ID: 1149553361

View in Genome Browser
Species Human (GRCh38)
Location 17:57556056-57556078
Sequence TGATAAGCTTGGAACTGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149553361 Original CRISPR TGATAAGCTTGGAACTGGAT TGG Intronic
901049071 1:6417254-6417276 TGATGACCTTGGCACTGGTTTGG - Exonic
909539365 1:76773469-76773491 TGATAGGGATGTAACTGGATTGG - Intergenic
909942010 1:81622019-81622041 TGCTATGTTTGGAATTGGATAGG - Intronic
910369350 1:86499422-86499444 TGATAAGCGTAAAACTGGATTGG - Intronic
910506813 1:87958926-87958948 ATATAATCTTGGAACTGGAAGGG - Intergenic
912513246 1:110202281-110202303 TGAAAAGCTTGGACTGGGATGGG + Intergenic
920784429 1:209027247-209027269 TGATTAGCTTAAAATTGGATTGG - Intergenic
924121494 1:240804012-240804034 TGTTAAGTTTGGAACTGTATGGG + Intronic
1068445410 10:57115812-57115834 TGACCAGCTAGGAACTGGCTGGG - Intergenic
1071968219 10:90874431-90874453 TGATAAAGTAGGAACTTGATGGG + Intronic
1074802242 10:117012231-117012253 TGATCAGCTTGGATTTGGATTGG - Intronic
1076791717 10:132780407-132780429 TGGGAAGATTGGAACTAGATGGG + Intronic
1077938735 11:6817891-6817913 TGGTCAGCTTGGAAGTGGGTGGG - Intergenic
1079002928 11:16772932-16772954 TGCTGAGCTTGGCACTGGGTTGG - Intergenic
1079881036 11:25926828-25926850 TCATAAGCTTGTAACTTTATGGG + Intergenic
1080270132 11:30442445-30442467 TGATATGGTTGGATCTGGAAAGG - Intronic
1080839982 11:35975156-35975178 TGATAACCTAGGAACTGCTTGGG + Intronic
1082880817 11:58035597-58035619 TGTTGAGCTTGGGACTGAATTGG + Intronic
1087282165 11:96223671-96223693 TAATAAGCATAGAACTCGATAGG + Intronic
1089963880 11:122639331-122639353 TGATGAGCCTGAAACTGGACTGG - Intergenic
1093827567 12:23713051-23713073 AGATAATCTTGGATTTGGATTGG + Intronic
1094567104 12:31609525-31609547 TGCTAAGATTGGAAGTGTATAGG + Intergenic
1097557087 12:61151973-61151995 TGTTATGCTTCAAACTGGATTGG + Intergenic
1099009768 12:77277823-77277845 TGATAAGCTTGAAATTTGACTGG + Intergenic
1101556937 12:105818901-105818923 TAAGAAGCTTGGAACAGGCTGGG + Intergenic
1101585373 12:106081039-106081061 TTAAAACCTTGGAAGTGGATGGG + Intronic
1105627609 13:22128243-22128265 AGAAAAGCTTACAACTGGATAGG - Intergenic
1108398935 13:50019492-50019514 TGATAAGATTAGATCTGGAGGGG + Intronic
1114255223 14:20996053-20996075 TCATTAGGTAGGAACTGGATAGG - Intronic
1118448014 14:65869368-65869390 CCATAAGCCTGGCACTGGATTGG - Intergenic
1119755143 14:77112241-77112263 GGACCAGGTTGGAACTGGATTGG + Intronic
1123687192 15:22807106-22807128 TGAAATGCTTGGAACTGAACTGG + Intronic
1124928273 15:34093675-34093697 TTGTAAGCTTGGAAATGGAGGGG - Intronic
1125618616 15:41038634-41038656 TGATCAGTTTGGATATGGATGGG - Intronic
1127630910 15:60826824-60826846 TCTTAAGCTTGGAATTTGATGGG - Intronic
1135955970 16:26956505-26956527 AGATAACTTTGGAACTGAATTGG - Intergenic
1139194865 16:64907062-64907084 AGACAAGGTTGGAACTGGAAAGG - Intergenic
1140763431 16:78132871-78132893 TGAGAAGCTGGGAAATGGAATGG - Intronic
1147722019 17:42545239-42545261 TGATTACATTGGAACTGAATTGG - Intergenic
1148442351 17:47717942-47717964 GGATGAGCATGGAACTGGGTCGG - Intergenic
1148461079 17:47839359-47839381 TGACAGGCTTGCACCTGGATCGG + Intronic
1149553361 17:57556056-57556078 TGATAAGCTTGGAACTGGATTGG + Intronic
1150323624 17:64237617-64237639 TGAAATGCATGGAACTTGATGGG + Intronic
1151069806 17:71195989-71196011 TGATAAGCATGGTACTCTATAGG + Intergenic
1162926762 19:13934173-13934195 TGGAAAGCTAGGAACTGGAGGGG + Intronic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
927908112 2:26876412-26876434 TGATAAGCTTGGTTTTAGATGGG + Intronic
929721070 2:44368280-44368302 TGATAAGGTTATAACTTGATGGG + Intronic
930714936 2:54584653-54584675 TAATAATCTTGGATCTGGGTGGG - Intronic
931817479 2:65919015-65919037 TGTGAAGCTTGGAACAGGAAGGG + Intergenic
933217750 2:79649972-79649994 TTATAAGGTTGGAATTGAATGGG + Intronic
934566104 2:95342320-95342342 TGATAAGGTAGGAACTGGAAAGG - Intronic
936934794 2:117828726-117828748 TGAAAGGCAAGGAACTGGATAGG - Intronic
937713907 2:125010273-125010295 TGAGAAGGTTGGAGCTGGAGGGG + Intergenic
940029379 2:149244915-149244937 TTAGAAGCTTTGAACTGAATTGG - Intergenic
940339288 2:152562804-152562826 TGATCACCTTGGTACTGGAATGG + Intronic
941746884 2:169096235-169096257 TGATAAGCTTTGAAAAGGACAGG + Intergenic
947195649 2:227564225-227564247 TGATATGCTTGAATCTGTATTGG + Intergenic
1176902462 21:14459899-14459921 TAATAATTTTGGAATTGGATCGG - Intergenic
1177033186 21:16008791-16008813 TGATAACAATGGAACTGAATAGG + Intergenic
1178492495 21:33061773-33061795 TGATAAACTTGGAAGTGGCAGGG + Intergenic
1181645358 22:24228386-24228408 TGATAAGGGTGGCACTGGACAGG - Intronic
950897356 3:16465498-16465520 TGTTAAGTTTCGAACTGTATTGG - Intronic
954624062 3:52012886-52012908 TGACAAGATTGGAACAGGATGGG - Intergenic
963347102 3:144108112-144108134 TGATCTGCTTGAAACTGGAGAGG + Intergenic
963676722 3:148321686-148321708 TAATAAGCTTGGGACTTGAGGGG + Intergenic
963963118 3:151332846-151332868 TGATAAGCATGGTACCGGATAGG + Intronic
965563891 3:170090257-170090279 TAATAAACTTGGAACTGGGAGGG - Exonic
967598213 3:191353047-191353069 TGAAGAGCTTGCAGCTGGATAGG + Intronic
967830082 3:193911217-193911239 AGATAAAGTTGGAACTGGAAGGG + Intergenic
972331472 4:38068116-38068138 TGTTCTGCTTGGAACTGGAGGGG - Intronic
973702366 4:53550009-53550031 TGAACAGCTTGGAACTGGAGTGG + Intronic
975693027 4:76984297-76984319 TGACTTGCTTGGAACTGGATTGG + Intronic
978093241 4:104743547-104743569 TGATAATCCTGGGACTGGCTTGG - Intergenic
979861274 4:125696599-125696621 GGATAACCTTGGAAATGAATAGG + Intergenic
982354551 4:154451819-154451841 TGAGAAACTTGGAACATGATTGG + Intronic
983299383 4:165905746-165905768 TGATAATGTTGGAACTGGTTAGG + Intronic
983404943 4:167315975-167315997 TGATAAGCATGGGACCCGATAGG + Intergenic
983709083 4:170692730-170692752 TGATAACGTTGGAATTGAATCGG - Intergenic
985839225 5:2293568-2293590 TGATAAGCATGGTACCTGATAGG - Intergenic
986625033 5:9715701-9715723 AGAAGAGCTTTGAACTGGATGGG + Intergenic
987301000 5:16598000-16598022 TGAAGAGCCTGGAACTGGAGTGG - Intronic
987754334 5:22081448-22081470 TGATATGCTTGGAATAGGATTGG - Intronic
988131637 5:27114068-27114090 TGAGGAGCTTAAAACTGGATGGG + Intronic
989462189 5:41713537-41713559 TGATAATCTTGGAAATTAATTGG + Intergenic
994023220 5:95051922-95051944 TAATAAGCATAGTACTGGATGGG - Intronic
995009748 5:107243756-107243778 TGATGAGCTTGGAAATGAAGTGG - Intergenic
1006513015 6:34531869-34531891 AGAGAAGCTTGGGTCTGGATTGG + Intronic
1006513027 6:34531922-34531944 AGAGAAGCTTGGGTCTGGATTGG + Intronic
1006872178 6:37261737-37261759 TGAAAAGCTTTGATCTGGTTGGG + Intronic
1012085019 6:94813780-94813802 TGATAACTTTGAAACTGGAGGGG - Intergenic
1017040763 6:150307030-150307052 TGATAAGCTTGGAACTGGAAGGG - Intergenic
1022788462 7:33662859-33662881 TGCTAGGCTTGGAATTGGTTCGG + Intergenic
1028322995 7:89485676-89485698 TGATAATTTTGGCACTGGACAGG - Intergenic
1036527662 8:9550199-9550221 TAATAAGCTTGGAAATGAAAAGG - Intergenic
1038654265 8:29434734-29434756 TGCTAAGCTTGGAACAGGACAGG + Intergenic
1039618761 8:38977606-38977628 TGTTAAGCTTTGAGCTGGAATGG + Intronic
1040468396 8:47716253-47716275 TGATATGCTTTGAACCGGCTGGG - Intronic
1040887911 8:52285147-52285169 TGAGAATCTTGGAACTGAAAAGG - Intronic
1041024137 8:53666711-53666733 AGAGAAGCTTGGTACAGGATAGG - Intergenic
1042322400 8:67490593-67490615 TGATAAGTTTGGAACTGATTGGG + Intronic
1043240795 8:77932468-77932490 AGATATGCTTGTTACTGGATAGG - Intergenic
1044546098 8:93461298-93461320 TGATAAGTTTGACACTGCATGGG + Intergenic
1051611969 9:18970071-18970093 TACTAAGCTTGCAAGTGGATGGG + Intronic
1053138915 9:35669802-35669824 TCATTAGCTTGGAACTTGCTTGG - Intronic
1053306980 9:36991641-36991663 TGGTATGCTTGTAACTGGGTCGG - Intronic
1055608465 9:77996270-77996292 TGATAAGTTTAAAACTTGATGGG + Intronic
1055671882 9:78615713-78615735 TGATAAGCTTGGTAATGATTGGG + Intergenic
1061072064 9:128316992-128317014 TGATCAGCTGGGGAGTGGATAGG - Intronic
1185865786 X:3622731-3622753 TGAAAAGCTTTGAGCAGGATGGG + Intronic
1187845913 X:23537082-23537104 TGATAAGCATGGTACCTGATAGG - Intergenic
1193732891 X:85122761-85122783 TGATAAGCATAGTACTTGATAGG + Intergenic
1194013517 X:88590651-88590673 TAATAAGCATGGTACTTGATAGG - Intergenic
1194843195 X:98770656-98770678 TCATAAGCTTTGAACAGAATTGG + Intergenic
1195234874 X:102887499-102887521 ATATATGCTTGGAACTGAATAGG - Intergenic
1196274948 X:113755843-113755865 TGAGAAGATTGGAACCGGGTTGG + Intergenic
1199271899 X:145893799-145893821 TAATAAGCATGGTACTCGATAGG + Intergenic
1200843048 Y:7803336-7803358 TGTTGAGTTTGGAACTGTATTGG - Intergenic