCAGGCACTAGG + Intronic
1122196607 14:100092114-100092136 ACACTTATGTCCCAGCTACTCGG + Intronic
1122255995 14:100476921-100476943 CCTATTATGTGCCAGGAACTAGG + Intronic
1122357332 14:101131583-101131605 CCTGCTCTGTCCCAGGTGCTGGG - Intergenic
1122555796 14:102579265-102579287 CTCATTTTGTCCCAGGTGCTGGG - Intergenic
1123170954 14:106372408-106372430 TCTATTCTGTCCTTGGTACTTGG + Intergenic
1125335620 15:38623514-38623536 CCTACTATGTGCCAGGAACTTGG - Intergenic
1125348063 15:38739972-38739994 CCTTCTATTTCCTAGGTACTGGG + Intergenic
1125633207 15:41165623-41165645 CTTATTATCTCCCAGTTTCTGGG + Intergenic
1126068298 15:44843253-44843275 CCCATTGTGTGCCAGGTACCAGG + Intergenic
1126090536 15:45047552-45047574 CCCATTGTGTGCCAGGTACCAGG - Intronic
1126185438 15:45826867-45826889 CCTAGTCTGTCCTAGGCACTGGG + Intergenic
1126644252 15:50859259-50859281 CCTGTAAAGTCCCAGCTACTTGG - Intergenic
1126674357 15:51146638-51146660 CATAGTATGTGCCAGGAACTGGG - Intergenic
1126831837 15:52615434-52615456 CCTATTATACCTCAGGTAATAGG + Intronic
1126847729 15:52776790-52776812 CCTCCTATGTGCCAGGCACTAGG - Intronic
1126869532 15:52972818-52972840 CCTATTATGTGCCAGCCACCTGG + Intergenic
1127860835 15:62993124-62993146 CCTTTTCTCTCCCAGGCACTGGG - Intergenic
1128216322 15:65936744-65936766 CATACTCTGTGCCAGGTACTGGG - Intronic
1128385617 15:67146281-67146303 CCTACTATGTGCAAGGCACTTGG - Intronic
1128753415 15:70164972-70164994 GCGCTTATGTCTCAGGTACTGGG - Intergenic
1129230474 15:74194417-74194439 CTTAGTATGTGCCAGGTTCTAGG + Intronic
1129281787 15:74490871-74490893 CCTATTATATCCCAGCAGCTGGG + Intergenic
1129442334 15:75590666-75590688 CCTACTATGTTCTAGGTTCTAGG - Intergenic
1130532601 15:84758798-84758820 CGTATTCAGTCCCAGCTACTTGG + Intronic
1130768011 15:86892641-86892663 CCTACTGTGTGCCAGGTGCTTGG - Intronic
1130934676 15:88458884-88458906 CCTCGTATGTGCCAGGCACTGGG + Intergenic
1131228990 15:90646833-90646855 CCTACTGTGTGCCAGGTGCTGGG - Intergenic
1131390084 15:92040688-92040710 CCTAATATGTCACAGGCAGTGGG - Intronic
1131401708 15:92130649-92130671 CCTATTAAGGTCCAGGTAATGGG + Intronic
1132775559 16:1591794-1591816 CCTATTGTATGCCAGGTACTTGG - Intronic
1133368981 16:5233833-5233855 CCTCTGTGGTCCCAGGTACTTGG + Intergenic
1133615810 16:7475869-7475891 CTTACTATGTCCCAGGAAGTGGG + Intronic
1134208466 16:12256684-12256706 CCTGCTATGTGCCAGGTACCAGG + Intronic
1134305003 16:13024030-13024052 CCTTTTATGTGCGAGGAACTGGG + Intronic
1134882612 16:17758876-17758898 TCTACTATGTTCCAGGTCCTGGG + Intergenic
1134915190 16:18063369-18063391 CCTATTATGTGCCATGCACTGGG - Intergenic
1135170573 16:20179797-20179819 CCTATGATGTGCCTGGTGCTGGG - Intergenic
1135175530 16:20224899-20224921 CTAATTGTGTGCCAGGTACTCGG - Intergenic
1135183335 16:20293546-20293568 CCTAATATGTCCCAGGTGTTAGG + Intergenic
1135190739 16:20352431-20352453 CCTATTATGTGCCAGGTACCAGG - Intronic
1135664967 16:24328029-24328051 CCTACTATGTGCCAGGTCCTGGG + Intronic
1135814738 16:25622285-25622307 TCTTTTATATTCCAGGTACTGGG - Intergenic
1135865684 16:26099675-26099697 CCAAATATGTCCCAGGTACTAGG + Intronic
1135997091 16:27258692-27258714 TCTCTTATGTGCCAGGTGCTTGG - Intronic
1136080323 16:27848274-27848296 CCTACTGTGTGTCAGGTACTGGG - Intronic
1137625020 16:49902162-49902184 CCTACTATGTTCCAGGTCCTGGG + Intergenic
1137780832 16:51096498-51096520 CCTACTAAGTGCCAGGTACTAGG + Intergenic
1138214418 16:55190847-55190869 CCTACTATGTACCAGGTCCTGGG + Intergenic
1138331050 16:56215545-56215567 CTTATTATGTTCCTAGTACTGGG - Intronic
1138509657 16:57500995-57501017 CCTACTCTGTGCCAGGCACTGGG + Intergenic
1139408729 16:66741063-66741085 CCTATACTGTACCAGGTACCAGG - Intronic
1139446894 16:67003595-67003617 CCTACTTTGTGCCAGGCACTTGG + Intronic
1140267090 16:73430011-73430033 CATGTTATATCCCAGCTACTTGG - Intergenic
1140446937 16:75036982-75037004 CCTGTTCTGTGCCAGGCACTTGG + Intronic
1140633456 16:76882328-76882350 CCTAGTATATCCCAGGCACATGG - Intergenic
1140834110 16:78777712-78777734 CCTATTATGTGCCAGATACTAGG + Intronic
1140867759 16:79078863-79078885 CCTATTATGTGCCTGGCAATTGG - Intronic
1141206752 16:81938786-81938808 CCTTTGGTGTCCCAGGTTCTCGG + Exonic
1142087162 16:88189544-88189566 CCTACTGTGTGCCAGGCACTAGG + Intergenic
1142535908 17:617614-617636 GCTATTATTTCCCAGGTAGCTGG + Intronic
1142535931 17:617714-617736 GCTATTATTTCCCAGGTAGCTGG + Intronic
1142536131 17:618563-618585 GCTATTATTTCCCAGGTAGCTGG + Intronic
1142692484 17:1615231-1615253 CCTGTAATATCCCAGCTACTTGG - Intronic
1142868379 17:2805086-2805108 CCTGTTTTGTGCCAGGCACTGGG - Intronic
1143043401 17:4056634-4056656 CCTACTATGTGCCAGGCACTAGG + Intronic
1143073394 17:4317391-4317413 CCTATATAGTCCCAGTTACTCGG + Intronic
1143119917 17:4600104-4600126 AAGATTATCTCCCAGGTACTAGG + Intronic
1143621379 17:8082276-8082298 CTTACTAGGTCCCAGGTATTGGG + Intronic
1144107347 17:11997730-11997752 CCTATTCTGTGCCAGGCACTCGG + Intergenic
1144620660 17:16816438-16816460 CCTACTATGTGCCAGGCATTGGG + Intergenic
1144884980 17:18451709-18451731 CCTACTATGTGCCAGGCATTGGG - Intergenic
1145147239 17:20492668-20492690 CCTACTATGTGCCAGGCATTGGG + Intergenic
1145248016 17:21282584-21282606 CCTACTATGTGCCTGGTTCTGGG + Intergenic
1145792313 17:27635312-27635334 CCTATTTTGTCCCAGCTATTCGG + Intronic
1145807203 17:27743215-27743237 CCTATTTGGTCCCAGCTATTCGG + Intergenic
1145989801 17:29072399-29072421 TCTGTTAAGTCCCAGCTACTCGG + Intergenic
1146083222 17:29802226-29802248 CCTATTATGTTTTAGATACTAGG + Intronic
1146447932 17:32947723-32947745 CCTACTGTGTGCCAGGAACTGGG - Intergenic
1146952064 17:36913590-36913612 CCTACTATGTGCCATGCACTGGG - Intergenic
1147127281 17:38380244-38380266 CCTGTTAGATGCCAGGTACTTGG + Intronic
1147169432 17:38609395-38609417 CCTCTTGTGCCCCAGGTGCTAGG - Intergenic
1147412264 17:40262204-40262226 CCTATATAGTCCCAGCTACTCGG - Intronic
1147456835 17:40543133-40543155 CCTATGATGTGCCAGGCACTGGG + Intergenic
1147572048 17:41577338-41577360 CCTACTATGTGCCAGGCATTGGG + Intergenic
1148472208 17:47901883-47901905 CCTACCATGTGCCAGGGACTGGG + Intronic
1148517700 17:48236894-48236916 CTTACTATGTGCCAGGCACTGGG + Intronic
1148582721 17:48754720-48754742 CGTATTATGTGCCAAGCACTGGG - Intergenic
1148678241 17:49457486-49457508 CCTACTATGTGGCAGGCACTGGG + Intronic
1148975978 17:51528605-51528627 CATAATCTGTGCCAGGTACTGGG + Intergenic
1149437472 17:56645206-56645228 CCTACTATGTGCCAGGCACTAGG + Intergenic
1149553304 17:57555706-57555728 CCTATTATGTCCCAGGTACTGGG - Intronic
1150201170 17:63359467-63359489 CCTGTAATATCCCAGCTACTTGG - Intronic
1150559642 17:66283429-66283451 TCTACTATGTGCCAGGTACTGGG + Intergenic
1150717542 17:67584768-67584790 CCTACTATGTCCCAGGCATTAGG + Intronic
1151639100 17:75376217-75376239 CCTATATAGTCCCAGCTACTTGG + Intronic
1151905746 17:77047519-77047541 CCTGTCAAGTCCCAGCTACTTGG - Intergenic
1153148242 18:2057989-2058011 CCTATAATGTCCCAGGGTCAAGG - Intergenic
1153206447 18:2708403-2708425 CCTATATAGTCCCAGCTACTCGG + Intronic
1153851164 18:9095843-9095865 CCTCTTATATGCCAGGCACTAGG - Intergenic
1153871064 18:9320665-9320687 CCTATTTTGTGCCAGGCACCAGG + Intergenic
1154213896 18:12401474-12401496 CCTAATATTTTCCAGGTACTGGG + Intergenic
1154362055 18:13671561-13671583 CTTGTTATCTCCCAGCTACTCGG + Intronic
1154971728 18:21416566-21416588 CCTGTAGTGTCCCAGCTACTCGG + Intronic
1155150333 18:23117890-23117912 CCTACTATGTGCCAGGCACTAGG + Intergenic
1155354805 18:24941884-24941906 CCTACTATGTGCAAGGTGCTTGG - Intergenic
1155384226 18:25259674-25259696 CCTACCATGTGCCAGGCACTGGG + Intronic
1156240234 18:35246868-35246890 CCTACTTTGTCCCAGGAACTAGG + Exonic
1156869080 18:41923790-41923812 CCTACTATGTGCTAGGCACTGGG - Intergenic
1157194294 18:45608113-45608135 CCTATTATGTACCAGTCACAGGG - Intronic
1157346026 18:46834076-46834098 CCTATCATGTGTCAGATACTAGG - Intronic
1157396738 18:47347924-47347946 CCTACTATGTGTCAGGGACTAGG - Intergenic
1157476023 18:48024181-48024203 CCCAGGATGTCCCAGGTCCTTGG + Intergenic
1157602739 18:48904114-48904136 CCTATTAAGTGCCATGTCCTAGG - Intergenic
1157931909 18:51832699-51832721 CCTCCTATGTCCAAGGTACATGG - Intergenic
1158130936 18:54151966-54151988 GCTATTACGTGCCAGGCACTGGG + Exonic
1158461850 18:57653408-57653430 CCTGTGAAGTCCCAGCTACTTGG - Intronic
1158867899 18:61655596-61655618 CCCATTATGTGCCAGGCACTAGG - Intergenic
1158867991 18:61656673-61656695 CGCATTATGTGCCAGGCACTGGG - Intergenic
1160477328 18:79203572-79203594 CCTATTCTGTGCTAGGTGCTAGG + Intronic
1162082607 19:8227458-8227480 CCAAGTAAGTCCCAGATACTTGG - Intronic
1162208373 19:9072959-9072981 CCTATATAGTCCCAGCTACTTGG - Intergenic
1162294822 19:9806080-9806102 CCTAATAGGGCCCAGTTACTGGG + Intergenic
1162394240 19:10407154-10407176 CCTACTATGTACCAGGTGCCAGG + Intronic
1163182369 19:15613684-15613706 CCTACTATGTGCCAGGCACTGGG - Intergenic
1164051944 19:21591299-21591321 GCTATTATGTGCTAGGCACTGGG + Intergenic
1164054745 19:21613027-21613049 CCTATTATGTATCAGATATTTGG - Intergenic
1165715552 19:38043622-38043644 TTTACTATGTGCCAGGTACTAGG - Intronic
1166950877 19:46427402-46427424 CCTACTATGTTCCAGGAGCTGGG - Intergenic
1167858086 19:52258883-52258905 CCTGTCAAGTCCCAGCTACTCGG - Intergenic
1168093553 19:54101503-54101525 CCTATTATGTGCCAGGCTCTTGG + Intronic
1168661449 19:58170681-58170703 CATCTGAAGTCCCAGGTACTCGG + Intergenic
925628539 2:5866040-5866062 CCTGCTATGTCCCAGGCATTGGG + Intergenic
926029287 2:9571642-9571664 CCTATTATGTGCTAGGCACAGGG - Intergenic
926067529 2:9855556-9855578 CCTATATAGTCCCAGCTACTTGG + Intronic
926186107 2:10692024-10692046 CTTACTATGTGCCAAGTACTGGG - Intergenic
926304368 2:11627408-11627430 CTTATTCTGTACCAGGCACTGGG + Intronic
926771920 2:16385813-16385835 CCTATTATGCTCCAGGCACTCGG + Intergenic
927145615 2:20163777-20163799 CTTTCTATGTTCCAGGTACTGGG - Intergenic
927511856 2:23649002-23649024 CCTACTACGTGCCAGGCACTGGG - Intronic
927652988 2:24923405-24923427 TCTACTAGGTGCCAGGTACTGGG - Intergenic
927859204 2:26549983-26550005 CCCATTCTGTGCCAGGCACTGGG + Intronic
927939260 2:27093483-27093505 CCTACCATGTCCCAGGCACTGGG + Intronic
928284208 2:29974835-29974857 CCTTCTATGATCCAGGTACTGGG + Intergenic
928320729 2:30281135-30281157 CCTACTACGTTCCAGGTAATTGG - Intronic
928335777 2:30396740-30396762 TCTATTTTGTGCCAGGCACTGGG + Intergenic
928545621 2:32326843-32326865 GATATTATGTACCAGGCACTAGG - Intergenic
929165030 2:38873692-38873714 CTTATTATGTGCCAGATCCTGGG + Intronic
929465351 2:42139019-42139041 CCTAGTATGACCTAGATACTGGG - Intergenic
930114299 2:47705743-47705765 CCTAATATGTGCCAGGCACTGGG - Intronic
930707383 2:54518166-54518188 CCTATTATTACTCAGGTACATGG - Intronic
930879051 2:56251268-56251290 CCTAATATATACCAGGCACTGGG - Intronic
931259605 2:60605761-60605783 CCTATGATGTGCCAGCTTCTGGG + Intergenic
932289092 2:70560086-70560108 CCTGTTGTGTTCCAGGCACTGGG + Intergenic
932762145 2:74445093-74445115 CTTGCTATGTCCCAGGCACTGGG - Intergenic
932769835 2:74494509-74494531 CCCACTATGTACCAGGCACTTGG - Exonic
932782029 2:74565250-74565272 CCTATTATGTTCCAAGCACTAGG + Intronic
932819203 2:74885293-74885315 CCTACTGTGTAGCAGGTACTGGG - Intronic
932851486 2:75191852-75191874 CCTACTCTGTGCCAGGCACTTGG + Intronic
932907171 2:75766772-75766794 GCTATTATGTGCCAAGCACTGGG - Intergenic
934797054 2:97110627-97110649 CTTCTTATGTTCCAGGCACTGGG + Intergenic
934836358 2:97592802-97592824 CTTCTTATGTTCCAGGCACTGGG - Intergenic
935449955 2:103197975-103197997 CCTTCTATGTTCCAGCTACTGGG + Intergenic
936398489 2:112148464-112148486 CCTACAATGGCCCAGGCACTGGG + Intronic
936877908 2:117214576-117214598 CCTACTATGTGTCAGGTACCAGG + Intergenic
937511148 2:122596218-122596240 CCTATTTTGTGCCAGGTTCTAGG + Intergenic
938882688 2:135607347-135607369 CCTATTATGTACCAGACACCAGG + Intronic
938925956 2:136042663-136042685 CATATGATGTTCCAGGTTCTGGG + Intergenic
939335695 2:140825399-140825421 CCTATAATGTGCCAGTTACTGGG - Intronic
939795326 2:146636379-146636401 CCTGTTCTGTCCCAGTTATTGGG - Intergenic
939828438 2:147044139-147044161 TTTATGATGTCCCTGGTACTAGG + Intergenic
939901202 2:147851823-147851845 CCTATTGTGTACCAGGTTCCAGG - Intronic
940040881 2:149359312-149359334 CCTACTGTGTGCCAGGCACTCGG - Intronic
940137468 2:150455006-150455028 CCTATTAGGTTCCAGGTACTGGG + Intergenic
940171818 2:150836708-150836730 CCTATTATGGACTAGGTCCTGGG + Intergenic
940970108 2:159886941-159886963 CATATTATTTGCCAGGTTCTAGG + Intronic
941283932 2:163585561-163585583 CCTAATATGTGCCAAGTACTGGG - Intergenic
941354794 2:164477269-164477291 TCTATTTTGTTCCAGGTTCTAGG + Intergenic
942082483 2:172413773-172413795 CCTATAGAGTCCCAGGTTCTGGG + Intergenic
942223890 2:173798139-173798161 CATAATATGTCCCAGGCTCTAGG - Intergenic
942969273 2:181938271-181938293 TCTATTGTATGCCAGGTACTTGG + Intergenic
943059066 2:183018816-183018838 CCTCTTATGTGTCAGGCACTAGG + Intronic
943132367 2:183870029-183870051 CATATAATCTCCTAGGTACTTGG + Intergenic
943695949 2:190930673-190930695 CCTATAGTGTGCCAGTTACTAGG + Intronic
943794643 2:191977036-191977058 CTTACTATGTGCCAGGAACTTGG - Intronic
943797133 2:192010610-192010632 CCTACTTGGTACCAGGTACTAGG + Intronic
944243943 2:197512915-197512937 CATATTATGTGCAAGGCACTGGG - Intronic
944537341 2:200724166-200724188 CCTTATATGTCCCAGGTAGTGGG - Intergenic
944654288 2:201862390-201862412 CTTATTATGTGCCAGGTAGGGGG - Intronic
945340252 2:208644200-208644222 TCTATTGTATCTCAGGTACTGGG + Intronic
945974583 2:216260257-216260279 CCTATTGTGTGCCAAGCACTGGG + Intronic
946044809 2:216812070-216812092 CCTTTATAGTCCCAGGTACTTGG + Intergenic
946176425 2:217924623-217924645 CCTACTATGCACCAGGCACTGGG + Intronic
946436454 2:219659478-219659500 CCTAATATATGCCAGGCACTAGG - Intergenic
946478059 2:220028161-220028183 TCTATTAGGTTCCAGGAACTAGG + Intergenic
946617329 2:221523909-221523931 CCTGGTATGTCCTAGGTGCTGGG + Intronic
946907968 2:224433936-224433958 CCTAGTATGTGTCAGGCACTGGG - Intergenic
947333845 2:229059400-229059422 CCTATTATGTGCTAGGCACAAGG + Intronic
947400871 2:229730442-229730464 CCTATTGTGGGCCAGGCACTGGG + Intergenic
948344288 2:237282491-237282513 CCTATTTTGTCCCAAATGCTGGG - Intergenic
1169069744 20:2717218-2717240 TCTACTATGTACCAGGCACTAGG + Intronic
1169137672 20:3207370-3207392 CCTACTATGTACCAGGAGCTGGG + Intergenic
1169683777 20:8247673-8247695 ACTACTATGTTCCAGGTATTAGG - Intronic
1169752882 20:9012820-9012842 CCTACTATGTGCCAGGCAGTAGG - Intergenic
1169919184 20:10715952-10715974 CCTACTTTGTGCCAGGCACTGGG - Intergenic
1169967135 20:11230198-11230220 CCTATGAAGTCCCAGGTAAAAGG + Intergenic
1170251946 20:14292984-14293006 CCTGCTATGTGCCAGGCACTAGG + Intronic
1170306591 20:14945241-14945263 TCTATTAAATCCCAGCTACTTGG - Intronic
1172042651 20:32056875-32056897 CCTACTATGTGCCAGGTGCCAGG - Intronic
1172050218 20:32111471-32111493 CCAATTCTGTTCCAGGAACTAGG + Intronic
1172053482 20:32137613-32137635 CCTACTATGTGTCAGGCACTGGG - Intronic
1172575335 20:36003778-36003800 CCTCTTATGAACCAGCTACTTGG + Intronic
1172594191 20:36138595-36138617 CTTAATATGTGCCAGGAACTGGG + Intronic
1172632332 20:36386708-36386730 CCTATAGTCCCCCAGGTACTTGG - Intronic
1172730003 20:37079076-37079098 CCTGTTAAGTCCCAGCTACTTGG + Intronic
1173001078 20:39106207-39106229 CCTCTTCTGTCCCAGGGCCTTGG - Intergenic
1173117687 20:40261712-40261734 CCTATTATGTACAAGGCACTGGG + Intergenic
1173154324 20:40595123-40595145 CCTACTATGCACCAGATACTGGG + Intergenic
1173170996 20:40723754-40723776 CCTACTATGTGCCAGGCCCTGGG + Intergenic
1173370987 20:42435072-42435094 CCTATTGTGTTCCAGGTACTAGG + Intronic
1173834363 20:46115596-46115618 CCTATTATGTACCTAGGACTGGG + Intergenic
1173908062 20:46643094-46643116 CCTACTATGTGCCAGGCACGGGG + Intronic
1174266903 20:49338541-49338563 CTTATTATCTGCCACGTACTGGG + Intergenic
1174502288 20:50994348-50994370 CTTACTATGGCCCAGATACTTGG + Intergenic
1175028317 20:55927028-55927050 CCCACTATGTGCAAGGTACTAGG + Intergenic
1175192505 20:57221064-57221086 CCTACTATGTGCCAGGCTCTAGG + Intronic
1177804587 21:25861849-25861871 CCTACTATGTCCCAGGTACTGGG - Intergenic
1178060854 21:28851912-28851934 CCTGGTATGTACCAGGTACTTGG - Intergenic
1178705420 21:34868811-34868833 CCTACTGTGTGCCAGGAACTGGG - Intronic
1178942040 21:36914421-36914443 CCTACTGTGTCCCAGGCATTGGG - Intronic
1179032254 21:37730883-37730905 TCTATTATGTGCCAAGTACTGGG + Intronic
1180977384 22:19855691-19855713 CCTATCTTGTCCCAGGATCTGGG - Intergenic
1181155002 22:20914468-20914490 TGTATTATGTGCTAGGTACTGGG + Intergenic
1181764006 22:25078201-25078223 CCTATTATGTGCCAGGCACTGGG - Intronic
1181821451 22:25478949-25478971 CCTACTATGTGCCAGGTGCAGGG + Intergenic
1181888787 22:26042770-26042792 CCTATTATGTGCTAGGCACTGGG + Intergenic
1181947331 22:26528388-26528410 TCTACTATGTGCCAGGTGCTGGG + Intronic
1182021408 22:27084689-27084711 CCTACTATGTACCAGGTGTTGGG - Intergenic
1182064750 22:27422568-27422590 CCTGCTATGTGCCAGGTACTTGG - Intergenic
1182125965 22:27816034-27816056 CCTACTATGTGCCAGGCACCAGG + Intergenic
1182216533 22:28723285-28723307 CTTTTTATATGCCAGGTACTAGG - Intronic
1182237975 22:28891493-28891515 CTTATTGTGTGCCAGGCACTGGG + Intronic
1182374356 22:29835688-29835710 CTTATTATGTGCCAGGTATTGGG - Intronic
1182469196 22:30537068-30537090 CTTATTCTGTACCAGGCACTGGG - Intronic
1182478024 22:30587207-30587229 CCTATTGTATCCCTGGTGCTAGG + Intronic
1182774311 22:32819551-32819573 CCTACTATATTCCAGGTGCTGGG + Intronic
1183099402 22:35574700-35574722 CCTACTATGTGCCAGGTTCTAGG - Intergenic
1183424614 22:37732872-37732894 CCTACTGTGTACCAGGCACTGGG - Intronic
1183436900 22:37801631-37801653 CTTAATATGTGCCAGGCACTGGG - Intergenic
1183788160 22:40044048-40044070 CCTATTTTGTGCCAAGTATTGGG - Intergenic
1183797400 22:40131025-40131047 CCTGTCAAGTCCCAGCTACTCGG - Intronic
1183856630 22:40638996-40639018 CCTGTCAAGTCCCAGCTACTCGG + Intergenic
1183975934 22:41512358-41512380 CATACTGTGTCTCAGGTACTAGG + Intronic
1184094699 22:42310298-42310320 CCTACTATGTGCCAGGTCCTGGG + Intronic
1184167117 22:42736128-42736150 CCTAGTATCTTCCAGGTCCTGGG - Intergenic
1184292440 22:43505244-43505266 CTTCTTATGTGCCAGGCACTGGG + Intronic
1184601275 22:45544850-45544872 CCTAGTATGTGCCAGGCCCTGGG - Intronic
1184653534 22:45930229-45930251 CCTTTTCTGTGCCAGGTGCTAGG - Intronic
1184925742 22:47635860-47635882 TCTACTATGTGCCAGGTGCTAGG - Intergenic
949488897 3:4568382-4568404 CCTATTATGTGCCAGATGCAGGG + Intronic
949541417 3:5035039-5035061 CCTATTATGTGCTATGTATTTGG + Intergenic
950070097 3:10145066-10145088 CCTGTTTAGTCCCAGCTACTCGG + Intronic
950074136 3:10175248-10175270 CCTGTAATCTCCCAGCTACTCGG - Intronic
950091957 3:10302110-10302132 CCTGTAATCTCCCAGCTACTGGG + Intronic
950139679 3:10606823-10606845 CCTACTATGTGCCAGGCCCTGGG - Intronic
950368577 3:12507612-12507634 CCTACTATGTGCCAGGCATTGGG + Intronic
950977421 3:17262893-17262915 CCAATTATGTTCCATGTCCTGGG + Intronic
951481828 3:23169503-23169525 CCTATTATGTGCCAGGCACGAGG + Intergenic
951649183 3:24930554-24930576 CCTATTATGTGCCAGGCATTGGG - Intergenic
951861265 3:27255831-27255853 CCTATTATTTGCCAGATACTAGG + Intronic
951954487 3:28239849-28239871 ACTATTATGTATCAGGTATTGGG + Intergenic
952041463 3:29266767-29266789 CCTATTAAGTTCTAGGTGCTGGG + Intergenic
952130314 3:30354485-30354507 CCTGTTATGTACTAGGCACTAGG + Intergenic
952508592 3:34031832-34031854 CCCATGATGTGACAGGTACTGGG + Intergenic
952582262 3:34848356-34848378 CCTAACATGTCCTAGGCACTGGG + Intergenic
952929614 3:38348854-38348876 CCTACTTTGTGCCAGGTGCTAGG + Intronic
953082735 3:39635780-39635802 CCTTTTGTGGCCCATGTACTTGG + Intergenic
954099205 3:48356412-48356434 CCTACTATGTGCCAGGCACTGGG + Intergenic
954539921 3:51386555-51386577 CCTACTATGTGCTAGGCACTGGG + Intronic
954893613 3:53956072-53956094 CCTACCATGTGCCAGGCACTGGG - Intergenic
955955728 3:64287570-64287592 CCTTCTATGTTCCAGGTGCTGGG - Intronic
956005352 3:64772879-64772901 CCTATTATGTGCTAGGTAAAGGG - Intergenic
956272330 3:67461491-67461513 TATATTATGTATCAGGTACTGGG + Intronic
956770800 3:72524321-72524343 CCTATTATATACCAGGAACTGGG - Intergenic
958906124 3:99943965-99943987 CCTATCATGTTCTAGGTACCAGG - Intronic
959084911 3:101841966-101841988 CCTACTAAGTAACAGGTACTTGG + Intronic
959297126 3:104550542-104550564 CCTACTATGTGCCAGGTCCAAGG - Intergenic
959580844 3:107980885-107980907 CCTACTATGTGCCAAGTGCTGGG + Intergenic
959758152 3:109924635-109924657 CCTACTATGTGCCTGGAACTGGG + Intergenic
960790015 3:121418707-121418729 CCTTTTATCTCCCAAGCACTGGG - Intronic
960837014 3:121917182-121917204 CATATTATGTGCTAGGTATTGGG + Intronic
960853432 3:122079031-122079053 CTTGCTATGTTCCAGGTACTAGG + Intronic
960897739 3:122523247-122523269 CCTGTTAAATCCCAGCTACTTGG - Intergenic
960959422 3:123058951-123058973 CCTACTATGTGCTAGGCACTGGG + Intergenic
961083442 3:124045673-124045695 CCTACTAAGTGCCAGGCACTGGG + Intergenic
961528724 3:127526428-127526450 CCTACTATGTGCCAGGCACTGGG + Intergenic
961829355 3:129615548-129615570 CCTACTATGTGCCAGGCACTGGG + Intergenic
962369206 3:134806745-134806767 CCTACTATGTACCAGGCAGTAGG + Intronic
962518744 3:136178656-136178678 CCTGTAATTTCCCAGCTACTTGG - Intronic
962597476 3:136961195-136961217 CCATTTATGTACCAGGTTCTGGG + Intronic
962713195 3:138104360-138104382 CCTGCTATGTGCCAGGCACTAGG - Intronic
962938217 3:140101177-140101199 CCTATTATGTACCAGGAACATGG - Intronic
963006517 3:140731384-140731406 CATATAATGTGCCAGGGACTGGG + Intergenic
963232832 3:142926215-142926237 CCTATCATGTGCCAGGCACTAGG + Intergenic
963295524 3:143541960-143541982 CCTTCTATGTCCTGGGTACTGGG - Intronic
963354222 3:144189898-144189920 ACTACTATGTGCCAGGGACTGGG - Intergenic
963385773 3:144591976-144591998 CCTACTATGTGTCAGATACTGGG + Intergenic
963700915 3:148625701-148625723 CCTGCTATGTGCCAGGCACTAGG - Intergenic
963719177 3:148840361-148840383 CCCAAAATGTCCCAGGTACCAGG + Intronic
964127518 3:153251286-153251308 CCTAATATGTGCTAGCTACTGGG + Intergenic
964209953 3:154215459-154215481 CCTACTATGTTTCAGGTACTAGG - Intronic
964686436 3:159401036-159401058 CTTATTATGTGTCAGGTACAGGG - Intronic
964711934 3:159680149-159680171 CCTATTGTGTTCCAGGTGCTGGG - Intronic
964718409 3:159747097-159747119 TCTACTATGTGCCAGGTACTGGG - Intronic
964846616 3:161051309-161051331 CCTACTATGTACAAAGTACTCGG - Intronic
964888407 3:161511074-161511096 CCTACTATGTACCAGGCACTAGG + Intergenic
965302980 3:167026879-167026901 CCTACTATGTGTCAGATACTTGG - Intergenic
965444117 3:168753246-168753268 CCCATTATGTTCCAAGCACTGGG + Intergenic
965460027 3:168951224-168951246 CCAACTATGTGCCAGGCACTGGG + Intergenic
965644289 3:170863690-170863712 TTTATTATGTGCCAGGGACTGGG - Intergenic
965908511 3:173741365-173741387 CCTACTATGTGCCAGGTAAAAGG + Intronic
966298213 3:178448716-178448738 CCTACTATGTGCCAGGTACTAGG + Intronic
966629710 3:182058946-182058968 CCTGCCATGTCTCAGGTACTGGG + Intergenic
966770561 3:183500056-183500078 CCTGTTATGCACCAGGTCCTGGG - Intronic
966841942 3:184096807-184096829 CCTGTGAGGTCCCAGCTACTTGG + Intergenic
967023812 3:185546400-185546422 CCTATATAGTCCCAGCTACTTGG + Intronic
967073292 3:185980821-185980843 CTTATTATGTACCAGGCACTGGG - Intergenic
967329694 3:188278082-188278104 CGTACTATGTTCCAGGCACTGGG + Intronic
967348923 3:188490484-188490506 CTTATAAAGTCCCAGCTACTCGG - Intronic
967362428 3:188647023-188647045 CCTATTATGGGCCAAGAACTAGG - Intronic
969067482 4:4498473-4498495 CCTATTATGTGCCAGTCATTGGG - Intronic
969528658 4:7717441-7717463 TCTATTATGGGCCAGGTAGTGGG - Intronic
970309831 4:14770431-14770453 TCTGTTAAGTGCCAGGTACTGGG - Intergenic
971292376 4:25355995-25356017 CCTACTATGTTCCAGGTATCAGG - Intronic
971319446 4:25593581-25593603 CCTATTATGTGACAGGCATTGGG + Intergenic
971383955 4:26126186-26126208 CCTATTTAGTGCCAGGCACTAGG + Intergenic
971529694 4:27671007-27671029 CCTTTTGTGAACCAGGTACTTGG + Intergenic
971610136 4:28713560-28713582 CCTAATATGTTTAAGGTACTTGG + Intergenic
971672596 4:29582151-29582173 TCTAATATGTCCCATGGACTTGG - Intergenic
971936166 4:33150579-33150601 CCTATTGCATCCCAGGGACTGGG + Intergenic
972375785 4:38468902-38468924 CCTACTTTGCCCCAGGTCCTTGG + Intergenic
972984151 4:44743432-44743454 CCTACTATGTGCCAGGCACTAGG - Intergenic
973133958 4:46683040-46683062 ATTATTATCACCCAGGTACTAGG + Intergenic
973553386 4:52057527-52057549 CCCAGTATGTACCAGGCACTGGG + Intronic
973728904 4:53804329-53804351 CCTACCATGTGCCAAGTACTAGG + Intronic
974879760 4:67740600-67740622 CCTACTATGTCCTAGGAATTTGG - Exonic
975349965 4:73334121-73334143 CCTATAAAATCCCAGCTACTAGG - Intergenic
975380317 4:73692391-73692413 CCTTTTATGTACTAGGTGCTGGG - Intergenic
976337830 4:83911241-83911263 TCTATTATGTGCAAGGTGCTGGG + Intergenic
976836043 4:89375087-89375109 CTTACTATGTGCCAGGCACTGGG - Intergenic
977207925 4:94184398-94184420 CCTCTTATGTGCCAGGTACTGGG + Intergenic
977840667 4:101699798-101699820 CCTATCAGGTCCCACGTAATTGG + Intronic
978731985 4:112038743-112038765 CCAGTTTTGTCCCAGGGACTTGG + Intergenic
979248439 4:118536217-118536239 CTTATGATGTGCCAGGCACTGGG - Intergenic
979958731 4:126989654-126989676 CCTATTATGTGTCAAATACTGGG - Intergenic
980508633 4:133756895-133756917 GCTACCATGTCCCAGCTACTCGG - Intergenic
980886624 4:138769292-138769314 CATATTATGTGCCAGGAATTGGG - Intergenic
980951003 4:139376781-139376803 CTTACTATATACCAGGTACTAGG - Intronic
980993870 4:139762240-139762262 CCTATTGTGTCCCAGGCGCTGGG - Intronic
981144841 4:141312243-141312265 CCTGTTCTGTCCCAGGAACAAGG - Intergenic
981469120 4:145109869-145109891 CCTTCTATGTCCTAGGTGCTAGG + Intronic
981765580 4:148245216-148245238 TCTACAATGTGCCAGGTACTTGG + Intronic
982546548 4:156740359-156740381 TCTATTATGTCTCAGGGCCTGGG + Intergenic
982901509 4:161009955-161009977 CCTATTGTGTTCAAGGGACTTGG - Intergenic
983090142 4:163493684-163493706 CCTACTGTGTGCCTGGTACTGGG - Intergenic
984617467 4:181914872-181914894 CCTTTTATGCACCAGGTACTGGG + Intergenic
985500197 5:238833-238855 CCTATGTAGTCCCAGCTACTTGG + Intronic
985737199 5:1590857-1590879 CCTATGTAGTCCCAGCTACTTGG - Intergenic
986187453 5:5458310-5458332 CCTGTTATGTTCCAGGGACCAGG + Intronic
986285460 5:6355381-6355403 CCTATTGTGTGACAGCTACTAGG + Intergenic
987158603 5:15116301-15116323 CCTACTATGTGTCAGGTAGTGGG - Intergenic
988544078 5:32140705-32140727 CCTATGTAGTCCCAGCTACTTGG + Intronic
989270814 5:39530833-39530855 ACTCTTATGTGCCAGGCACTGGG - Intergenic
989377080 5:40775577-40775599 CCTATAGTATACCAGGTACTAGG + Intronic
989669132 5:43893471-43893493 CCTCTTATGTCACATATACTTGG - Intergenic
990297142 5:54413663-54413685 TTTATCATGTGCCAGGTACTGGG - Intergenic
990670427 5:58123388-58123410 CCTACTATGTGCCTGGTGCTGGG + Intergenic
990843939 5:60115496-60115518 CCTACTATGTACCAGATACAGGG + Intronic
990937658 5:61167250-61167272 CTTAGTATGTACCAGGTGCTGGG + Intergenic
991034350 5:62113152-62113174 CCTATTATGCACTGGGTACTGGG - Intergenic
991112419 5:62915974-62915996 CCTGTTATAGACCAGGTACTTGG + Intergenic
991248552 5:64533860-64533882 CCTACTATGTACCAGGCACTGGG + Intronic
991471530 5:66974285-66974307 CACATTATGTGCCAGATACTAGG - Intronic
991522319 5:67514823-67514845 CCTACTATGTTCCAGGCACAGGG + Intergenic
992025616 5:72666163-72666185 CTTACTATGTGCCAGGCACTGGG + Intergenic
992795012 5:80247972-80247994 CCTATATAGTCCCAGCTACTTGG - Intronic
992844101 5:80727669-80727691 CCTATTATATGCCAGGCATTGGG + Intronic
993214719 5:85005572-85005594 CTTATTATGTAACAGGAACTTGG - Intergenic
993485312 5:88476646-88476668 TCTATTATGTACAAGGTGCTGGG - Intergenic
994332896 5:98527935-98527957 CCCACTGTGTCCCAGGTCCTAGG + Intergenic
994825409 5:104707704-104707726 CCTACTATGTACCAGCAACTGGG - Intergenic
996648888 5:125849212-125849234 CCTACTATGTACCAGGTCATAGG + Intergenic
997152612 5:131514861-131514883 TCTGATATGTCCCAGGTGCTAGG - Intronic
997178403 5:131802516-131802538 CCTACTATGTTCCAAGTGCTAGG + Intergenic
997275328 5:132582342-132582364 CCTGCTATGTGCCAGGCACTAGG - Intronic
997481461 5:134188214-134188236 CCTGTTATGTGCCAGGCATTAGG - Intronic
998430140 5:142063548-142063570 CCTATGATGTGCCAGGCACTAGG - Intergenic
998516113 5:142755709-142755731 CCTCCTTTGTCCCAGGTACTGGG + Intergenic
998617488 5:143756606-143756628 GCTATTACTTCCCAGGAACTAGG + Intergenic
998697985 5:144662715-144662737 CCTATGACTTTCCAGGTACTGGG - Intergenic
998754611 5:145362531-145362553 CATATTATATACCAGGTTCTGGG - Intergenic
998801198 5:145871256-145871278 CTTATTAGGTCCTAGGCACTTGG - Intronic
998921481 5:147073109-147073131 CCTAGTATGTGCCAGGCACTGGG - Intronic
998993331 5:147843163-147843185 CCTATGATCTACTAGGTACTGGG - Intergenic
999130414 5:149278721-149278743 CCTACTATGGGCCAGGCACTGGG - Intronic
999145011 5:149386685-149386707 CCTACTATGTGCCAGGCACTGGG + Intronic
999182921 5:149682679-149682701 CTTACTATGTGCCAGGCACTGGG - Intergenic
999241876 5:150132623-150132645 CATATTAGGTGCCAGGTGCTGGG - Intronic
999244361 5:150145703-150145725 CTTGTTCTGTGCCAGGTACTGGG - Intronic
999265734 5:150265615-150265637 CCTAGTATGTGCCAGGTGTTTGG - Intronic
999461950 5:151764928-151764950 GCTATTATGTGCCAGGCACTTGG - Intronic
999743753 5:154576382-154576404 CCTACTGTGTGCCAGGCACTGGG - Intergenic
999745057 5:154585547-154585569 CCTACTATGTGCTAGGCACTGGG - Intergenic
999885156 5:155914371-155914393 CCTACTATGTGCCAGGCTCTAGG + Intronic
1000137503 5:158367070-158367092 TTTAATATGTCCCAGGCACTAGG - Intergenic
1000278811 5:159764270-159764292 CCTCCTATGTGCCAGGCACTGGG - Intergenic
1000512474 5:162200537-162200559 ACCATTATGTTCCAGGAACTGGG - Intergenic
1000584934 5:163085811-163085833 CCTACCTTGTGCCAGGTACTGGG - Intergenic
1000714695 5:164626808-164626830 CCTGTTATCTACCAGGTATTAGG + Intergenic
1000739131 5:164944146-164944168 CTTATTATGTGCCAGGCACAAGG + Intergenic
1000781862 5:165492307-165492329 CCTGTAGTGTCCCAGCTACTTGG - Intergenic
1000850904 5:166339395-166339417 CCTACTTTGTGCCAGGTTCTGGG + Intergenic
1000916075 5:167083378-167083400 CCTATTATGTCCCAAGCAGTTGG - Intergenic
1001067475 5:168548354-168548376 CCTTCTCTGTGCCAGGTACTGGG + Intergenic
1001129344 5:169050839-169050861 CCTATTGTGTGCCAGGTACATGG - Intronic
1001307533 5:170586299-170586321 CCTAATATATGCAAGGTACTGGG - Intronic
1001505491 5:172276229-172276251 ACTATTATGTACTAGTTACTGGG - Intronic
1001640512 5:173240580-173240602 CCCACTATGTACCAGGTGCTGGG + Intergenic
1001812705 5:174641770-174641792 CCTGTTATGTGCCAGATACTGGG + Intergenic
1001828100 5:174762573-174762595 CTTACTGTGTGCCAGGTACTGGG + Intergenic
1002202705 5:177539229-177539251 CTTATTACGTGCCAGGCACTGGG + Intronic
1002327499 5:178419427-178419449 CCTGTTCTGTGCCAGGCACTGGG + Intronic
1002966964 6:1976397-1976419 CCCGTTATGTGCCAGGCACTGGG - Intronic
1003123536 6:3337369-3337391 CCTTGTAGGTGCCAGGTACTGGG + Intronic
1004083342 6:12418485-12418507 CCTATTAGGTGCCTGGTACATGG - Intergenic
1004563993 6:16778550-16778572 CCTATATAGTCCCAGCTACTTGG - Intergenic
1004651772 6:17616873-17616895 CCTATATAGTCCCAGCTACTGGG - Intronic
1005401636 6:25440049-25440071 CCTACTATGTGCCAAGAACTAGG - Intronic
1005881075 6:30061430-30061452 ACTATTCTGTCCCAGGACCTAGG - Exonic
1006130706 6:31867779-31867801 CCCACTATGTGCCAGGCACTGGG - Intronic
1006131833 6:31874251-31874273 CCTACTATGTGCCAGGTGCTGGG - Intronic
1006167834 6:32075687-32075709 CCTACTGTGTGCCAGGGACTGGG - Intronic
1006265404 6:32917774-32917796 CCTGTAATATCCCAGCTACTCGG + Intergenic
1006618828 6:35348229-35348251 CCAACTATGTGCCAGGCACTTGG + Intronic
1007069752 6:39027698-39027720 GCTGTAATGTCCCAGCTACTTGG + Intronic
1007509516 6:42364469-42364491 CCTACTATGTGCCAGGCTCTGGG - Intronic
1007895043 6:45346528-45346550 CCTATTATATGCCAGGCATTTGG - Intronic
1008425795 6:51354590-51354612 CCTGTACTGTGCCAGGTACTTGG - Intergenic
1008789394 6:55211809-55211831 TCTATTATTCCCAAGGTACTGGG + Intronic
1008936142 6:56994669-56994691 CTTCTTTTGTGCCAGGTACTAGG - Intronic
1009334184 6:62465147-62465169 CATATTATGTCACATTTACTTGG - Intergenic
1010175351 6:73021569-73021591 CCTATTTTGTTCTAGGCACTGGG - Intronic
1010373977 6:75144775-75144797 CCTATTATATGCCAGTCACTGGG - Intronic
1010502793 6:76622252-76622274 CCTACTATCACCCAGGTAGTAGG - Intergenic
1011003496 6:82618076-82618098 TCTAGTATGTGCCAGGCACTTGG - Intergenic
1012221599 6:96656211-96656233 CCTATTATGTACTAGTTCCTGGG - Intergenic
1012412167 6:98971044-98971066 CCTACTCTGTGCCAGGTACTCGG + Intergenic
1013034405 6:106366514-106366536 TCTGTTATCTGCCAGGTACTAGG - Intergenic
1013180262 6:107711217-107711239 CCTTTTCTGTACCAGGTGCTAGG + Intronic
1013428753 6:110037561-110037583 CCTACTATGTGCTAGGCACTGGG + Intergenic
1013652968 6:112214770-112214792 CCTGTTATGTCACAGGACCTTGG + Intronic
1013656927 6:112255586-112255608 CCTAACATGTGCCAGATACTTGG + Intergenic
1014020789 6:116586677-116586699 TCTATTATGTGCAAGGCACTAGG - Intronic
1014142059 6:117955037-117955059 AGTATTAGCTCCCAGGTACTTGG - Intronic
1015257976 6:131201298-131201320 CCTACTATGTGCCAGACACTGGG + Intronic
1015608264 6:134984317-134984339 TGTATTATGTGCCAGGCACTGGG + Intronic
1015740525 6:136448963-136448985 CATACAATGTTCCAGGTACTGGG + Intronic
1015924631 6:138296578-138296600 CCTGTCACGTCCCAGGTACCGGG + Intronic
1016305840 6:142682596-142682618 CCTCTCTTGTCCCAGCTACTTGG + Intergenic
1016462881 6:144296508-144296530 CCTATTATGAGCCAGGCATTGGG - Intronic
1016629982 6:146217615-146217637 CCTACTGTGTGCCAGGCACTGGG + Intronic
1017291284 6:152741464-152741486 CTTATAATGTACCAGGTATTGGG + Intergenic
1018627536 6:165793871-165793893 CTTATAATGGGCCAGGTACTGGG + Intronic
1020040099 7:4995460-4995482 GCTGTTATGTGCCAGGTACTGGG + Intronic
1020273319 7:6609927-6609949 CCTGTAAAATCCCAGGTACTCGG + Intergenic
1021370698 7:19842224-19842246 CCTGCTATGTACCAGGTGCTGGG + Intergenic
1021672826 7:23049258-23049280 CCTACTTTGTGCCAGGTACTAGG - Intergenic
1022199094 7:28098461-28098483 CCTCCTATGTGCCAGGCACTTGG - Intronic
1022523134 7:31020545-31020567 CCTATTCTGTGCCAGGTATGAGG - Intergenic
1023947563 7:44815465-44815487 CCTCTTTAGTCCCAGCTACTCGG - Intronic
1024003625 7:45209276-45209298 CCTACTATATCCTAGGTATTGGG - Intergenic
1024308216 7:47945863-47945885 CCAACTATGTCCCAGGAACCAGG - Intronic
1025254210 7:57372613-57372635 CCTACTATGTGCCAGGCCCTGGG + Intergenic
1026211343 7:68308409-68308431 CCTACTATGTACCAGATGCTTGG - Intergenic
1026284042 7:68947597-68947619 CCTATCATGTACCATGTACTTGG - Intergenic
1027880744 7:83832376-83832398 CCTATTATTTTCAAAGTACTTGG - Intergenic
1028419642 7:90618500-90618522 CCTTTCATGACCCAGGTGCTGGG + Intronic
1028694052 7:93688032-93688054 CATATGTTGTCCCAGCTACTGGG - Intronic
1028889801 7:95974304-95974326 CTTACTATGTGCCAGGTGCTGGG - Intronic
1029049612 7:97670847-97670869 CCTATAATGTGAGAGGTACTAGG - Intergenic
1029416316 7:100445381-100445403 CCTATATAGTCCCAGCTACTTGG - Intergenic
1029672855 7:102045972-102045994 CCTACTACATCCCAGGCACTGGG - Intronic
1029676663 7:102074550-102074572 CCTGTTGTGTGCCAGGCACTGGG - Intronic
1029935791 7:104422979-104423001 CCTACAATGTTCCGGGTACTGGG + Intronic
1030270626 7:107664911-107664933 CCTAATATGTTCCAGGCACTAGG + Intronic
1031105973 7:117543490-117543512 CTTACTATGTGCCAGGCACTAGG + Intronic
1031601361 7:123714636-123714658 CCTACTATGTACAAGGGACTGGG + Intronic
1031682813 7:124695413-124695435 CCTATATAGTCCCAGCTACTTGG - Intergenic
1032103103 7:128999734-128999756 CCTGTAATATCCCAGCTACTTGG - Intronic
1032442044 7:131949443-131949465 CTTATTATGTTCAAGGTGCTGGG + Intergenic
1032761675 7:134949098-134949120 CCTAGAATGTGCCAGGCACTGGG - Intronic
1034425634 7:151012660-151012682 CCTACTATGTACCAGGCACCAGG - Exonic
1034820764 7:154214403-154214425 CCTGTGATGTGCCAGGCACTAGG - Intronic
1034896793 7:154881478-154881500 CCTACTATGGCCCTGGTACATGG + Intronic
1036061569 8:5327784-5327806 CTTATCATGGCCCAGGGACTTGG + Intergenic
1036490020 8:9216245-9216267 CCTGTTTTGTCACAGATACTTGG - Intergenic
1036735916 8:11316556-11316578 TATATGATGTTCCAGGTACTAGG + Intronic
1037262361 8:17023147-17023169 CCTAATGTGTGCCAGGAACTGGG + Intergenic
1037484167 8:19331708-19331730 CCTGTTATGTGGCAGGCACTAGG + Intronic
1037606160 8:20438962-20438984 CCTACTATGTTCCAGGCATTGGG + Intergenic
1038661428 8:29500673-29500695 CCTTTTATGTACCAGACACTGGG + Intergenic
1038669861 8:29574042-29574064 CCTAATATGTTCCAGACACTAGG + Intergenic
1038986198 8:32813119-32813141 CATATTATGTACCAGATGCTGGG + Intergenic
1039022957 8:33227621-33227643 CCTAGTATGTACCAGGCACTGGG - Intergenic
1039065434 8:33603501-33603523 ACTCTTATATCCCAGCTACTTGG - Intergenic
1039229034 8:35422726-35422748 CCTACTATGTGCCAGGTAGTAGG + Intronic
1041235526 8:55797636-55797658 ACTTTTGTTTCCCAGGTACTTGG - Intronic
1041245160 8:55881864-55881886 CCTACTATGTACCAGGCACTGGG - Intronic
1041266637 8:56072113-56072135 CTTGTTAAGTCCCAGCTACTAGG + Intronic
1041623075 8:59996041-59996063 CCTACTATGTACCAGTCACTTGG - Intergenic
1042049841 8:64691580-64691602 CCTACTATGTCTCAGGCACTTGG - Intronic
1042105531 8:65322343-65322365 CCTATTATGTGCCAGGAGCCAGG - Intergenic
1042476072 8:69249059-69249081 CCTACTATGTGCCAGGCATTAGG - Intergenic
1043320519 8:78979931-78979953 CTTATTATGTGCTAGGGACTAGG + Intergenic
1043790224 8:84456642-84456664 CCTACTATGGCACAGGCACTGGG + Intronic
1044137660 8:88608244-88608266 GCTAAGATGTCCCAGGCACTGGG + Intergenic
1044457163 8:92401756-92401778 CATACTATGTGCCAGTTACTAGG - Intergenic
1044480024 8:92674906-92674928 CCCATTATGTCCTTGGCACTAGG - Intergenic
1044630222 8:94271348-94271370 CCTATTATATCGCAGGCTCTAGG + Intergenic
1044879085 8:96704060-96704082 CCTATTATGTCCCAGGCACTGGG + Intronic
1045416923 8:101976718-101976740 CCTACTATGTGTCAGGCACTTGG + Intronic
1045760529 8:105601277-105601299 CCTACCATGTGCCAGCTACTGGG - Intronic
1046309173 8:112412767-112412789 TCTATGATGTGCCAGGAACTGGG + Intronic
1046711830 8:117519450-117519472 CCTATTATGTGCTGGGTGCTAGG - Intergenic
1047011492 8:120677658-120677680 TCTAGTATGTCCCAGGCATTAGG + Intronic
1047495668 8:125406971-125406993 CCTACTATGTGCCAGGCACCAGG - Intergenic
1047778320 8:128091794-128091816 CTTATGATGTGCCAGGCACTGGG - Intergenic
1047823482 8:128548138-128548160 CCTATGATGTTCCTGGCACTGGG - Intergenic
1047825504 8:128569659-128569681 CCTACTATGTAGCAGGTACTTGG + Intergenic
1048546165 8:135389448-135389470 CCTATTATTTCCCAAGATCTGGG + Intergenic
1048708451 8:137181477-137181499 CCTACTATGTGCTGGGTACTTGG - Intergenic
1048890886 8:138945393-138945415 CCTACTGTGTGCCAGGCACTGGG + Intergenic
1049112976 8:140660903-140660925 CCTATTATGTACGAGACACTTGG + Intronic
1049317023 8:141974850-141974872 CCTACTGTGTCTCAGGCACTGGG - Intergenic
1050008991 9:1165785-1165807 CTTACTATGAGCCAGGTACTGGG + Intergenic
1050432239 9:5573747-5573769 CCTATCACGTACCAGGTACATGG - Intergenic
1050524993 9:6538567-6538589 CCTACTATGTGCCAGGCACCTGG + Intronic
1050594874 9:7195200-7195222 CCTACTTTGTGCCAGGTACTGGG + Intergenic
1051045049 9:12862943-12862965 ATTATTATGAACCAGGTACTAGG - Intergenic
1051674680 9:19547121-19547143 CCTATTATGTGCCAAACACTGGG - Intronic
1051730351 9:20135981-20136003 TCTACTATGTGCCAGATACTAGG + Intergenic
1052419272 9:28221173-28221195 CCTGTAAGGTCCCAGCTACTTGG + Intronic
1052983396 9:34466061-34466083 TCTACTATGTGCCAGGTCCTCGG - Intronic
1055036739 9:71825771-71825793 CTTACTATGTCCCAAGCACTTGG - Intergenic
1055281912 9:74683888-74683910 CCTAGTATGTAGCAGGCACTTGG - Intronic
1055498906 9:76883945-76883967 CTTACTATGTGCCAGGCACTGGG - Intronic
1055728672 9:79258506-79258528 CCTACTTTGTGCCAGGTACTTGG - Intergenic
1055733866 9:79307441-79307463 TCTATTATGTGCCAGCCACTAGG + Intergenic
1056231598 9:84551234-84551256 GCAATCATGTCCCAGGTAGTAGG + Intergenic
1056241364 9:84650276-84650298 CCTGTAATATCCCAGCTACTTGG - Intergenic
1056771500 9:89481068-89481090 CCTAGTGTGTCCCAGGTTCTGGG - Intronic
1057913216 9:99036055-99036077 CTTATTTTGTCCCAGGCAATGGG - Intronic
1057977487 9:99621688-99621710 CCTAATATGTCCCAGGCACTGGG + Intergenic
1058613451 9:106800291-106800313 CCTACTGTGTGCCAGGTTCTGGG + Intergenic
1058728020 9:107822050-107822072 CCTGTAGTGTCCCAGCTACTCGG + Intergenic
1058813921 9:108666591-108666613 TCTACTATGTCCCAGGCACTTGG - Intergenic
1058861790 9:109123570-109123592 CCTATGCTGTGCCAGGTGCTGGG - Intergenic
1058866346 9:109165648-109165670 CATATTATGTCTCAGCTAATAGG + Intronic
1059420985 9:114192353-114192375 CCTTTTATGTCCATGGTACAAGG - Intronic
1059463405 9:114449848-114449870 CTTATCATGTGCCAGGCACTGGG + Intronic
1059515048 9:114885862-114885884 CGTTTTATCACCCAGGTACTAGG - Intergenic
1059702465 9:116788900-116788922 CTTATTATGTGACAGGTTCTGGG - Intronic
1060160062 9:121354079-121354101 CCTACTGTGTTCCAGGTTCTGGG - Intronic
1060205548 9:121680685-121680707 CCTACTGTGTGCCAGGCACTGGG + Intronic
1060341448 9:122780267-122780289 CCTATGATGTGCCAGGTGCTTGG + Intergenic
1060364894 9:123001289-123001311 ACTACTATGTTCCAGGTACTTGG - Intronic
1060492022 9:124092072-124092094 CCAATTCTGTGCCAGGTGCTGGG - Intergenic
1060516563 9:124269736-124269758 CCTACTATGTGCCAGGCACCGGG - Intronic
1060518989 9:124283223-124283245 CCTACTATGTGCCAGGCCCTGGG - Intronic
1060713156 9:125890436-125890458 CCTACTATGTCCTAGGTGATGGG + Intronic
1185581992 X:1216816-1216838 TCTGTTATCTCCCAGGCACTGGG + Intergenic
1185766609 X:2730803-2730825 CCTGTAATATCCCAGCTACTTGG + Intronic
1186177367 X:6938901-6938923 TCCATTATGTCCCAGATAATTGG + Intergenic
1186613971 X:11167142-11167164 CCTACCATGTCCCAGGCACAGGG + Intronic
1186637759 X:11425025-11425047 CCTGTTGTGTTCCAGGTATTTGG - Intronic
1186850735 X:13577193-13577215 CCTACTATGTGCCAGGCACTGGG - Intronic
1186959873 X:14724286-14724308 CCTATTATGTGCCAGGTACGTGG - Intronic
1187353816 X:18547106-18547128 CCTACTATGTAACAGGCACTGGG - Intronic
1187431873 X:19232468-19232490 CCTACTATGTACCAGATACTGGG - Intergenic
1187554438 X:20338628-20338650 CCTGCTATGTTCCAGGCACTAGG - Intergenic
1187562698 X:20417719-20417741 CCTACTATGTGCCAGGGATTTGG - Intergenic
1188150419 X:26667454-26667476 CCTGATATTTCCCAGGCACTAGG + Intergenic
1190335443 X:49258947-49258969 CCTATTTTGCCCCAGTGACTAGG + Intronic
1190777019 X:53560923-53560945 CCTACTGTATCCTAGGTACTAGG - Intronic
1190858818 X:54323813-54323835 CCCATTATGTCCCTAGCACTTGG + Intronic
1190908228 X:54749202-54749224 CCTATTATGTGAGAGGCACTGGG + Exonic
1192305164 X:69951490-69951512 CCTATTATGTGCCAGGCCCAGGG + Intronic
1192339359 X:70250097-70250119 CCTATTATGTTCTAGGCACTGGG + Intergenic
1192617413 X:72641992-72642014 CTTATTATGTACCAGGCACTGGG - Intronic
1193602592 X:83526297-83526319 TCTACTATGTACCAGATACTGGG + Intergenic
1195523392 X:105856996-105857018 CTTATTATGTAACAGGTTCTAGG - Intronic
1195679847 X:107536874-107536896 CCTACTCTGTGCCAGGTGCTGGG - Intronic
1195995772 X:110730309-110730331 CCTTTTATGCCCCAGCTCCTGGG + Intronic
1196112179 X:111958450-111958472 CTTACTATGTGCCAGGTACTGGG - Intronic
1196238271 X:113308400-113308422 TCTATTATGTACCATGTATTTGG - Intergenic
1197001773 X:121448490-121448512 CCTATTACGTTCCAGGTACTGGG - Intergenic
1197271440 X:124428678-124428700 CTTACTATGTGCCAGGCACTGGG - Intronic
1197479149 X:126961284-126961306 CCTATTATGTACAAGTTAGTAGG + Intergenic
1197764022 X:130047778-130047800 CTTACTATGTGCCAGGCACTGGG + Intronic
1197863303 X:130992888-130992910 CCTATTATGTGCTAGACACTGGG - Intergenic
1197904325 X:131408252-131408274 TCTATTATGTCCTAGACACTAGG + Intergenic
1198119655 X:133579411-133579433 CCAATTAGGTCCCAGGCACTGGG + Intronic
1198415172 X:136412659-136412681 CCTACTGTGTTCCAGGCACTGGG + Intronic
1198470755 X:136944340-136944362 CATATTATGTACCAGGCACTAGG + Intergenic
1198504166 X:137284882-137284904 CCTAATATGTGCCAGGGCCTGGG + Intergenic
1198552010 X:137755341-137755363 GCTATTATGTGTCAGGCACTGGG + Intergenic
1198792055 X:140356551-140356573 CCTACTATGTTCCTGGTCCTGGG + Intergenic
1199466028 X:148138213-148138235 CTTATTTTGTGCTAGGTACTGGG + Intergenic
1199494894 X:148441908-148441930 CTTACTATGTGCCAGGAACTAGG - Intergenic
1199601612 X:149544517-149544539 TCTATTAGGTGCCACGTACTGGG + Intronic
1199817799 X:151414187-151414209 CCTATTCTGTGCCAGGCATTGGG - Intergenic
1199860735 X:151798589-151798611 CCTACTCAGTGCCAGGTACTGGG + Intergenic
1200177511 X:154127268-154127290 CATGTTAAGTCCCAGCTACTTGG + Intergenic