ID: 1149553306

View in Genome Browser
Species Human (GRCh38)
Location 17:57555707-57555729
Sequence ACCTATTATGTCCCAGGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 1, 1: 1, 2: 12, 3: 111, 4: 527}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149553306_1149553311 29 Left 1149553306 17:57555707-57555729 CCAGTACCTGGGACATAATAGGT 0: 1
1: 1
2: 12
3: 111
4: 527
Right 1149553311 17:57555759-57555781 TGATGGTGTTTATCCTCACCAGG 0: 1
1: 0
2: 0
3: 8
4: 126
1149553306_1149553309 12 Left 1149553306 17:57555707-57555729 CCAGTACCTGGGACATAATAGGT 0: 1
1: 1
2: 12
3: 111
4: 527
Right 1149553309 17:57555742-57555764 CTTATTAACCAGAAGAGTGATGG 0: 1
1: 0
2: 0
3: 17
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149553306 Original CRISPR ACCTATTATGTCCCAGGTAC TGG (reversed) Intronic
901667319 1:10833716-10833738 ACCTACTATGTGCCAGGCATTGG + Intergenic
902540139 1:17148939-17148961 ACCTACTATGTTCCAGGCCCCGG + Intergenic
902642228 1:17774359-17774381 ACCTACTATGTGCCTGGTGCTGG - Intronic
902650722 1:17835784-17835806 ACCTACTATGGCGTAGGTACTGG + Intergenic
902711814 1:18245696-18245718 GCCTACTATGTGCCAGGCACTGG + Intronic
903093580 1:20946599-20946621 ACTTATTATGTGCCAGGAACTGG + Intronic
904040352 1:27580711-27580733 GCTTATTATGTGCCAGGCACTGG - Intronic
904094230 1:27965335-27965357 TGCTGTTATGTGCCAGGTACTGG + Intronic
904117865 1:28175643-28175665 CCCTATCAGGTCCCAGGTGCTGG - Intronic
904232882 1:29091517-29091539 ACCTATAATGTCCTAGGGTCTGG - Intronic
904356798 1:29945482-29945504 ACCTATTACGTGCCAGGTTCTGG - Intergenic
904413459 1:30339979-30340001 ACCTATTTTGTGCCAGATACAGG - Intergenic
904581817 1:31549274-31549296 ACCTACTATGTGCTAGGTGCTGG + Intergenic
904932750 1:34102998-34103020 ATCTATTATGTACCAGGTTCAGG - Intronic
905346730 1:37316263-37316285 GCCTACTATGTACCAGGCACCGG - Intergenic
905480597 1:38259293-38259315 ACCTACTGTGTGCCAGGCACCGG - Intergenic
905847721 1:41246672-41246694 TCCTATTATGTGCCAGGAACTGG + Intergenic
905911424 1:41657626-41657648 ACCTACTAAGTGCCAGGCACAGG + Intronic
906388873 1:45396438-45396460 ACCTATTATGTGCCAGGCACTGG + Intronic
906804564 1:48767922-48767944 ACCTACTATGTGCCAGGCTCTGG + Intronic
907324440 1:53627801-53627823 ACCTGTTGTGTGCCAGGCACTGG + Intronic
907545982 1:55260429-55260451 ACTTACTATGTGCCAGGTGCTGG + Intergenic
908228337 1:62078797-62078819 CCCTACTATGTTCCAGGCACTGG + Intronic
908348251 1:63258343-63258365 ACCTAATGTGTGCCTGGTACTGG + Intergenic
908548670 1:65187696-65187718 GCATACTATGTCCCAGGCACTGG - Intronic
909060389 1:70872456-70872478 ACTGACTATGTTCCAGGTACTGG + Intronic
909391026 1:75122255-75122277 ACCTACTATGTACCAGGAACTGG - Intergenic
911456139 1:98125944-98125966 ACTTATTATGTGCTAGGTACAGG - Intergenic
911504075 1:98726885-98726907 GCCTATTATGTGCCAGGCATTGG - Intronic
911712500 1:101090370-101090392 ACCTACTATGTACCAGGTCTTGG - Intergenic
911747501 1:101455557-101455579 ACCTATTATGTGCCAGCTGTGGG + Intergenic
912236656 1:107858730-107858752 ACCTTTTAGGTACCAGGGACTGG - Intronic
912452512 1:109776077-109776099 ACCTATTAGGTGCCAGGCACTGG - Intergenic
912664024 1:111562931-111562953 TCTTACTATGTACCAGGTACTGG + Intronic
912710466 1:111946066-111946088 ACCTACTATGTGCCAAGCACTGG - Intronic
912711252 1:111951591-111951613 ACCTTCTATGTGCCAAGTACTGG + Intronic
912858279 1:113191313-113191335 AACTACTGTGTCCCAGGCACTGG + Intergenic
912934172 1:113988314-113988336 ACCTACTGTGTGCCAGATACTGG - Intergenic
913489406 1:119364895-119364917 ACCTACTATGTACCAGGCTCTGG + Intergenic
913570471 1:120114968-120114990 ACCTACTATGTGCTAGGCACTGG - Intergenic
914291276 1:146275946-146275968 ACCTACTATGTGCTAGGCACTGG - Intergenic
914461243 1:147887353-147887375 ACCTACTACGTGCCAGGCACTGG - Intergenic
914552320 1:148726729-148726751 ACCTACTATGTGCTAGGCACTGG - Intergenic
914984339 1:152443146-152443168 ACCTACTGTGTACCAGGCACTGG + Intergenic
915375769 1:155393893-155393915 TTCTATTATGTACCAGGTGCTGG + Intronic
915523971 1:156464998-156465020 GCCTACTATGTGCCAGGCACTGG + Exonic
916806145 1:168263336-168263358 ACCTACTATGTGCCAGCTACTGG + Intergenic
917067095 1:171108717-171108739 GCCTACTATGTGCCAGGCACTGG + Intronic
918267820 1:182862864-182862886 AATTACTATGTACCAGGTACTGG - Intronic
919109688 1:193202257-193202279 GCCTATTATGCTCCAGGTACTGG + Intronic
919781132 1:201221878-201221900 ACCTACTAGGTGCTAGGTACTGG + Intronic
920103563 1:203534158-203534180 ACCTTTCATGCACCAGGTACTGG + Intergenic
920418799 1:205816151-205816173 ACCTACTATGTGCCAGGAGCTGG - Intergenic
920740225 1:208574945-208574967 ACCTCTTCTGTGCCAGGTGCTGG + Intergenic
920841731 1:209561087-209561109 ACTAATTATGTCCCAGGCAATGG + Intergenic
922129265 1:222760709-222760731 ATTTATTATGTGCTAGGTACTGG + Intergenic
922644120 1:227267982-227268004 ACCTACCATGTCCCAGGCACTGG + Intronic
923117235 1:230953467-230953489 ACTTACTATGTGCCAGGCACTGG + Intronic
1066483947 10:35825806-35825828 ATCTATTATGTACCAGATATAGG + Intergenic
1066504881 10:36031171-36031193 ACCTTTTATTTGCCAGGCACTGG + Intergenic
1067354745 10:45513370-45513392 ACCTACTATGAGCCAGGTACAGG + Intronic
1069619059 10:69825117-69825139 ACCTACTATGTGCCAGGCACAGG + Intronic
1070286072 10:75084903-75084925 GCCTACTATGTGCCAGGCACTGG + Intergenic
1070372956 10:75802687-75802709 ACTTATTATGTGCCAGGTACTGG - Intronic
1070403285 10:76072416-76072438 ACCTACTATGTGCCAAGCACTGG - Intronic
1070442864 10:76463885-76463907 ACCTACTGTGTGCCAGGCACTGG - Intronic
1070708256 10:78657315-78657337 ACCTACTATGTGCCGGGCACAGG - Intergenic
1070735758 10:78862542-78862564 TCCTATTTTGTACCAGGTATTGG + Intergenic
1070861473 10:79669034-79669056 ATCTATTATTTGCCAGGCACTGG + Intergenic
1071146303 10:82576797-82576819 ACCTATTATGTCTCAAACACTGG - Intronic
1071264772 10:83955123-83955145 ACCTACTATGTGCAAGGTATGGG - Intergenic
1071667774 10:87577224-87577246 CCCTATTATGTGCTAGGCACTGG - Intergenic
1071749277 10:88456566-88456588 ACCTGTGATGTCACAGGCACAGG - Intronic
1072036081 10:91564094-91564116 ACCAATTATGTACCAGGTCCAGG + Intergenic
1072177898 10:92947043-92947065 ACCTATTATGTGCTAGGCTCTGG - Intronic
1072419236 10:95275442-95275464 ACCTACTATGTTCCAGTTATTGG - Intronic
1072448198 10:95517637-95517659 ACCTACTGTGTTCCAGGCACAGG - Intronic
1073364101 10:102923298-102923320 ATGTATTCTGTGCCAGGTACAGG + Intronic
1073495201 10:103884593-103884615 ACCTTTTGTGTGCCAGATACTGG - Intronic
1074236797 10:111592774-111592796 ACGTATTATGTTCCAGGCACTGG + Intergenic
1075831390 10:125414569-125414591 ACCTACTCTGTGCCAGGCACTGG + Intergenic
1078004908 11:7525351-7525373 ACCTATGATGTGCCAAGCACTGG - Intronic
1078473622 11:11611712-11611734 ACCCAAAATGTCCCAGGCACCGG - Intronic
1078806136 11:14706956-14706978 ACCTGGTATGTACCAGGTGCTGG + Intronic
1078871803 11:15353553-15353575 ACCTACTATGTGCCAGGTCTGGG + Intergenic
1079011924 11:16835586-16835608 ACCTACTATGTCTCAGGCACTGG + Intronic
1079153308 11:17921423-17921445 ACCTATTATGTCTTAGGCACTGG - Intronic
1079356647 11:19735461-19735483 ACCTACTATGTTCCAGGCACTGG + Intronic
1079553495 11:21730519-21730541 ACCTGTTATGTGCTAGGAACTGG - Intergenic
1079638588 11:22776124-22776146 ACCTACTATGTGCCTGGAACTGG + Intronic
1080409278 11:32008540-32008562 ACCTGTTATATGCCAGGCACTGG - Intronic
1080415801 11:32068854-32068876 ACCTACTAAGTGCCAGGCACTGG + Intronic
1081533850 11:43983386-43983408 ACCTACTATGTGCCTGGTGCAGG + Intergenic
1081603543 11:44512205-44512227 ACTCAATATGTGCCAGGTACTGG - Intergenic
1081756069 11:45545450-45545472 ACCTATTATGTGCCAGGCACTGG + Intergenic
1083252714 11:61478549-61478571 ACCTACCGTGTGCCAGGTACTGG + Intronic
1084084440 11:66848559-66848581 ATCTAAGATGTCCCAGGTCCTGG - Exonic
1085139047 11:74123396-74123418 ACTTATTATGTGCTAGGTCCTGG + Intronic
1085234637 11:75004964-75004986 ACCTATTATGTACCAGGGGCTGG + Intronic
1085739671 11:79068207-79068229 ATCTGTTCTGTGCCAGGTACTGG + Intronic
1085764112 11:79267711-79267733 ATTTATTATGTGCCAGATACTGG - Intronic
1086171485 11:83841638-83841660 ACCTCTTATGTACCAGGTATTGG - Intronic
1087268465 11:96086224-96086246 ACCTACAATGTGCCAGGAACTGG - Intronic
1087566430 11:99865057-99865079 ACCTATTTTGTGACAGGTACTGG + Intronic
1088069867 11:105769160-105769182 ACCTATTATATGCCAGTCACTGG - Intronic
1088664304 11:112079111-112079133 GCCTCCTATGTACCAGGTACTGG - Intronic
1089036006 11:115392273-115392295 ATCTATTACGTGCCAGGCACTGG - Intronic
1089229345 11:116957773-116957795 ACCTAGTATGTGGCAGGTGCAGG + Intronic
1089343404 11:117774939-117774961 GCTTACTATATCCCAGGTACAGG - Intronic
1089388230 11:118081791-118081813 ATCTACTATGTGCTAGGTACTGG + Intronic
1089417984 11:118308743-118308765 ACCTACTATGTGCCAGACACTGG - Intronic
1089488508 11:118865819-118865841 ACCTACTATGTGCCAGGTTGTGG - Intergenic
1089564930 11:119365793-119365815 ACTTATTAGATCCCAGGCACTGG + Intronic
1089756833 11:120693553-120693575 ACCTAGTATGTGTCAGATACTGG + Intronic
1091060601 11:132457869-132457891 AGCTATTTTGTGCCAGGCACAGG + Intronic
1091294336 11:134462366-134462388 ACTTACTATGTGCCAGGCACAGG + Intergenic
1091372209 11:135070427-135070449 GCCTATTATGTACCAGGCACTGG - Intergenic
1092052169 12:5479738-5479760 ACCTACTATGTGCCAAGGACTGG - Intronic
1092117585 12:6020437-6020459 ACCTCTCATGTGCCAGGTACTGG + Intronic
1092963575 12:13619620-13619642 ACCGATTCTGTGCCAGGCACTGG + Intronic
1093241876 12:16686816-16686838 ATTTATTATGTGCCAGGTTCTGG + Intergenic
1093583428 12:20808513-20808535 ATCTATAATGTGCCAGGTACTGG + Intergenic
1095468625 12:42513364-42513386 ACCTACTATGCACCAGGTATTGG - Intronic
1095546479 12:43376847-43376869 ATCTATTATTTCTCAGTTACTGG + Intronic
1095649387 12:44588958-44588980 ACTTAGTATGTGCCAGGCACTGG + Intronic
1096022968 12:48337483-48337505 CCTTATTATGTGCCAGGCACTGG - Exonic
1096029203 12:48396905-48396927 ACTTACTATGTGCCAGGCACAGG + Intergenic
1096192505 12:49629549-49629571 ACCTATTATGTGCCAGATGCTGG + Intronic
1096634905 12:52952012-52952034 ACCTGCTATGTGCCAAGTACTGG - Intronic
1096766317 12:53893165-53893187 ACTTATGATGTGCCAGGCACTGG - Intergenic
1097841306 12:64324207-64324229 ACCTAGTATGTACCAAGCACTGG + Intronic
1097887669 12:64745812-64745834 ACCTACTATGTTTCAGGCACTGG - Intronic
1098019912 12:66143728-66143750 CCCTATTATGTCCCATAAACAGG + Intronic
1098150098 12:67537787-67537809 ACCTTCTATGTCCCAGGAACTGG - Intergenic
1098184983 12:67886918-67886940 ACCTAATGTGTGTCAGGTACTGG + Intergenic
1098450533 12:70613363-70613385 ACCTATTGTGTGCCAGGCTCTGG + Intronic
1099207498 12:79744941-79744963 ACCTACTATGTACTAGGCACTGG - Intergenic
1100888041 12:99094121-99094143 ATTTATTATGTGCCAGGCACTGG + Intronic
1101003452 12:100379031-100379053 GCCTACTGTGTCTCAGGTACTGG - Intronic
1101019550 12:100539665-100539687 ACCTATTATGTGCCAGGAACTGG + Intronic
1101359260 12:104010617-104010639 ATCTACTATGTGCCAGGCACTGG - Intronic
1101734675 12:107454096-107454118 ACCTACTATGTGCCAGGCACAGG - Intronic
1101793322 12:107950610-107950632 ACCTACTATATTCCAGGTTCTGG + Intergenic
1101845224 12:108358170-108358192 ACTTATTATGTGCCAGGCACTGG + Intergenic
1101873877 12:108586272-108586294 ACCTACTATGTGCCGGGTATTGG - Intergenic
1102023066 12:109697186-109697208 ACCTACTATGCGCCAGGCACTGG - Intergenic
1102159596 12:110757712-110757734 ACCTTGTATGTGCCAGGCACGGG - Intergenic
1102225566 12:111225845-111225867 ACTTATTATGTACCAAGTTCTGG - Intronic
1102426733 12:112849684-112849706 ACCTATTATGTACCAGGCTTTGG - Intronic
1102432391 12:112893853-112893875 ACCTACTATGTGCCAGACACTGG + Intronic
1102433122 12:112898972-112898994 ATCTACTATGTTCCAGGCACTGG + Intergenic
1102475056 12:113183406-113183428 ACCTACTGTGTGCCAGGTACTGG + Intronic
1102742631 12:115221814-115221836 ACTTACTATGTCCCAGGTGTTGG + Intergenic
1102924160 12:116814229-116814251 ACCTATTCTGTACCAGGCCCAGG + Intronic
1103397639 12:120620228-120620250 ATCTACCATGTGCCAGGTACTGG - Intergenic
1103716506 12:122948435-122948457 ACCTGCTATGTCCCAGGCACTGG - Intronic
1104863642 12:131939605-131939627 ACCTTTTAAGTGGCAGGTACAGG + Intronic
1106127607 13:26913145-26913167 ACCTACTATGTGCTAAGTACTGG - Intergenic
1106150956 13:27101480-27101502 ACCTACTATGTGCCAGGAACTGG + Intronic
1106364629 13:29066690-29066712 ACCTATTATGGGCCAGATGCTGG + Intronic
1106667222 13:31864455-31864477 ACCTACTATGTGTCAGGTCCGGG - Intergenic
1106773266 13:32983593-32983615 ACCTACCATGTGCCAGATACTGG + Intergenic
1108400453 13:50036880-50036902 ACCTATTATGTGCCTGGTAGTGG + Intergenic
1108499039 13:51052058-51052080 ACTTGTTGTGTGCCAGGTACAGG - Intergenic
1109204005 13:59461667-59461689 TCCTATTATGTTCAAGGCACTGG - Intergenic
1110437480 13:75491445-75491467 ACCTACTATGGTCCAGGGACTGG + Intergenic
1110703272 13:78574678-78574700 ACCTAAGATGTGCCAGGCACTGG + Intergenic
1111108790 13:83680288-83680310 ACCTATTATGTGTCAGGAAAAGG - Intergenic
1114725440 14:24931587-24931609 ACCTACTATGTTTCAGGTAGTGG + Intronic
1114739274 14:25078550-25078572 ACCTATTATATACCAGGCACTGG - Intergenic
1117032872 14:51693006-51693028 ACCCACTAGGTACCAGGTACTGG - Intronic
1117457317 14:55911388-55911410 ACCTATTATGTGCTAGCTTCTGG + Intergenic
1117663353 14:58031075-58031097 ATCTAATAGGTACCAGGTACTGG + Intronic
1117872571 14:60216746-60216768 ACCTAGTATGTACCAGGCACTGG + Intergenic
1118702594 14:68448515-68448537 ACCTCCTATGTTCCAAGTACTGG - Intronic
1118752982 14:68819951-68819973 ACCTGCTATGTGCCAGGCACTGG + Intergenic
1118816342 14:69316934-69316956 ACCTACTGTGTGCCAGGTGCAGG + Intronic
1118904890 14:70016697-70016719 CACCATTATGTTCCAGGTACTGG + Intronic
1119531057 14:75361685-75361707 ACCTATTATGTGTGAGGCACTGG + Intergenic
1119644005 14:76335485-76335507 AGCTACTATGTGCCAGGCACTGG + Intronic
1119658674 14:76435454-76435476 ACCTACTATGTGCCAAGTGCTGG - Intronic
1119757150 14:77127083-77127105 ACCTACTATGTAACAGGCACGGG - Intronic
1120180414 14:81337350-81337372 ATCTACTATGTGCCAGGCACCGG + Intronic
1121242184 14:92438989-92439011 TCCTATTATGCCCGAGGTTCCGG + Intronic
1121245880 14:92460547-92460569 ACCTGTTATGTGCCAGGTCTGGG + Intronic
1121540093 14:94719110-94719132 ATCTACTTTGTGCCAGGTACTGG - Intergenic
1121613047 14:95294203-95294225 ACCTACTATGTGCCAGGGACTGG + Intronic
1121779672 14:96614157-96614179 ACCTACTGTGTGCCAGGCACTGG - Intergenic
1121885450 14:97538748-97538770 ACCTATTATGTGCCAGCCATTGG - Intergenic
1122357334 14:101131584-101131606 ACCTGCTCTGTCCCAGGTGCTGG - Intergenic
1125167397 15:36723961-36723983 ACCAATTATGTTCAAGGTGCTGG + Intronic
1125348061 15:38739971-38739993 ACCTTCTATTTCCTAGGTACTGG + Intergenic
1125633206 15:41165622-41165644 ACTTATTATCTCCCAGTTTCTGG + Intergenic
1126095899 15:45090050-45090072 ATCTATTATGTCCCGGGCACAGG - Intergenic
1126988858 15:54346863-54346885 CCCTATTATATGCCAGGCACTGG + Intronic
1128659498 15:69487852-69487874 ACCTACTATGTGCCAGGCACTGG + Intergenic
1128873827 15:71185777-71185799 ACCTACTGTGTGCCAGGCACTGG + Intronic
1130833053 15:87621403-87621425 CCTTATTATGTGCCAGGCACTGG + Intergenic
1131606930 15:93915472-93915494 ACCTGCTATGTGCCAGTTACTGG - Intergenic
1132942681 16:2515767-2515789 GCTTACTATGTGCCAGGTACTGG + Intronic
1133333161 16:4988710-4988732 ACTTAATATGTGCCAGGCACTGG - Intronic
1134320682 16:13159905-13159927 GCCTACTATGTGCCAGGCACTGG + Intronic
1134882611 16:17758875-17758897 ATCTACTATGTTCCAGGTCCTGG + Intergenic
1134915192 16:18063370-18063392 ACCTATTATGTGCCATGCACTGG - Intergenic
1135170575 16:20179798-20179820 ACCTATGATGTGCCTGGTGCTGG - Intergenic
1135181783 16:20281214-20281236 ACCTACTAAGTCCTAGGCACAGG + Intergenic
1135601214 16:23785201-23785223 ACTTATTATGTATCAGGCACTGG + Intergenic
1135664965 16:24328028-24328050 ACCTACTATGTGCCAGGTCCTGG + Intronic
1135732617 16:24907330-24907352 ACCTACTGTGTACCAGGCACAGG + Intronic
1135814739 16:25622286-25622308 ATCTTTTATATTCCAGGTACTGG - Intergenic
1137571927 16:49572127-49572149 ACCTACTATGTGTCAGGCACTGG + Intronic
1137625018 16:49902161-49902183 ACCTACTATGTTCCAGGTCCTGG + Intergenic
1137625529 16:49905708-49905730 ACCTACTATGTGCCAAGCACCGG - Intergenic
1138214416 16:55190846-55190868 ACCTACTATGTACCAGGTCCTGG + Intergenic
1138318617 16:56091652-56091674 GCCTATAATGTACCAGGCACTGG - Intergenic
1138509655 16:57500994-57501016 ACCTACTCTGTGCCAGGCACTGG + Intergenic
1140144791 16:72296073-72296095 ACCTAATATGTGCCAGGTATAGG - Intergenic
1141350228 16:83287803-83287825 ACCTATTTGGTGCCAGGGACTGG - Intronic
1141518734 16:84563514-84563536 ACCTACTATGTGCCAGGCACTGG - Intergenic
1142868381 17:2805087-2805109 ACCTGTTTTGTGCCAGGCACTGG - Intronic
1142986460 17:3697981-3698003 AACTATTATGTGGCAGGCACAGG - Intergenic
1143403323 17:6659755-6659777 ACCTACTTTGTACCAGGTAATGG - Intergenic
1143621378 17:8082275-8082297 ACTTACTAGGTCCCAGGTATTGG + Intronic
1144487814 17:15682118-15682140 GCTTATTCTGTACCAGGTACTGG - Intronic
1144620658 17:16816437-16816459 ACCTACTATGTGCCAGGCATTGG + Intergenic
1144771349 17:17761403-17761425 ACCTACTCTGTGCCAGGCACAGG + Intronic
1144785647 17:17830150-17830172 ACCTATCGCGTGCCAGGTACTGG + Intronic
1144884982 17:18451710-18451732 ACCTACTATGTGCCAGGCATTGG - Intergenic
1144913208 17:18700172-18700194 GCTTATTCTGTACCAGGTACTGG + Intronic
1145147237 17:20492667-20492689 ACCTACTATGTGCCAGGCATTGG + Intergenic
1145248014 17:21282583-21282605 ACCTACTATGTGCCTGGTTCTGG + Intergenic
1146952066 17:36913591-36913613 ACCTACTATGTGCCATGCACTGG - Intergenic
1147229140 17:39004433-39004455 ACCTACTATGTGCCAGGCACTGG + Intergenic
1147456833 17:40543132-40543154 ACCTATGATGTGCCAGGCACTGG + Intergenic
1147505638 17:41014135-41014157 ACCTACTATATGCCAGGCACTGG + Intronic
1147553546 17:41462099-41462121 ATCTACTATGTGCCACGTACAGG + Intronic
1147572046 17:41577337-41577359 ACCTACTATGTGCCAGGCATTGG + Intergenic
1148133743 17:45278440-45278462 ACTTATCATTTCCCAGGCACCGG + Intronic
1148472206 17:47901882-47901904 ACCTACCATGTGCCAGGGACTGG + Intronic
1148678239 17:49457485-49457507 ACCTACTATGTGGCAGGCACTGG + Intronic
1148908633 17:50927686-50927708 ACTTACTATGTGCCAGGCACTGG - Intergenic
1148925817 17:51084110-51084132 ACTTACTATGTACCAGGCACAGG + Intronic
1149406690 17:56359092-56359114 ATCTACTATGTACTAGGTACTGG - Intronic
1149553306 17:57555707-57555729 ACCTATTATGTCCCAGGTACTGG - Intronic
1150559641 17:66283428-66283450 ATCTACTATGTGCCAGGTACTGG + Intergenic
1150580717 17:66471426-66471448 ACCTATTCTGTGCCAGACACTGG - Intronic
1151369899 17:73641244-73641266 ACCTTCTATGTGCCAGGCACTGG + Intronic
1151694073 17:75705217-75705239 ACCTATTAGGTCCCACGTTAGGG + Intronic
1153256013 18:3172196-3172218 ACCTGTTATGTGCTAGGTAGGGG - Intronic
1153698577 18:7668958-7668980 TCCTACTATGTGCCAGGCACTGG - Intronic
1153939810 18:9968159-9968181 ACATATTAAGTCCGAGGTATCGG - Intergenic
1154213894 18:12401473-12401495 CCCTAATATTTTCCAGGTACTGG + Intergenic
1155222585 18:23698762-23698784 ATCTACTATGTGCCAGGTATAGG + Intronic
1155416758 18:25606825-25606847 GCCTACTCTGTACCAGGTACTGG + Intergenic
1155747140 18:29370553-29370575 AGCCCATATGTCCCAGGTACAGG - Intergenic
1155922104 18:31613991-31614013 ACCTACTCTGTTCCAGGTGCTGG + Intergenic
1156196271 18:34777235-34777257 ACTTATAATGTTCCAGGTATGGG - Intronic
1156591693 18:38496946-38496968 GCCTTTTATGTCCCAGTTCCAGG - Intergenic
1156869082 18:41923791-41923813 ACCTACTATGTGCTAGGCACTGG - Intergenic
1156895231 18:42238903-42238925 ATCTATCATGTGCCAGGCACTGG + Intergenic
1157194296 18:45608114-45608136 ACCTATTATGTACCAGTCACAGG - Intronic
1157415935 18:47502871-47502893 ACCCACTATGTGCCAGGCACTGG + Intergenic
1157744945 18:50127245-50127267 ACCTATTATATACCAGATACTGG + Intronic
1158130935 18:54151965-54151987 AGCTATTACGTGCCAGGCACTGG + Exonic
1158432032 18:57397916-57397938 ACCTACTATGTGCCAGGCACTGG + Intergenic
1158886606 18:61834044-61834066 ACCTACTATGTACCAGACACTGG + Intronic
1159278692 18:66255047-66255069 ATCTATTCTGTACCAGGTTCAGG - Intergenic
1159282304 18:66301846-66301868 ACCTATTATCTCCTAGCTCCTGG - Intergenic
1160398099 18:78586838-78586860 ACCCAGTGTGTTCCAGGTACAGG + Intergenic
1161426137 19:4204279-4204301 ACCTACTGTGTGCCAGGCACTGG + Intronic
1161495437 19:4583721-4583743 ACCTACTGTGTACCAGATACTGG + Intergenic
1162198700 19:9005971-9005993 ACTTACTATGTGCCAGGTACTGG + Intergenic
1163182371 19:15613685-15613707 ACCTACTATGTGCCAGGCACTGG - Intergenic
1164051943 19:21591298-21591320 AGCTATTATGTGCTAGGCACTGG + Intergenic
1164708278 19:30336312-30336334 ACCTACTATGTGCCAGGCGCTGG - Intronic
1164822458 19:31260643-31260665 ATCTACTATGTGCCAGGCACAGG + Intergenic
1165284624 19:34831720-34831742 AGCTATTTTCTCCCAGGTATAGG - Intergenic
1165287548 19:34854283-34854305 AACTATCTTCTCCCAGGTACAGG + Intergenic
1166950879 19:46427403-46427425 ACCTACTATGTTCCAGGAGCTGG - Intergenic
1167751543 19:51383488-51383510 ACCTATTATGCACCAGGTGTAGG - Intronic
1168076568 19:53983383-53983405 ACCTACTGTGTACCAGGCACTGG + Exonic
1168144141 19:54410191-54410213 ACCTACTATGTGCTAGGCACAGG + Intergenic
925628537 2:5866039-5866061 ACCTGCTATGTCCCAGGCATTGG + Intergenic
926029289 2:9571643-9571665 TCCTATTATGTGCTAGGCACAGG - Intergenic
926422571 2:12714834-12714856 ACCTACTATGTGCCAGACACTGG - Intergenic
927605011 2:24479188-24479210 TCCTACTATGTGCCAAGTACTGG + Intergenic
927652989 2:24923406-24923428 ATCTACTAGGTGCCAGGTACTGG - Intergenic
927859202 2:26549982-26550004 ACCCATTCTGTGCCAGGCACTGG + Intronic
927939258 2:27093482-27093504 ACCTACCATGTCCCAGGCACTGG + Intronic
928284206 2:29974834-29974856 ACCTTCTATGATCCAGGTACTGG + Intergenic
928335776 2:30396739-30396761 ATCTATTTTGTGCCAGGCACTGG + Intergenic
928534207 2:32223900-32223922 ACATATAATGTAGCAGGTACTGG + Intronic
928626041 2:33141052-33141074 ACATACTATGTGCCAGGTATGGG + Intronic
928933615 2:36650622-36650644 ACCTACTATGTGCCAGGTACTGG + Intergenic
929071372 2:38034308-38034330 ACCTAATATGTCCAAGATAGTGG - Intronic
929165029 2:38873691-38873713 ACTTATTATGTGCCAGATCCTGG + Intronic
929338883 2:40787949-40787971 ACTTACTATGTTCCAGGCACTGG + Intergenic
929465353 2:42139020-42139042 ACCTAGTATGACCTAGATACTGG - Intergenic
929642392 2:43595058-43595080 ACCTACTATGTGCCAGGCACTGG - Intronic
930114301 2:47705744-47705766 GCCTAATATGTGCCAGGCACTGG - Intronic
930879053 2:56251269-56251291 ACCTAATATATACCAGGCACTGG - Intronic
932108959 2:68975919-68975941 AACTATTTTGTCCCAGGCAAAGG + Intronic
932762146 2:74445094-74445116 ACTTGCTATGTCCCAGGCACTGG - Intergenic
932819205 2:74885294-74885316 ACCTACTGTGTAGCAGGTACTGG - Intronic
932907172 2:75766773-75766795 AGCTATTATGTGCCAAGCACTGG - Intergenic
933564516 2:83933830-83933852 ACCTCGTATATCCCAGGCACTGG + Intergenic
937482754 2:122279537-122279559 ACCTGCTATGTGCCAGATACTGG - Intergenic
939335697 2:140825400-140825422 TCCTATAATGTGCCAGTTACTGG - Intronic
939347118 2:140979872-140979894 ACATTTTATGGCCCAGGTAAAGG - Intronic
940137466 2:150455005-150455027 ACCTATTAGGTTCCAGGTACTGG + Intergenic
940171816 2:150836707-150836729 ACCTATTATGGACTAGGTCCTGG + Intergenic
940248749 2:151649655-151649677 ACCTATTATGTGCTAGATACTGG + Intronic
940270575 2:151885476-151885498 GCCTGTTATGTGCCAGGTCCTGG - Intronic
940986762 2:160058782-160058804 ACCTTTTCTGCCCCAGGCACTGG + Intronic
941283934 2:163585562-163585584 TCCTAATATGTGCCAAGTACTGG - Intergenic
941463419 2:165797150-165797172 ACCTACTAAGTGCCAGGTGCTGG - Intergenic
942082481 2:172413772-172413794 ACCTATAGAGTCCCAGGTTCTGG + Intergenic
944537343 2:200724167-200724189 ACCTTATATGTCCCAGGTAGTGG - Intergenic
944654289 2:201862391-201862413 ACTTATTATGTGCCAGGTAGGGG - Intronic
945212792 2:207401028-207401050 ACATACTATGTGCCAGGTGCTGG + Intergenic
945340251 2:208644199-208644221 ATCTATTGTATCTCAGGTACTGG + Intronic
946176423 2:217924622-217924644 ACCTACTATGCACCAGGCACTGG + Intronic
946617327 2:221523908-221523930 ACCTGGTATGTCCTAGGTGCTGG + Intronic
946907970 2:224433937-224433959 ACCTAGTATGTGTCAGGCACTGG - Intergenic
947061707 2:226173786-226173808 ACCTATTGAGGCCAAGGTACTGG - Intergenic
947521003 2:230845956-230845978 ACCTACTGTGTGCCAGGCACTGG - Intergenic
1168887221 20:1267960-1267982 ACCTACTATGTGCCAGGCACAGG - Intronic
1169137670 20:3207369-3207391 ACCTACTATGTACCAGGAGCTGG + Intergenic
1169950521 20:11038369-11038391 ACCTACTATGTGCAAGGTTCTGG - Intergenic
1171473152 20:25388324-25388346 ACCTACTACGTGCCAGGTACTGG + Intronic
1172038547 20:32027856-32027878 ACCTACTATGTGCCAGGCCCAGG - Intronic
1172181386 20:33005922-33005944 ACCTAGTATGGTCCAGGTGCTGG + Intergenic
1172757281 20:37294831-37294853 ATCTACTATGTGCCAGGCACTGG - Intronic
1173117685 20:40261711-40261733 CCCTATTATGTACAAGGCACTGG + Intergenic
1173170994 20:40723753-40723775 ACCTACTATGTGCCAGGCCCTGG + Intergenic
1173248703 20:41353320-41353342 ACCTACTATGTCCCAGGCCTAGG + Intronic
1173354568 20:42275161-42275183 ACCTATTGTGTGCCAGTCACAGG - Intronic
1173435660 20:43030161-43030183 ACCTACTATGTGACAGGTACTGG + Intronic
1173538642 20:43834807-43834829 ACCTGCTATATCCCAGGTATTGG - Intergenic
1173797385 20:45871376-45871398 ACCTATTATGTGCCAGACACTGG - Intronic
1173908060 20:46643093-46643115 ACCTACTATGTGCCAGGCACGGG + Intronic
1174266902 20:49338540-49338562 ACTTATTATCTGCCACGTACTGG + Intergenic
1174275022 20:49397422-49397444 ACCTACTATGTACCAGACACAGG - Intronic
1174643471 20:52065567-52065589 ACCTATTATGTGCCAGGATTTGG + Intronic
1174686622 20:52462162-52462184 ATCTATTATATGCCAGGTACTGG - Intergenic
1174747327 20:53076401-53076423 CCCTATTGTGTGCCAGGCACTGG + Intronic
1175140494 20:56857362-56857384 ACCTACTATGTGCCAGGCCCAGG - Intergenic
1177804589 21:25861850-25861872 CCCTACTATGTCCCAGGTACTGG - Intergenic
1178705422 21:34868812-34868834 ACCTACTGTGTGCCAGGAACTGG - Intronic
1179032253 21:37730882-37730904 ATCTATTATGTGCCAAGTACTGG + Intronic
1179302865 21:40128213-40128235 ATCTAGTATGTTCCAGATACTGG - Intronic
1179908799 21:44437409-44437431 ACCTACTGTGTCCCAGGCATGGG + Intronic
1180569022 22:16698850-16698872 ACCTCTCATGTGCCAGGTATTGG + Intergenic
1180977386 22:19855692-19855714 ACCTATCTTGTCCCAGGATCTGG - Intergenic
1181155001 22:20914467-20914489 ATGTATTATGTGCTAGGTACTGG + Intergenic
1181256677 22:21567494-21567516 TCCTACTATGTGCCAGGCACTGG + Intronic
1181365250 22:22371522-22371544 ACCTACTATGTGCCAGGCTCAGG + Intergenic
1181368433 22:22397887-22397909 ACCTATTATGTGCCAGTCTCAGG + Intergenic
1181764008 22:25078202-25078224 ACCTATTATGTGCCAGGCACTGG - Intronic
1181821449 22:25478948-25478970 CCCTACTATGTGCCAGGTGCAGG + Intergenic
1181888785 22:26042769-26042791 ACCTATTATGTGCTAGGCACTGG + Intergenic
1181947330 22:26528387-26528409 ATCTACTATGTGCCAGGTGCTGG + Intronic
1182374357 22:29835689-29835711 GCTTATTATGTGCCAGGTATTGG - Intronic
1182469197 22:30537069-30537091 ACTTATTCTGTACCAGGCACTGG - Intronic
1182558836 22:31143270-31143292 ATCTACTATGTGCCAGGCACAGG + Intergenic
1182774309 22:32819550-32819572 ACCTACTATATTCCAGGTGCTGG + Intronic
1182789008 22:32933249-32933271 ACTCACTATGTGCCAGGTACCGG + Intronic
1183361383 22:37384949-37384971 ACCTACTATGTACCAGGCGCCGG + Intronic
1183424616 22:37732873-37732895 ACCTACTGTGTACCAGGCACTGG - Intronic
1183885727 22:40880155-40880177 TACTTTTATGTCCCATGTACTGG - Intronic
1184042806 22:41954084-41954106 ACTTGTTATGTGCCAGGCACTGG - Intergenic
1184043065 22:41955922-41955944 ACTTGTTATGTGCCAGGCACTGG + Intergenic
1184094697 22:42310297-42310319 GCCTACTATGTGCCAGGTCCTGG + Intronic
1184167119 22:42736129-42736151 ACCTAGTATCTTCCAGGTCCTGG - Intergenic
1184601277 22:45544851-45544873 ACCTAGTATGTGCCAGGCCCTGG - Intronic
949488895 3:4568381-4568403 ACCTATTATGTGCCAGATGCAGG + Intronic
949784738 3:7728474-7728496 ACCTATGAGGGCCCTGGTACTGG + Intronic
950091955 3:10302109-10302131 ACCTGTAATCTCCCAGCTACTGG + Intronic
950139681 3:10606824-10606846 ACCTACTATGTGCCAGGCCCTGG - Intronic
950368575 3:12507611-12507633 ACCTACTATGTGCCAGGCATTGG + Intronic
950444951 3:13031602-13031624 ACCTACTGTGTGCCAGGCACAGG + Intronic
950692334 3:14669800-14669822 ACCTAACATGTCCCAGGCAGTGG - Intronic
950977419 3:17262892-17262914 ACCAATTATGTTCCATGTCCTGG + Intronic
951246386 3:20346464-20346486 ACCTATTATATGCCATGTCCTGG - Intergenic
951517430 3:23576761-23576783 CCCTACTCTGTTCCAGGTACTGG - Intronic
951649185 3:24930555-24930577 TCCTATTATGTGCCAGGCATTGG - Intergenic
951806266 3:26647386-26647408 AACTAGTATGTGCCAGGTGCTGG - Intronic
952041461 3:29266766-29266788 ACCTATTAAGTTCTAGGTGCTGG + Intergenic
952120762 3:30241416-30241438 ACCTACTATGTTCCAGGCACTGG - Intergenic
952508590 3:34031831-34031853 ACCCATGATGTGACAGGTACTGG + Intergenic
954099203 3:48356411-48356433 ACCTACTATGTGCCAGGCACTGG + Intergenic
954539919 3:51386554-51386576 ACCTACTATGTGCTAGGCACTGG + Intronic
954580232 3:51699298-51699320 ACCTATTCTGTCCCAGGGGCTGG - Intronic
955402506 3:58603310-58603332 ACCTACTATGTGCCAGGCATTGG + Intronic
955409865 3:58648612-58648634 GTCTATTATGTGCCAGGCACTGG - Intronic
955611435 3:60761736-60761758 ATTTATTATGTCCTAGCTACAGG - Intronic
955955730 3:64287571-64287593 ACCTTCTATGTTCCAGGTGCTGG - Intronic
955996807 3:64687121-64687143 ACCTACTATGTGCCAGTAACAGG + Intronic
956005354 3:64772880-64772902 ACCTATTATGTGCTAGGTAAAGG - Intergenic
956272329 3:67461490-67461512 ATATATTATGTATCAGGTACTGG + Intronic
956770802 3:72524322-72524344 ACCTATTATATACCAGGAACTGG - Intergenic
957036417 3:75297412-75297434 ATCTATTATGTGCCAAGTCCAGG - Intergenic
957228616 3:77481551-77481573 AGCTATTATGTGCAAGATACAGG + Intronic
958812236 3:98874571-98874593 TCCTATTATGGACCAGATACTGG + Intronic
959580842 3:107980884-107980906 ACCTACTATGTGCCAAGTGCTGG + Intergenic
959758150 3:109924634-109924656 ACCTACTATGTGCCTGGAACTGG + Intergenic
960203190 3:114862930-114862952 ACATACTATGTGCCAGGTATTGG + Intronic
960630944 3:119729789-119729811 ACCTATTATATGCCAGGAACTGG + Intronic
960790017 3:121418708-121418730 ACCTTTTATCTCCCAAGCACTGG - Intronic
961080150 3:124019865-124019887 ATCTATTATGTGCCAAGTCCAGG - Intergenic
961083440 3:124045672-124045694 ACCTACTAAGTGCCAGGCACTGG + Intergenic
961264598 3:125631576-125631598 CTCTAGTATGTGCCAGGTACTGG + Intergenic
961528722 3:127526427-127526449 ACCTACTATGTGCCAGGCACTGG + Intergenic
961696911 3:128711703-128711725 ACCTACTATGTTCCAGGCATTGG + Intergenic
961827038 3:129604581-129604603 ACCTAGTATGTACCAGGTGTGGG - Intronic
961829353 3:129615547-129615569 ACCTACTATGTGCCAGGCACTGG + Intergenic
962377263 3:134868668-134868690 ACCTACTATGTGTCAGGTTCTGG + Intronic
962597474 3:136961194-136961216 ACCATTTATGTACCAGGTTCTGG + Intronic
963006516 3:140731383-140731405 ACATATAATGTGCCAGGGACTGG + Intergenic
963252422 3:143115546-143115568 ACCTATAATGTACCAGGTGCTGG - Intergenic
963295526 3:143541961-143541983 ACCTTCTATGTCCTGGGTACTGG - Intronic
963385771 3:144591975-144591997 ACCTACTATGTGTCAGATACTGG + Intergenic
964127516 3:153251285-153251307 ACCTAATATGTGCTAGCTACTGG + Intergenic
964423993 3:156533044-156533066 GCCTATTGTATACCAGGTACTGG + Intronic
964686437 3:159401037-159401059 CCTTATTATGTGTCAGGTACAGG - Intronic
964711936 3:159680150-159680172 GCCTATTGTGTTCCAGGTGCTGG - Intronic
964718410 3:159747098-159747120 ATCTACTATGTGCCAGGTACTGG - Intronic
965026792 3:163312204-163312226 ACCTATTATGTGCCAGATAGTGG - Intergenic
965327777 3:167329012-167329034 ACCTACTTTGTGCCAGGCACAGG - Intronic
965574682 3:170206104-170206126 ACCTACTGTGTGCTAGGTACAGG + Intergenic
965644290 3:170863691-170863713 ATTTATTATGTGCCAGGGACTGG - Intergenic
966241995 3:177764869-177764891 ACCTACTATGTGCCAGGTTCTGG + Intergenic
966629708 3:182058945-182058967 ACCTGCCATGTCTCAGGTACTGG + Intergenic
966770563 3:183500057-183500079 ACCTGTTATGCACCAGGTCCTGG - Intronic
967073293 3:185980822-185980844 ACTTATTATGTACCAGGCACTGG - Intergenic
967329693 3:188278081-188278103 ACGTACTATGTTCCAGGCACTGG + Intronic
969067484 4:4498474-4498496 ACCTATTATGTGCCAGTCATTGG - Intronic
969528659 4:7717442-7717464 ATCTATTATGGGCCAGGTAGTGG - Intronic
970570120 4:17371875-17371897 ACCTACTATGTTCCAGGCAGAGG - Intergenic
970876037 4:20871148-20871170 GCCTATTATGACCCAGGCATTGG + Intronic
971319444 4:25593580-25593602 ACCTATTATGTGACAGGCATTGG + Intergenic
971914040 4:32844174-32844196 ACCTGTTATGTGTCAGGCACTGG + Intergenic
971936164 4:33150578-33150600 ACCTATTGCATCCCAGGGACTGG + Intergenic
972367399 4:38389327-38389349 ACCTATTATGTACCAAACACTGG + Intergenic
972580635 4:40393008-40393030 ACTTATTATTTACCAGGCACTGG - Intergenic
972843896 4:42964519-42964541 ACATACTTTGTTCCAGGTACAGG - Intronic
972946282 4:44260316-44260338 ACCTACTATGTTCTAGGTACTGG + Intronic
973553384 4:52057526-52057548 ACCCAGTATGTACCAGGCACTGG + Intronic
975380319 4:73692392-73692414 ACCTTTTATGTACTAGGTGCTGG - Intergenic
975692290 4:76977771-76977793 ACCTAGTATGTGCAAGGAACTGG - Intronic
975881684 4:78916466-78916488 ACCTATTATGTAGCAGCTAGTGG + Exonic
976337829 4:83911240-83911262 ATCTATTATGTGCAAGGTGCTGG + Intergenic
976836044 4:89375088-89375110 ACTTACTATGTGCCAGGCACTGG - Intergenic
977207923 4:94184397-94184419 ACCTCTTATGTGCCAGGTACTGG + Intergenic
979958733 4:126989655-126989677 ACCTATTATGTGTCAAATACTGG - Intergenic
980129354 4:128803839-128803861 AATTAGTATGTCCCAGGCACAGG - Intergenic
980993872 4:139762241-139762263 ACCTATTGTGTCCCAGGCGCTGG - Intronic
981416198 4:144496689-144496711 ACCTATTTTGTGCCAGGCAGTGG - Intergenic
981508581 4:145530064-145530086 ACCTATTAGGTGCCAGACACTGG + Intronic
981551640 4:145947431-145947453 ACCTACTATGGGCCAGGCACTGG + Intergenic
982487498 4:155984598-155984620 ACCTATCATTTCCCAGGCATGGG + Intergenic
983449610 4:167894467-167894489 GGCTATTATGTTCCAGGCACTGG + Intergenic
984617465 4:181914871-181914893 CCCTTTTATGCACCAGGTACTGG + Intergenic
984694306 4:182764301-182764323 ATTTATTATGTGCCAGCTACTGG + Intronic
986802677 5:11278367-11278389 ACCTCTTATGTGCCAGACACTGG + Intronic
987134665 5:14889677-14889699 ACCTCTAATTTCCCAGGGACAGG - Intergenic
987158605 5:15116302-15116324 ACCTACTATGTGTCAGGTAGTGG - Intergenic
987241742 5:16006975-16006997 ACCTACTATGTGCCAAGCACTGG + Intergenic
987294385 5:16537149-16537171 ACCTATTATGTGCTTGGTGCAGG - Intronic
989253289 5:39340208-39340230 ACCTACTATGACCCAGGCACAGG + Intronic
989270815 5:39530834-39530856 AACTCTTATGTGCCAGGCACTGG - Intergenic
989363692 5:40632420-40632442 ACCTGTTATGTGCCAGGCTCTGG + Intergenic
990323724 5:54653919-54653941 GCTTAGTATGTTCCAGGTACTGG + Intergenic
990843937 5:60115495-60115517 ACCTACTATGTACCAGATACAGG + Intronic
990937657 5:61167249-61167271 ACTTAGTATGTACCAGGTGCTGG + Intergenic
991248550 5:64533859-64533881 ACCTACTATGTACCAGGCACTGG + Intronic
991522317 5:67514822-67514844 GCCTACTATGTTCCAGGCACAGG + Intergenic
991568302 5:68028438-68028460 ATCTATTATGTACCAGATTCTGG + Intergenic
991583575 5:68180885-68180907 ACCTACTGTGTGCCAGGCACTGG + Intergenic
993522619 5:88921861-88921883 ATCTACTATGTTCCAGGCACCGG - Intergenic
994182853 5:96786613-96786635 ACCTATCATGTGCCAGGCACTGG + Intronic
994695511 5:103068743-103068765 GCCTACTATGTTCCAGATACTGG - Intergenic
994825411 5:104707705-104707727 ACCTACTATGTACCAGCAACTGG - Intergenic
995328258 5:110917049-110917071 ACCTGTAATGCCCCAGGCACTGG + Intergenic
995394699 5:111675149-111675171 ATCTAATATGTCCCAGGCACTGG + Intronic
995682256 5:114732961-114732983 CCCTATTATGTGCCAGGCAATGG + Intergenic
997453688 5:134003058-134003080 ACCTACTATGGGCCATGTACTGG + Intronic
997833170 5:137170333-137170355 ACCTATGGTGTTCCAGGCACTGG + Intronic
998277019 5:140765636-140765658 ACCTACTATTTGCCATGTACAGG - Intergenic
998443791 5:142183193-142183215 ACCTGCTATGTGTCAGGTACTGG + Intergenic
998516111 5:142755708-142755730 GCCTCCTTTGTCCCAGGTACTGG + Intergenic
998599430 5:143569921-143569943 ACCTACTATGTGCCAGGTACTGG + Intergenic
998921483 5:147073110-147073132 ACCTAGTATGTGCCAGGCACTGG - Intronic
998993333 5:147843164-147843186 ACCTATGATCTACTAGGTACTGG - Intergenic
999076013 5:148796250-148796272 AGATATTATGTCCCAGATACCGG - Intergenic
999130416 5:149278722-149278744 ACCTACTATGGGCCAGGCACTGG - Intronic
999145009 5:149386684-149386706 ACCTACTATGTGCCAGGCACTGG + Intronic
999182922 5:149682680-149682702 ACTTACTATGTGCCAGGCACTGG - Intergenic
999295954 5:150459521-150459543 ACCTACTGTGTGCCAGGCACTGG + Intergenic
999687962 5:154119116-154119138 ACCCACTATGTCCCAGGCCCAGG + Intronic
1000599226 5:163252144-163252166 ACTTATTATGTACTAGGTATTGG + Intergenic
1000796340 5:165669790-165669812 ACTTATTATGTGCCAAGCACTGG + Intergenic
1000850902 5:166339394-166339416 ACCTACTTTGTGCCAGGTTCTGG + Intergenic
1001307535 5:170586300-170586322 ACCTAATATATGCAAGGTACTGG - Intronic
1001522391 5:172403861-172403883 ATCTACTATGTGCCAGGAACTGG + Intronic
1001812703 5:174641769-174641791 ACCTGTTATGTGCCAGATACTGG + Intergenic
1001828099 5:174762572-174762594 ACTTACTGTGTGCCAGGTACTGG + Intergenic
1001948380 5:175798354-175798376 ACCTGTTATATACCAGGCACTGG + Intronic
1002143554 5:177160743-177160765 GCCTACTATGTCCCAGGCACTGG + Intronic
1002202704 5:177539228-177539250 ACTTATTACGTGCCAGGCACTGG + Intronic
1002327497 5:178419426-178419448 ACCTGTTCTGTGCCAGGCACTGG + Intronic
1004005376 6:11633083-11633105 ATCTATTATGTGCCAGGTGTAGG + Intergenic
1004651774 6:17616874-17616896 ACCTATATAGTCCCAGCTACTGG - Intronic
1005418872 6:25628972-25628994 ACCTATTATGTACCAGGAAATGG + Intergenic
1006130708 6:31867780-31867802 ACCCACTATGTGCCAGGCACTGG - Intronic
1006131835 6:31874252-31874274 ACCTACTATGTGCCAGGTGCTGG - Intronic
1006167836 6:32075688-32075710 ACCTACTGTGTGCCAGGGACTGG - Intronic
1006453076 6:34116398-34116420 ACCTACTATGTTCCAGGCACTGG + Intronic
1007509518 6:42364470-42364492 ACCTACTATGTGCCAGGCTCTGG - Intronic
1007787102 6:44286896-44286918 ACCTACTATGTGCCAGACACTGG + Intronic
1009307809 6:62113206-62113228 ACATATTATGTCCCATATTCAGG + Intronic
1010175353 6:73021570-73021592 ACCTATTTTGTTCTAGGCACTGG - Intronic
1010373685 6:75141250-75141272 AGTTATTATGTGCCAGGCACTGG + Intronic
1012221601 6:96656212-96656234 ACCTATTATGTACTAGTTCCTGG - Intergenic
1012428960 6:99144113-99144135 GCCTATTATGTCGAAGGCACTGG - Intergenic
1013428751 6:110037560-110037582 ACCTACTATGTGCTAGGCACTGG + Intergenic
1013581973 6:111544480-111544502 ACTTATTATGGCTCAGATACTGG - Intergenic
1015107834 6:129557438-129557460 ACCTATTATGTGCGAATTACTGG + Intergenic
1015608263 6:134984316-134984338 ATGTATTATGTGCCAGGCACTGG + Intronic
1015610894 6:135016776-135016798 GCCTAATATGTACCAGGCACTGG - Intronic
1015740524 6:136448962-136448984 ACATACAATGTTCCAGGTACTGG + Intronic
1015778680 6:136841091-136841113 ACCTACTATGTACTAGGCACGGG - Intronic
1015924629 6:138296577-138296599 ACCTGTCACGTCCCAGGTACCGG + Intronic
1016462883 6:144296509-144296531 ACCTATTATGAGCCAGGCATTGG - Intronic
1017291283 6:152741463-152741485 ACTTATAATGTACCAGGTATTGG + Intergenic
1017513546 6:155135799-155135821 ACCTATTTTATTCTAGGTACTGG - Intronic
1017560749 6:155625669-155625691 ACCCACTCTGTGCCAGGTACTGG + Intergenic
1018402661 6:163440783-163440805 ACCTACTCTGTACCAGGCACTGG - Intronic
1019628210 7:2032167-2032189 ACCTGTTCTGTTCCAGGCACTGG - Intronic
1019779701 7:2932015-2932037 ACCTACTATGTGCCAGGTGCTGG - Intronic
1020040098 7:4995459-4995481 TGCTGTTATGTGCCAGGTACTGG + Intronic
1021218389 7:17944791-17944813 ATCTATTATGGGCCAGGCACTGG + Intergenic
1021239863 7:18187116-18187138 ACCTACTATGTCCCTGGAATGGG + Intronic
1022972840 7:35532994-35533016 ACCTACTATGTGCCAGGCATTGG + Intergenic
1023515555 7:40997768-40997790 ACCTATTGTGTTCCAAGTATGGG - Intergenic
1024003627 7:45209277-45209299 ACCTACTATATCCTAGGTATTGG - Intergenic
1024940169 7:54754659-54754681 AGGTATTTTATCCCAGGTACTGG - Intronic
1025254208 7:57372612-57372634 ACCTACTATGTGCCAGGCCCTGG + Intergenic
1026185330 7:68078549-68078571 GCCTATTATGTGACAGGCACAGG + Intergenic
1026612455 7:71872256-71872278 ACCTACTATGTGTCAGGTGCAGG - Intronic
1027196145 7:76031854-76031876 ACCTACTATGTCCCAGGCACTGG + Intronic
1027467479 7:78534051-78534073 GCCTATTATTTGCCAGGCACAGG + Intronic
1028694053 7:93688033-93688055 ACATATGTTGTCCCAGCTACTGG - Intronic
1028889802 7:95974305-95974327 ACTTACTATGTGCCAGGTGCTGG - Intronic
1029597601 7:101545959-101545981 ACCTACTATGTGCAAGGCACAGG + Intronic
1029672857 7:102045973-102045995 ACCTACTACATCCCAGGCACTGG - Intronic
1029676665 7:102074551-102074573 ACCTGTTGTGTGCCAGGCACTGG - Intronic
1030088830 7:105839761-105839783 ACCTACTATGTGCCAGGCATGGG + Intronic
1030205196 7:106945636-106945658 ACTTATTATGTGTCAGGTATAGG - Intergenic
1030734770 7:113034634-113034656 ACTTACTATGTACCAGATACTGG + Intergenic
1030845985 7:114411904-114411926 ACCTACTATGTGCCATGCACTGG - Intronic
1031506921 7:122596433-122596455 ACCTATTATGTGCCATTTATGGG + Intronic
1031515916 7:122698512-122698534 ATCTATAACGTTCCAGGTACTGG - Exonic
1031601359 7:123714635-123714657 ACCTACTATGTACAAGGGACTGG + Intronic
1031937674 7:127752378-127752400 ACCTATTGTGTGCCAGCTATTGG + Intronic
1032322936 7:130900830-130900852 ACCTACTGTGTGCCAGGCACTGG - Intergenic
1032442043 7:131949442-131949464 ACTTATTATGTTCAAGGTGCTGG + Intergenic
1033620650 7:143059311-143059333 ACCTACTATATTCTAGGTACAGG - Intergenic
1036123391 8:6041763-6041785 ACCTATTGTGTTCCAGGCACTGG + Intergenic
1037606158 8:20438961-20438983 ACCTACTATGTTCCAGGCATTGG + Intergenic
1037655498 8:20880226-20880248 ACCTATTACGTGCCAAGTCCTGG - Intergenic
1037781492 8:21872282-21872304 AACTACTATGTGCCATGTACCGG - Intergenic
1037917108 8:22779267-22779289 ACCTCTGATGTACCAGGCACGGG + Intronic
1039022959 8:33227622-33227644 ACCTAGTATGTACCAGGCACTGG - Intergenic
1039789249 8:40861185-40861207 ACTTAGCATGTGCCAGGTACTGG - Intronic
1040029163 8:42808650-42808672 ATCTATAATGTGCCAGGCACAGG - Intergenic
1040974289 8:53172767-53172789 ACCTACTCTGTGCCAGGCACAGG + Intergenic
1041245162 8:55881865-55881887 ACCTACTATGTACCAGGCACTGG - Intronic
1041483722 8:58350789-58350811 ACAAATTATGTACCAGCTACTGG - Intergenic
1042057741 8:64784542-64784564 ACCTAGTATGTATCTGGTACTGG + Intronic
1043351273 8:79363526-79363548 ACATATTATGTATCAGGTACTGG - Intergenic
1043525841 8:81095713-81095735 ACCTAGTATGTAGCAGGCACAGG - Intronic
1044609150 8:94074831-94074853 ACCTATTGTTTCCTAGGTAGGGG - Intergenic
1044879083 8:96704059-96704081 ACCTATTATGTCCCAGGCACTGG + Intronic
1047823484 8:128548139-128548161 ACCTATGATGTTCCTGGCACTGG - Intergenic
1048085895 8:131179134-131179156 ACCTACTGTGTGCCAAGTACTGG - Intergenic
1048187332 8:132253399-132253421 ACTTACTATGTGCCAAGTACTGG + Intronic
1048228366 8:132612689-132612711 ACCTACTATGTGCCAGGCATGGG - Intronic
1048546163 8:135389447-135389469 ACCTATTATTTCCCAAGATCTGG + Intergenic
1048890884 8:138945392-138945414 ACCTACTGTGTGCCAGGCACTGG + Intergenic
1049317025 8:141974851-141974873 ACCTACTGTGTCTCAGGCACTGG - Intergenic
1050008990 9:1165784-1165806 ACTTACTATGAGCCAGGTACTGG + Intergenic
1050594872 9:7195199-7195221 GCCTACTTTGTGCCAGGTACTGG + Intergenic
1051674682 9:19547122-19547144 ACCTATTATGTGCCAAACACTGG - Intronic
1052787702 9:32845032-32845054 ACCTACCATGTCCCAAGCACTGG + Intergenic
1053390014 9:37727947-37727969 ATCTATTATGTGCCAAGCACTGG + Exonic
1054823719 9:69549331-69549353 ACCTATAGTGTCCCAGGCATGGG - Intronic
1054966956 9:71039858-71039880 ATGTATTATGGCCCAGATACAGG - Intronic
1055287534 9:74745324-74745346 ACCTACTATGTGCCAGGCACTGG + Intronic
1055325376 9:75122796-75122818 ATATATTATGTGCCACGTACTGG - Intronic
1055498907 9:76883946-76883968 ACTTACTATGTGCCAGGCACTGG - Intronic
1055502560 9:76916189-76916211 TCCTGTTATGTCCCAGACACTGG + Intergenic
1056285958 9:85088356-85088378 ACCTGTTACCTCCCTGGTACGGG + Intergenic
1056771502 9:89481069-89481091 GCCTAGTGTGTCCCAGGTTCTGG - Intronic
1057753632 9:97811694-97811716 ACCTACTATCTGCCAGGCACTGG - Intergenic
1057977485 9:99621687-99621709 GCCTAATATGTCCCAGGCACTGG + Intergenic
1058172198 9:101695255-101695277 ACCTATTTTGTGTCAGGCACTGG + Intronic
1058703747 9:107621987-107622009 ACCTACTATGTGCCAGGAAAAGG - Intergenic
1059395373 9:114031189-114031211 ACCTCCTATGTACCAGGCACTGG - Intronic
1059435993 9:114276637-114276659 ACCTCTTATGTGTCAGGTACTGG - Intronic
1059783725 9:117557455-117557477 ACCTACTATGTACTAGGCACTGG + Intergenic
1059914389 9:119082920-119082942 ACCTACTATGTGCTAGGTATTGG - Intergenic
1060492024 9:124092073-124092095 ACCAATTCTGTGCCAGGTGCTGG - Intergenic
1060516565 9:124269737-124269759 ACCTACTATGTGCCAGGCACCGG - Intronic
1060518991 9:124283224-124283246 ACCTACTATGTGCCAGGCCCTGG - Intronic
1060713154 9:125890435-125890457 ACCTACTATGTCCTAGGTGATGG + Intronic
1061347154 9:130035587-130035609 GCCTACTATGCCCCAGGTGCTGG - Intronic
1061665064 9:132155912-132155934 ACCTACTATGTGCCAGACACAGG - Intergenic
1061762701 9:132861324-132861346 ACCTACTAAGTCCTAGGCACTGG - Intronic
1062034040 9:134374916-134374938 ACCTGCTATGTGCCAGGCACTGG + Intronic
1185830801 X:3301229-3301251 ACCTACAATGTTCCAGGCACTGG + Intergenic
1186546026 X:10450459-10450481 ACATGTTAAGTCCCAGGCACAGG + Intronic
1186613969 X:11167141-11167163 TCCTACCATGTCCCAGGCACAGG + Intronic
1186850737 X:13577194-13577216 ACCTACTATGTGCCAGGCACTGG - Intronic
1186869726 X:13759003-13759025 GTCTTTTATGTCCCAGGCACTGG - Intronic
1187063466 X:15810260-15810282 ACCTATTATATGCCAGGTAATGG + Intronic
1187120677 X:16403340-16403362 ACCTATTCTCTCCAAGGTAGGGG - Intergenic
1187431875 X:19232469-19232491 GCCTACTATGTACCAGATACTGG - Intergenic
1189335063 X:40166178-40166200 ACTTATTTTGTGCCAGGTCCCGG + Intronic
1189396378 X:40626707-40626729 ACATATTGTGTCCCAGGGAGAGG + Intergenic
1189969479 X:46403283-46403305 ACCTACTATGTACCAGGCACTGG - Intergenic
1190476891 X:50837035-50837057 ACCTATTATGTGCCAGGTAGTGG + Intergenic
1190908226 X:54749201-54749223 ACCTATTATGTGAGAGGCACTGG + Exonic
1192305162 X:69951489-69951511 GCCTATTATGTGCCAGGCCCAGG + Intronic
1192336942 X:70229483-70229505 ACCTAGTTTGTCCTGGGTACAGG + Intergenic
1192339357 X:70250096-70250118 ACCTATTATGTTCTAGGCACTGG + Intergenic
1192608047 X:72540350-72540372 ACCTATTATGAGTCAGATACTGG + Intronic
1192617414 X:72641993-72642015 ACTTATTATGTACCAGGCACTGG - Intronic
1194800138 X:98263041-98263063 TCCCATTATGTTCCAGGCACTGG + Intergenic
1195679849 X:107536875-107536897 ACCTACTCTGTGCCAGGTGCTGG - Intronic
1196112180 X:111958451-111958473 GCTTACTATGTGCCAGGTACTGG - Intronic
1196514469 X:116553301-116553323 ACCTACTAAGTGACAGGTACTGG - Intergenic
1197001775 X:121448491-121448513 TCCTATTACGTTCCAGGTACTGG - Intergenic
1197331355 X:125156946-125156968 AAGTATTATGTGCCAGGCACTGG + Intergenic
1197854178 X:130897649-130897671 ACCTATTATGTGCCTGCCACTGG + Intronic
1198119653 X:133579410-133579432 ACCAATTAGGTCCCAGGCACTGG + Intronic
1198139172 X:133785597-133785619 GCCTATTGTGTGCCAGGTACTGG + Intronic
1198792053 X:140356550-140356572 ACCTACTATGTTCCTGGTCCTGG + Intergenic
1199789583 X:151139987-151140009 TCCTACTATGTGCCAGGTGCTGG + Intergenic
1199817801 X:151414188-151414210 ACCTATTCTGTGCCAGGCATTGG - Intergenic
1200381409 X:155841321-155841343 GCCTACTATGTGCCAGGTTCTGG - Intergenic
1202046333 Y:20739977-20739999 ACCTCTTATCTCCCAGGGTCAGG - Intergenic