ID: 1149556198

View in Genome Browser
Species Human (GRCh38)
Location 17:57575153-57575175
Sequence CTCCAGCCGGGGGGTGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 419}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149556198_1149556208 -7 Left 1149556198 17:57575153-57575175 CCCCCGCCACCCCCCGGCTGGAG 0: 1
1: 0
2: 3
3: 57
4: 419
Right 1149556208 17:57575169-57575191 GCTGGAGCAGATCCCTGTTCTGG 0: 1
1: 0
2: 0
3: 16
4: 156
1149556198_1149556214 25 Left 1149556198 17:57575153-57575175 CCCCCGCCACCCCCCGGCTGGAG 0: 1
1: 0
2: 3
3: 57
4: 419
Right 1149556214 17:57575201-57575223 TCCCCTCCACAAGCAGCCCATGG 0: 1
1: 0
2: 2
3: 30
4: 241
1149556198_1149556209 -3 Left 1149556198 17:57575153-57575175 CCCCCGCCACCCCCCGGCTGGAG 0: 1
1: 0
2: 3
3: 57
4: 419
Right 1149556209 17:57575173-57575195 GAGCAGATCCCTGTTCTGGCTGG 0: 1
1: 0
2: 1
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149556198 Original CRISPR CTCCAGCCGGGGGGTGGCGG GGG (reversed) Intronic
900247355 1:1643101-1643123 CTTCAGCTTGGGGGTGGCCGTGG - Intronic
900258579 1:1710233-1710255 CTTCAGCTTGGGGGTGGCCGTGG - Intronic
900513188 1:3069829-3069851 CCCGAGCCGGGGAGGGGCGGAGG + Intronic
901086288 1:6614043-6614065 TTCCGGGCGGGGGGCGGCGGCGG - Exonic
901808006 1:11749973-11749995 GCCCAGCCCGAGGGTGGCGGGGG + Intronic
902225403 1:14993607-14993629 AGGCAGCAGGGGGGTGGCGGCGG - Intronic
902380094 1:16048722-16048744 CTCCCCCCGGTGGGGGGCGGTGG - Intronic
903028940 1:20448982-20449004 CACCAGCTGGGGAGTGGGGGTGG - Intergenic
903811363 1:26036673-26036695 GTCAAGCTGGGGGGTGGGGGTGG - Intergenic
903838330 1:26220422-26220444 CACCATCCGGGAGCTGGCGGGGG - Intergenic
904376262 1:30084331-30084353 ATCCAGCAGGGCGGTGGCAGAGG + Intergenic
904612005 1:31731077-31731099 CTGCAGCCTGGCGGTGGGGGTGG - Exonic
905275297 1:36813741-36813763 CTTCAGCGGGGGCGGGGCGGGGG + Intronic
906372291 1:45264405-45264427 ATACAGCCGGTGAGTGGCGGAGG - Intronic
906719698 1:47996561-47996583 CTGCGCCCGGGGGGTGGAGGTGG + Intronic
908807248 1:67944459-67944481 CTCCAGCCTGGAGGTTGCAGTGG + Intergenic
910208366 1:84770271-84770293 ATGCAGCCTGGGGGTAGCGGAGG + Intergenic
910388032 1:86705286-86705308 CTCCACCCCGGGGCTGGCGGAGG + Intronic
910850909 1:91649142-91649164 CTCCTTCCTGGGGGTGGCGGGGG + Intergenic
911591726 1:99755393-99755415 CTCCAGCCTGGGGTCGGAGGGGG + Intronic
912492335 1:110069315-110069337 CGCCAGCCGGGCGGCGGCAGGGG + Intronic
912806119 1:112758400-112758422 GTCCTGCCTGGTGGTGGCGGTGG + Intergenic
915322695 1:155064250-155064272 CTCCAGCCTGCGGGAGGCTGGGG - Intronic
916720549 1:167482176-167482198 CTCCAGTCGGGTGGTGTTGGGGG - Intronic
916773416 1:167936067-167936089 CTCCTGCCGGGGGCCGGAGGCGG - Intronic
917141768 1:171842015-171842037 CACCAGGCGGGGGGTGGCAGGGG - Intronic
917479967 1:175403470-175403492 CTCCAGCCGGGGGGTGTGTGTGG - Exonic
919097818 1:193059085-193059107 CTCCAGACGCGGGGCGGCGGTGG + Intronic
920642493 1:207766634-207766656 CTACTGCAGGGGGGTGGTGGTGG - Intronic
920914841 1:210251518-210251540 CGCCAGCCAGGGAGTGGGGGCGG - Intergenic
921221918 1:212979550-212979572 CTCCAGCTGGAGGGAGGAGGTGG - Intronic
921283721 1:213590761-213590783 CGGCAGCCGGGTGGTGGTGGCGG + Intergenic
922335865 1:224617568-224617590 CTCCTGCCGGCGGGAGGCGAAGG + Intronic
922958533 1:229625755-229625777 CTCCCGCCGGCGGGCGGTGGGGG - Intronic
924409116 1:243784790-243784812 CTCCAGCCTAGGGGTGGGAGGGG - Intronic
924415011 1:243849928-243849950 CCTCAGGCGGGGGATGGCGGCGG - Intronic
924415087 1:243850096-243850118 ATGGAGCCGGGGGGGGGCGGGGG + Intronic
924422945 1:243926153-243926175 CTGGAGGTGGGGGGTGGCGGGGG - Intergenic
924559521 1:245146223-245146245 TTCTTGCTGGGGGGTGGCGGGGG - Intergenic
1066402641 10:35090464-35090486 GTCCCGCCGGGGAGCGGCGGCGG - Intronic
1067523944 10:47027270-47027292 CCCCAGCCAGGGCGTGGCAGAGG + Intergenic
1067977289 10:51041096-51041118 CTCCAGGCGTGGGGTGGTGGTGG - Intronic
1069570150 10:69489843-69489865 CCCCAGCCAGGGGCTGGAGGAGG + Intronic
1069952199 10:72026791-72026813 CTCCAGCCGAGGCCTGGCAGAGG + Intergenic
1070835674 10:79445606-79445628 CCGCAGTCGGGGGGAGGCGGCGG - Exonic
1072654399 10:97319980-97320002 CTGCAGGCGGCGGGAGGCGGCGG - Exonic
1073146767 10:101286228-101286250 CTCCAGTCTGGGGGTGGGGGTGG - Intergenic
1074121732 10:110498344-110498366 CTCCTGCAGGAGGGCGGCGGCGG + Exonic
1074503361 10:114045016-114045038 GGCCAGCGGGGCGGTGGCGGCGG - Exonic
1074531978 10:114304670-114304692 GGCCAGCCAGGGTGTGGCGGTGG - Intronic
1074766057 10:116700866-116700888 CTCCAGCCTTGGGGTGGGGAAGG - Intronic
1074861260 10:117512158-117512180 AGCCAGCCGGGGGGTGTGGGGGG - Intergenic
1075015253 10:118905876-118905898 CTCCAGGCAGGAGGTGGTGGGGG + Intergenic
1075061285 10:119258752-119258774 CTCCAGCAGGGGAGTGGAGAGGG + Intronic
1075170008 10:120104459-120104481 CTCTATCCCTGGGGTGGCGGGGG - Intergenic
1075519411 10:123135173-123135195 CTCCAGCTGCGTGGGGGCGGCGG + Intergenic
1075629306 10:123991664-123991686 CGCCAGCCGGGGGGAGGGGCCGG + Intergenic
1075712656 10:124538872-124538894 CTGCAGCCGTGGCGTGGCAGAGG + Intronic
1076427971 10:130380891-130380913 CTTCAGCCGTGGGATGGTGGAGG - Intergenic
1076685193 10:132195527-132195549 TTCCAGCCTGGAGGTGGGGGCGG + Intronic
1076721978 10:132396861-132396883 CACGAGCCCGGGGGCGGCGGGGG - Intergenic
1076783070 10:132735151-132735173 CTCCACACGGGGGGTTGCAGAGG - Intronic
1076811573 10:132888974-132888996 CTCCAGAGGGTGGGTGGAGGCGG - Intronic
1076898735 10:133326801-133326823 CTCCAGGCAGGGGGTGGCAGGGG - Intronic
1076994981 11:293411-293433 CCCCAGCCAGTGGCTGGCGGTGG + Exonic
1077167843 11:1151877-1151899 TTCCAGGCGGGGGGTGGCGTAGG - Intergenic
1077196711 11:1284637-1284659 CACCAGCCTGGGGGTGGGTGTGG - Intronic
1077266302 11:1652411-1652433 GTCCAGACGGGGGCAGGCGGGGG - Intergenic
1077486295 11:2839833-2839855 ATCCAGTCGGGGAGTGGCGACGG - Intronic
1077581283 11:3418829-3418851 CTGCAGCAGGAGGGGGGCGGTGG + Intergenic
1079411396 11:20191172-20191194 CTTCTGCAGAGGGGTGGCGGGGG + Intergenic
1079426031 11:20342967-20342989 CTCCAGCGGGGGCCGGGCGGGGG - Intergenic
1080418649 11:32091646-32091668 CCCCGGCCGGGGCGCGGCGGCGG - Intronic
1080588328 11:33700493-33700515 CCCAGGCCGGGTGGTGGCGGGGG + Exonic
1081611468 11:44565619-44565641 CTGCAGCCGGGAGGGGGCCGAGG + Exonic
1081627470 11:44663983-44664005 CTCCAGGAGGGAGGTGGGGGGGG + Intergenic
1081653363 11:44840257-44840279 CACCAGCCAGGGAGTGGGGGAGG + Intronic
1081808555 11:45902807-45902829 CCCCAGGCGGAGGGTGGCGGGGG + Exonic
1081860890 11:46332886-46332908 CTCCAGCCGGTGGGGTCCGGAGG - Intronic
1082907967 11:58333550-58333572 CTCCAGCCTGGGTGTGACAGAGG - Intergenic
1083172633 11:60931968-60931990 CCTCAGCCTGGGGGTGGAGGAGG - Exonic
1083340325 11:61955091-61955113 GGCCAGCCTGGGGGTGGGGGTGG - Exonic
1083607318 11:63986684-63986706 CTCCCGGCCGGGGGTCGCGGCGG - Intronic
1083729210 11:64643784-64643806 CTCCAGGAGGGGGGTGCAGGAGG - Intronic
1083759252 11:64806807-64806829 CCCCAGCCTGGGAGTGGCAGGGG - Intronic
1083927652 11:65818242-65818264 CTCCGGGCGGGGGGTGGGGCAGG + Intergenic
1084190244 11:67495394-67495416 GTCCAGCCTGGGGGTGGGGGAGG - Intronic
1085284437 11:75350777-75350799 CCCCAGGCTGGGGGTGGCGGGGG + Intronic
1086965083 11:93019192-93019214 CTTGAGCCCAGGGGTGGCGGAGG - Intergenic
1088601244 11:111478117-111478139 CTACAGCAGGGAGGTGGTGGTGG - Intronic
1088647235 11:111926983-111927005 CTCCAGCCGCGGCCTGGGGGTGG - Intergenic
1088899319 11:114103284-114103306 CTCAGGCTGGGGGGTGGTGGGGG - Intronic
1089243001 11:117098060-117098082 CCCCAGCCGGGGGGTCGGGGCGG - Intronic
1090653258 11:128824705-128824727 CTCCGGGTGGGGGGTGGCCGAGG + Intergenic
1091448362 12:557773-557795 CACCAGCCAGGGGGTGGCATGGG + Intronic
1091616534 12:2054154-2054176 CTCCAGGTGGCGGGTGGGGGCGG + Intronic
1092002797 12:5045282-5045304 CAGCAGCCAGGGGGTGGAGGAGG + Exonic
1092089986 12:5796691-5796713 CTGCAGCCGGGTGGAGGCAGGGG + Intronic
1092135394 12:6143530-6143552 CTCCAGCTGGGGGGGGGGGGGGG - Intergenic
1094041186 12:26122900-26122922 CTCCAGGCAGGGGGCGGCCGCGG + Exonic
1094470280 12:30796239-30796261 CTGCGGCCGCGGGGCGGCGGGGG - Intergenic
1095113872 12:38330464-38330486 CCCCATCCGGGAGGTGGGGGGGG - Intergenic
1095230494 12:39733744-39733766 CTCCAGCTTGGTGGTGGCAGAGG - Intronic
1095986323 12:48001975-48001997 CTGGAGCCGAGAGGTGGCGGCGG + Intronic
1096305754 12:50473782-50473804 CTTGAACCGGGGGGTGGGGGTGG + Intronic
1096657577 12:53101200-53101222 CTCCTGCCAGGGAGTGGGGGCGG + Intronic
1096695317 12:53344987-53345009 CGCCAGCCCGGGGGAGGGGGCGG + Intronic
1097794192 12:63844514-63844536 CTCCAGCCAGCGAGTGGCGGGGG - Exonic
1100587720 12:95995292-95995314 CTCCAGTCTGGGGGTGGGGGTGG + Intronic
1101899791 12:108783129-108783151 AGCCAGCCGTGGGGTGGCGCAGG - Exonic
1101970724 12:109310093-109310115 CTCCAGGCGGGGCGGGGCAGCGG - Intergenic
1102488796 12:113276515-113276537 CTCCAGCCAGTGGCAGGCGGAGG - Intronic
1103364246 12:120370123-120370145 CTCCAGCCTCGGTGTGGTGGGGG - Intergenic
1103380598 12:120491336-120491358 CACCAGCCTGGGGCTGGCAGTGG - Intronic
1103509924 12:121467261-121467283 CTCCGGGCGGGCGGCGGCGGCGG - Intronic
1103918873 12:124389333-124389355 CTCCAGACGGAGGCTCGCGGCGG + Intronic
1104241032 12:126989890-126989912 CTCCAGCTGAGAGGTGGCAGTGG - Intergenic
1104736472 12:131138593-131138615 CTCCAGCAGGGGGGAAGCAGCGG - Intronic
1107016952 13:35715006-35715028 CTCCAGCTGGTGTGTGGCTGGGG + Intergenic
1108229514 13:48321162-48321184 CCGCATCCGGGGGGAGGCGGCGG + Intronic
1108254927 13:48600825-48600847 CTTCAGATGGGGGGTGGGGGTGG + Intergenic
1112497094 13:99913891-99913913 CACCCTCCGTGGGGTGGCGGGGG - Intergenic
1112693142 13:101917633-101917655 CTCCAACCCGGGGTTGGGGGTGG - Intronic
1113420324 13:110165982-110166004 CTCCAGGGGAGGGGTGGCCGAGG - Intronic
1118339094 14:64879819-64879841 CCCGAGCCCGGGGGTGGCGGCGG + Exonic
1119743144 14:77027053-77027075 CCCAACCCGGGGGGTGGCGGAGG - Exonic
1121356575 14:93220823-93220845 CTGCAGCTGGGTGGTGGTGGGGG - Intronic
1122151099 14:99726707-99726729 CCTCAGCAGGGGGGTGGTGGGGG - Exonic
1122227039 14:100285984-100286006 CTCCACCACGGGCGTGGCGGGGG + Intergenic
1122339450 14:101018796-101018818 CTCCAGTCGGGGGGCGGGTGGGG - Intergenic
1122417690 14:101558186-101558208 CTCCAGCAGGGGGCGGGCAGGGG - Intergenic
1122550166 14:102545071-102545093 CCCCGGGCGGGGGGTGGGGGGGG + Intergenic
1122624179 14:103075712-103075734 CTCGAGCCGGGAGGGGGCGCTGG + Intergenic
1122859589 14:104576549-104576571 CTCCAGCTGGGTGGGGACGGTGG - Intronic
1123008108 14:105334030-105334052 GTCCAGCCTGGGGGTGGTCGTGG + Intronic
1123041958 14:105493949-105493971 CTGCTGCGGGGGGGTGGGGGTGG + Intronic
1123051924 14:105548117-105548139 CCCATGCCGGCGGGTGGCGGTGG - Intergenic
1123474398 15:20579748-20579770 CTTGAGCCCGGGGGTGGAGGTGG - Intergenic
1123643614 15:22420605-22420627 CTTGAGCCCGGGGGTGGAGGTGG + Intergenic
1123664900 15:22600209-22600231 CTTCAGCCAGGGGGTGAAGGTGG + Intergenic
1124318730 15:28694638-28694660 CTTGAGCCAGGGGGTGGAGGTGG + Intergenic
1125759275 15:42085877-42085899 CTGCAGCCTGGGGGTGGGGACGG - Intronic
1126729273 15:51665551-51665573 CTCAAGGCTGGGGGTGGTGGTGG - Intergenic
1127787153 15:62365705-62365727 CTCCAGCCGAGGGGTGGCAGAGG - Intergenic
1128430436 15:67588011-67588033 CTCCAGCTGCAGGGTGGAGGAGG - Intronic
1128506596 15:68277543-68277565 CTCCAGCCAGGGAGTGGGGGCGG - Intergenic
1128972277 15:72118110-72118132 CTGCAGCCGGGGAGTCGCGCGGG - Intronic
1129703923 15:77783851-77783873 CTCCAGCCGGGAGTGGGAGGTGG + Intronic
1129862373 15:78872728-78872750 CCCCACCCGGGGGGGGGGGGGGG + Intronic
1130370806 15:83284339-83284361 CTCCGGCCGGGAGGCGGCGGCGG - Intronic
1130657017 15:85798852-85798874 GACCAGCCTGGGGGTGGCAGTGG - Intergenic
1132915304 16:2340651-2340673 CTCCAGCCTCGCAGTGGCGGCGG + Exonic
1132933801 16:2471315-2471337 CTGCAGCCGGGAGGAGGCGGCGG + Intergenic
1132939464 16:2499696-2499718 CTCCTGCCCTGGGGTGGGGGTGG + Intronic
1133212685 16:4272169-4272191 CTCCCGGCGCGGGGTGGGGGCGG - Intronic
1136088604 16:27902924-27902946 CTGCAGCTGGGAGGTGGCAGTGG + Intronic
1136591907 16:31222811-31222833 CTGCAGCCTGGGGGTGGGGAGGG - Exonic
1136911219 16:34146145-34146167 CGCCAGTCGGGGGTTGGGGGAGG - Intergenic
1137787957 16:51152525-51152547 CTCCGGCCGGGGGGAGGGGAGGG + Intergenic
1137988708 16:53131236-53131258 GTCGAGGCGGGGGGCGGCGGGGG + Intronic
1138249633 16:55491963-55491985 CTCCGGGCGGGGGTTGGGGGTGG + Intronic
1139467055 16:67159713-67159735 CTCCAGCCAGCTGGTGGCGGCGG - Intronic
1140063657 16:71592031-71592053 CTCTAGCGGGGGGGGGGGGGGGG - Intergenic
1141054604 16:80803996-80804018 CGGCGGCCGGAGGGTGGCGGGGG - Intronic
1141132157 16:81444396-81444418 GTCCGGCCCGGGGGCGGCGGGGG + Intergenic
1141602558 16:85135340-85135362 CTGCAGCGGGGGGATGGCAGTGG - Intergenic
1141741968 16:85899287-85899309 CGCCAGGCGGGGCGTGGGGGTGG + Intronic
1142411503 16:89919311-89919333 CCCCAGCTGGGGGATGGCTGTGG - Exonic
1142638221 17:1270692-1270714 CTGCAGCCGGGGCGAGGCGGAGG + Exonic
1143543262 17:7582013-7582035 CTCCTGCTGGGGGGGGGGGGGGG - Exonic
1144347158 17:14359705-14359727 CTTCAGCCGGGGGCTGGTGAAGG - Intergenic
1144686351 17:17228623-17228645 CTCCTGCAGGGGGTCGGCGGGGG + Intronic
1144916446 17:18727505-18727527 CACCTGGCGGGGGGTGGGGGTGG - Exonic
1144930999 17:18858457-18858479 CTCCCGCCAGGGGTCGGCGGGGG + Intronic
1145839742 17:27984631-27984653 CGGCAGCCGGGGGGGGGGGGGGG - Intergenic
1146229484 17:31095280-31095302 CCGCGGCCGGGGGGCGGCGGAGG - Exonic
1146256622 17:31394914-31394936 TTCCAGCGGTGGGGTGGCGGGGG + Intronic
1146271371 17:31487967-31487989 CTCGCGCCGGGGCGGGGCGGGGG - Intronic
1146302982 17:31705852-31705874 CTCCAGCCTGGGGGTGGGGCTGG - Intergenic
1146654326 17:34626353-34626375 CACCAGCCAGGTGGTGGCGCGGG + Exonic
1146956719 17:36940270-36940292 CACCTGCGGGGGGGTGGGGGTGG - Exonic
1147157033 17:38549138-38549160 CTCCGGCGGGGAGGGGGCGGTGG + Exonic
1147317794 17:39629104-39629126 CTGCTGCCTGGGGGTGGGGGAGG + Intronic
1147382248 17:40062862-40062884 CCCCAGCCGGAGCGGGGCGGGGG + Exonic
1147425765 17:40345286-40345308 CTCCTCCCGGGGAGAGGCGGGGG - Intronic
1148049679 17:44763558-44763580 CTGCAGCCGAGGGGTGGTGCAGG + Intronic
1148072221 17:44915073-44915095 CTCCAGCCGGGCGCTGTTGGCGG + Exonic
1148178016 17:45584691-45584713 CCCCGGCCGGGGGGAGGCGGGGG - Intergenic
1148199764 17:45742223-45742245 CACCTGAAGGGGGGTGGCGGTGG - Intergenic
1148755313 17:49970005-49970027 CTCCAGGTGGGGGGTTGGGGGGG - Intronic
1149556198 17:57575153-57575175 CTCCAGCCGGGGGGTGGCGGGGG - Intronic
1149726346 17:58898218-58898240 CTCCAGCCTGGGGGTGACAGAGG + Intronic
1150407904 17:64918977-64918999 CCCCGGCCGGGGGGAGGCGGGGG - Intronic
1151370739 17:73644878-73644900 CGCCAGCCGCGGGGCGGCGGGGG + Intergenic
1151370768 17:73644989-73645011 CTCCGGCCGGGGCGCGGCGGAGG - Intergenic
1151611270 17:75177073-75177095 CTCCAGCCGGAGGTTGAGGGGGG + Intergenic
1151635602 17:75345705-75345727 CTCCACCCTGGGGGTGGGGGTGG - Intronic
1151653854 17:75486284-75486306 CACCAGCCGTGGGGTGGGGCTGG + Exonic
1151779939 17:76239540-76239562 CAGAAGCCGGGGGGTGGGGGGGG - Intronic
1151813442 17:76458862-76458884 CTTCAGCTGGGGGGTGGGGTGGG + Intronic
1151979335 17:77499385-77499407 CTGCAGCCCGGTGGGGGCGGGGG - Exonic
1152019009 17:77770804-77770826 CTGCAGCCGGGGGTGGGCTGGGG - Intergenic
1152236680 17:79142659-79142681 GGCCAGCTGGGGGGTGCCGGGGG + Intronic
1152801485 17:82332843-82332865 CTCCAGCAGGGCGGGGGTGGTGG - Intronic
1152809825 17:82376099-82376121 CTCCAGCTGAGGGGTGGAGCAGG + Intergenic
1153070411 18:1098503-1098525 CTACAGCCGGGGGCGGGGGGAGG - Intergenic
1153935213 18:9914562-9914584 CGCCGGCCGGGGCGAGGCGGAGG + Intronic
1154507828 18:15060460-15060482 CTCCAGCCGGGTGATGGCAGTGG - Intergenic
1156558033 18:38089569-38089591 CTCCAGCGGTGGGGTGGGGTGGG - Intergenic
1157301912 18:46485256-46485278 CTGCAGCCTGGGGGTGGGGGAGG + Intronic
1158953805 18:62522374-62522396 CTCCAGCCTGGGCGTGGGCGCGG + Intergenic
1159241640 18:65750540-65750562 CGCCAGGCGGGAGGTGGAGGAGG + Intronic
1159770452 18:72542052-72542074 ATCCTGCCTGGGGGTGGCGCTGG - Exonic
1160070577 18:75624595-75624617 CTCCACCTGGGGGGTGGGAGAGG - Intergenic
1160515252 18:79476009-79476031 CTCCAGAAGGGGGGTGGGGCCGG + Intronic
1160586770 18:79917530-79917552 CTCCAGCTGTGGGGTGGCTGGGG + Intronic
1160799231 19:960171-960193 CTCCAGCGGGGTGGGGGCAGAGG - Intronic
1160915641 19:1495274-1495296 CTCCTGCCGGAGAGAGGCGGTGG - Exonic
1160960446 19:1718531-1718553 CTCCAGCCGGGGACTGGAGCTGG + Intergenic
1161184450 19:2907030-2907052 GTCCAGGCGGGGGGTGGGGGCGG + Intronic
1161209996 19:3061475-3061497 CCACTGCCTGGGGGTGGCGGGGG - Intronic
1161264651 19:3358754-3358776 CTCCAGGCAGGGGGCGGCAGGGG - Intergenic
1161264973 19:3359856-3359878 CCCCAGCCGGGGTGCGGGGGGGG - Intronic
1161333518 19:3699323-3699345 TTCAAGGCGGGGGGTGGGGGGGG + Intronic
1161802682 19:6424643-6424665 CCCCCGCCGGCGGGCGGCGGCGG + Exonic
1161976583 19:7611029-7611051 CTCCCCCCGGGGAGAGGCGGAGG + Intronic
1162381479 19:10334262-10334284 CTCCAGCCGGGAGGTGCCGGTGG - Exonic
1162729755 19:12711266-12711288 CCCCTGCCTGGGGGTGGTGGTGG - Intronic
1162740504 19:12771066-12771088 CTCCAGCCTGGGGGTGTTGGGGG + Exonic
1162773958 19:12967507-12967529 CTCCAGCCTGGGGGTGACAGAGG + Intronic
1163548434 19:17952330-17952352 CTCCGGCCGGTGAGTGGCAGTGG + Intronic
1163607273 19:18281989-18282011 CCCCGGCCGGGCGGGGGCGGGGG + Intergenic
1165124246 19:33582791-33582813 CTCCAGCTGGCAGGTGGCTGAGG - Intergenic
1165204522 19:34172460-34172482 CTCAAGCCGCGGCGCGGCGGCGG - Intergenic
1165307662 19:35012206-35012228 CTACAGCCGGGGGGCAGAGGGGG - Intronic
1165333419 19:35154030-35154052 CTCCAGCCTTGGGGTGGGTGGGG - Exonic
1166000718 19:39875932-39875954 CTGCGGGCGGGGGATGGCGGCGG + Intronic
1166210552 19:41304130-41304152 CTGTAGCTGGGTGGTGGCGGTGG - Exonic
1166361321 19:42254032-42254054 CGCGAGCCCGGGGGCGGCGGGGG + Intronic
1166493708 19:43282897-43282919 CTCCAGCCGGGGGGTGGGGCAGG - Intergenic
1166557430 19:43710261-43710283 ACCCAGCCTGGGGGTGGGGGTGG - Intergenic
925012403 2:495908-495930 CTCCAGCCTGGGGATCCCGGTGG - Intergenic
926094625 2:10073211-10073233 CCACAGCCGGGGGGGGGGGGGGG - Intronic
928378996 2:30802156-30802178 CTCTGGTTGGGGGGTGGCGGGGG + Intronic
928998761 2:37324910-37324932 CGCCCGCCGGGAGGTGGCCGCGG + Intergenic
930029848 2:47051764-47051786 CTCCAGCCGGGAGGCGGCGATGG - Exonic
931300283 2:60972970-60972992 CTGCAGCCGGGAGGTGTGGGCGG + Intronic
931854858 2:66292407-66292429 CTTCTGCGGGGGGGTGGTGGGGG + Intergenic
932417762 2:71584074-71584096 CCCCAGCCTGGGAGTTGCGGTGG + Intronic
932619794 2:73258732-73258754 CTCCAGCCGGGGTAGGGTGGGGG + Exonic
935238954 2:101161693-101161715 TTTTAGCCGGGGGGTGGTGGTGG - Intronic
935696792 2:105777234-105777256 CACGAGCCGGGGTGTTGCGGGGG + Intronic
936126693 2:109794573-109794595 ACCCGGCCGGGGGGCGGCGGCGG + Intronic
936460923 2:112713362-112713384 TTCCAGCGTGGGCGTGGCGGAGG + Intergenic
937001506 2:118472041-118472063 CTGCAGCAGGGTGGTGGCTGGGG - Intergenic
937258893 2:120573001-120573023 CTCCTGCCAGGGGCTGGGGGTGG - Intergenic
938451593 2:131425488-131425510 CGCCAGCCGGGCGGTGGGCGCGG - Intergenic
938764873 2:134454108-134454130 CTCCAGCCGTGGGGTCAGGGTGG - Exonic
940913044 2:159225606-159225628 CTCCAGCCGTGGGGCCACGGAGG + Intronic
940945680 2:159615551-159615573 CCCAAGCCGGGGAGTGGGGGTGG + Intronic
942240897 2:173964044-173964066 CGCCAGGCGTGGGCTGGCGGCGG - Intronic
942603053 2:177660974-177660996 CTCCAGCCGTGGGGTGCCCTGGG + Intronic
943692310 2:190881244-190881266 CTCCACCCGTGGTGGGGCGGGGG + Exonic
944675845 2:202033870-202033892 CTCCCGGCGGGCGGCGGCGGCGG + Intergenic
944811037 2:203328111-203328133 CTCCAGCGGCGGGCGGGCGGCGG + Intergenic
946308174 2:218868000-218868022 CTCCAGAAGGGGCGTGGCAGGGG - Intronic
946328693 2:218997836-218997858 CTCCAGACTGGGGGTGGGGGCGG - Intergenic
946688658 2:222295047-222295069 CGGCAGCCTGGGGGAGGCGGAGG - Intronic
947602851 2:231465024-231465046 CTGCAGCCGGGGGGTGCCTCCGG - Intronic
948135746 2:235634959-235634981 CTACAGCGGGGGGGAGGCTGAGG - Intronic
1169264727 20:4160932-4160954 CTCCAGCCCCGGGGAGGGGGTGG - Intronic
1170579460 20:17686934-17686956 CTCCAGCCTGGGCTTGGCTGGGG + Intergenic
1170967238 20:21084404-21084426 CTCAAGTCAGGGGGTGGCAGTGG + Intergenic
1171415555 20:24978046-24978068 CTCCAGGCAGTGGGTGGCTGTGG - Intronic
1172883560 20:38217067-38217089 CCCCAGCCAGGGGATGGGGGTGG + Intronic
1173512533 20:43641523-43641545 CTCCAGCCTGGGGGACGTGGTGG - Intronic
1173576523 20:44115860-44115882 CTGCAGCGGGGCGGTGGCCGGGG + Exonic
1173821212 20:46021855-46021877 CTTCCCCCGGGAGGTGGCGGGGG - Exonic
1174386340 20:50190444-50190466 CTCCAGCAGGGGGCGGGCCGGGG + Intergenic
1175401212 20:58701065-58701087 CTCCATCTGGGGTGTGGCTGAGG - Exonic
1175765022 20:61586471-61586493 CTCCAGCCAGGGAGTGCCTGAGG + Intronic
1175875130 20:62225953-62225975 CTCCTGCCTGGGGATGGAGGAGG - Intergenic
1176022529 20:62969299-62969321 CTGAAGGCGGAGGGTGGCGGTGG - Exonic
1176036636 20:63042832-63042854 CTCTAGCCTGAGGGTGGCGTTGG + Intergenic
1176068918 20:63216008-63216030 CGCCGGCCGGGCGGCGGCGGCGG + Exonic
1176234744 20:64049090-64049112 CTCGGGCCGGGGTGGGGCGGGGG - Intronic
1176241965 20:64079515-64079537 ATCCAGCGGGGTGGGGGCGGGGG + Intronic
1176790253 21:13311339-13311361 CTCCAGCCGGGTGATGGCAGTGG + Intergenic
1177295048 21:19162901-19162923 CTGCTGCCAGGGGGTGGTGGAGG + Intergenic
1177989427 21:28019548-28019570 CTCCAGCCGGGTGATGGCAGTGG + Intergenic
1178899471 21:36587780-36587802 TTCCAGCCATGGGGTGGCAGGGG - Intergenic
1179048719 21:37870217-37870239 CTGGGGCCGGGGGGTGGGGGCGG - Intronic
1179209342 21:39312936-39312958 CTCCGGCGCGGGGGGGGCGGGGG + Intronic
1179512000 21:41879344-41879366 CGGAAGCCGGGGGGCGGCGGCGG + Exonic
1179968310 21:44818980-44819002 TGCCAGCCGGGGCGTGGCGGAGG + Intergenic
1180557043 22:16586332-16586354 CTGCGGCGGGGGGGTGGGGGTGG + Intergenic
1181165785 22:20982304-20982326 CTCCAGCCGGCCCGGGGCGGTGG + Exonic
1182086401 22:27564059-27564081 CTCTGGCCAGGGGGTGGCAGGGG - Intergenic
1183286223 22:36965903-36965925 CTCCAGCCGGGCAGTGGGGGAGG - Intergenic
1183420786 22:37710244-37710266 CTCAAGCCGAGGGCTGGCTGAGG - Intronic
1183856142 22:40636420-40636442 CTCCAGGCGGGGCGAGGCCGCGG + Intronic
1184373389 22:44096971-44096993 CTCCATCCAGGGGGTGCCGGGGG - Intronic
1184422278 22:44389206-44389228 ACCCAGCCAGGGGGTGGCAGAGG + Intergenic
1184457994 22:44622198-44622220 CTGCAGACCGGGGGTGGGGGAGG - Intergenic
1184594058 22:45503475-45503497 CTCCTACCTGGGGGTGGAGGCGG - Intronic
1184757915 22:46527259-46527281 CTCCAGCATGGGGGTGGCTGAGG - Intronic
949834081 3:8249091-8249113 CTCCATCTGGGAGGTGGCGAGGG + Intergenic
950170446 3:10835312-10835334 CCCCAGCCATGGGGTGGGGGAGG + Intronic
950523362 3:13509242-13509264 CTCCTTGCGGGGGGTGGCTGTGG + Intergenic
951497671 3:23348993-23349015 CTCCTGCGGGGAGGTGGTGGGGG - Intronic
952379666 3:32795074-32795096 CTCCAGCCTAGGAGTGGCAGCGG - Intergenic
952416306 3:33093964-33093986 CTGCAGCTGGGGAGTGGCAGAGG + Exonic
952688503 3:36176303-36176325 CTGCTGCTGGGGGGTGGGGGAGG + Intergenic
953385340 3:42502843-42502865 CGGCAGCCTGGGGGTTGCGGAGG + Intronic
954803195 3:53199295-53199317 CTCCAGCAGGTGGGTGGTGGAGG + Intergenic
954839005 3:53495024-53495046 CTTCAGCAGGGGGGTGGGGAGGG - Intronic
955347733 3:58173368-58173390 CTCCAGATGGGGGTTGGGGGTGG + Intergenic
955398377 3:58573512-58573534 GTCCATCCGGGGAGTGGCTGTGG + Intronic
955769248 3:62372552-62372574 CTCCGGGCGGGCGGCGGCGGAGG - Exonic
957864616 3:86005851-86005873 GTCCTGTCGGGGGGTTGCGGGGG - Intronic
961356501 3:126343165-126343187 CTGGAGCCGGGGGGGGGGGGGGG - Exonic
961646187 3:128393996-128394018 TTCCAGTGGGGCGGTGGCGGGGG + Intronic
961827179 3:129605306-129605328 GTACACCCGGGCGGTGGCGGCGG - Intronic
962274204 3:134000022-134000044 CTCCAGTCAGGCGGTGGCAGTGG + Intronic
962922078 3:139959253-139959275 CTCCAGCTGTGGGGTGGTAGTGG + Intronic
965849878 3:173010547-173010569 CTCCAGCCTGGGGGCAGCAGGGG - Intronic
968092867 3:195909261-195909283 GCCCAGCCGGGGGGTGGTGTGGG - Intronic
968230685 3:197003143-197003165 CTCCAGGTGGCGGGAGGCGGCGG + Exonic
968658423 4:1788524-1788546 CCCCAGCCTGGGAGTGGGGGAGG - Intergenic
969715739 4:8867398-8867420 CTGAGGCCGGGGGGTGGCCGTGG + Exonic
971352018 4:25863186-25863208 ACCCGGGCGGGGGGTGGCGGCGG - Intronic
971648404 4:29238258-29238280 CTCCAGCCTGGGTGTGGGAGTGG + Intergenic
974404157 4:61444403-61444425 CTCCAGTCAGGGGCTGGCTGGGG - Intronic
975883552 4:78939234-78939256 CCCGAGCCGGGGAGCGGCGGCGG - Exonic
977408072 4:96625651-96625673 ATACTGCCTGGGGGTGGCGGTGG + Intergenic
979099886 4:116600069-116600091 CCCCAGCCGTCGGGTGGTGGTGG - Intergenic
981087463 4:140698729-140698751 CTCCATCTCGGGGGTGGGGGGGG + Intronic
982094798 4:151912071-151912093 CTCCAGCCAGGGGCTGGGTGCGG - Intergenic
982325623 4:154125955-154125977 CCCCAGCCCAGGGGTGGCGGTGG + Intergenic
983537972 4:168878159-168878181 CTGAAGACCGGGGGTGGCGGGGG - Intronic
983656446 4:170089855-170089877 GTCCAGCCGGGGAGTTTCGGCGG - Exonic
983949919 4:173627605-173627627 CTTCAGGAGGGGGGTGGCAGTGG + Intergenic
984832445 4:183988085-183988107 CCCCAGGCGCGGGGTGGCGAGGG - Intronic
985207168 4:187550866-187550888 CTCCAACCGGGCGGGGTCGGGGG + Intergenic
985512437 5:320451-320473 CTACACCCGGGGAGGGGCGGTGG + Intronic
985645675 5:1083701-1083723 CTGGAGCTGGGGGGTGGCGGGGG - Intronic
986308662 5:6534389-6534411 CTCCAGGGTGGGGGTGGGGGTGG - Intergenic
986501698 5:8407670-8407692 GTCCAGCTGGCGGGTGGCAGGGG + Intergenic
987340594 5:16936101-16936123 CCCCAGGCGGGGGAAGGCGGCGG + Exonic
989075949 5:37563613-37563635 CCCCATCCGGGGGGAGGTGGGGG - Intronic
990919221 5:60944737-60944759 TTGCAGGCGGGGGGCGGCGGGGG - Intronic
992550224 5:77852616-77852638 CTCCAGGAGGGGGGTGGGGAGGG + Intronic
993491595 5:88558308-88558330 CTCCACCCGGGGTGGGTCGGGGG - Intergenic
994063131 5:95504072-95504094 GCCCAGGCGGGGGGTGGGGGTGG + Intronic
994451392 5:99949487-99949509 CTCCAGGCGGGAGCTGGGGGAGG - Intergenic
996290984 5:121852095-121852117 CTGCGGCCAGGGGGCGGCGGGGG - Exonic
996354643 5:122582057-122582079 CTCTGGCAGGGGGGTGGCTGGGG + Intergenic
997358275 5:133278337-133278359 CTGCAGCCGAGGTGTGGCAGAGG - Intronic
997470193 5:134113294-134113316 CCCTAGCCCGGAGGTGGCGGGGG + Intergenic
997743076 5:136274939-136274961 CTCCACCTGGGGGGTGGTTGAGG + Intronic
997837946 5:137211683-137211705 CTCCAGCCGAGAGGTTGGGGTGG - Intronic
999242903 5:150137754-150137776 CTGCACCCTGGGGGTGGGGGTGG - Intronic
999654200 5:153796784-153796806 AACAAGCCGGGGGGTGGGGGTGG - Intronic
1001018858 5:168165650-168165672 TGCCAGCCGGGGGGGGGGGGGGG - Intronic
1001544104 5:172559211-172559233 CTGCGGCTGGGGGGTGGAGGGGG + Intergenic
1002043079 5:176528411-176528433 CTCCAGCCTGAGGGTGGGGCTGG + Exonic
1002257776 5:177971338-177971360 CTCCAGCCCGGGCGGGGCCGGGG - Intergenic
1002373929 5:178775075-178775097 CACCAGCCGGGGGGCGGTGGGGG + Intergenic
1002692358 5:181059268-181059290 CCCCAGCCTGGAGGTGTCGGAGG + Exonic
1003926488 6:10882207-10882229 CTGCAGCCAGAGGGTGGGGGTGG + Intronic
1004396337 6:15248817-15248839 CTCCAGGCGCGGCGGGGCGGCGG + Intronic
1004916226 6:20334605-20334627 CTCCAGCCTGGAGCTGGGGGTGG + Intergenic
1006370391 6:33640576-33640598 CTGCAGCCTGGGAGGGGCGGGGG - Intronic
1006729428 6:36225251-36225273 CTTCTGCCTGGGGGTGGGGGAGG - Exonic
1006814375 6:36840262-36840284 CTCCATCCTGGGGGAGGGGGAGG + Intergenic
1007784278 6:44271021-44271043 CTCCGGCCGCCGGGTGGGGGCGG - Intronic
1008848698 6:55997774-55997796 CTGCTGCCAGGGGGTGGAGGAGG + Intergenic
1009893662 6:69720868-69720890 CTGCCGCTGGGGGATGGCGGAGG - Intronic
1010846219 6:80712054-80712076 CTCCAGCCGAGGGGTCACAGAGG - Intergenic
1017164178 6:151391656-151391678 CTCCCGCCGGGGGGGAGAGGCGG + Intergenic
1019151825 6:170011413-170011435 CTTCAAGCGGGGGCTGGCGGTGG + Intergenic
1019283990 7:215221-215243 CTCCAGCTGGGGGGGGGAGCAGG + Intronic
1019302212 7:311593-311615 CTCCAGGAGGGGGGCGGGGGTGG - Intergenic
1019447344 7:1078335-1078357 CACCAGCTGCGGGGTGGGGGGGG + Intronic
1019459539 7:1149646-1149668 CTACAGCCTGGGTGTGGAGGAGG - Intergenic
1019514815 7:1434987-1435009 CTCCAGCTGGGGGTGGGGGGGGG - Intronic
1019547580 7:1585894-1585916 CGGCAGCCCTGGGGTGGCGGCGG + Intergenic
1020001661 7:4759519-4759541 CACCAGCCAGGGCGCGGCGGGGG + Exonic
1020093358 7:5353788-5353810 CTCCAGCAGGACGGTGGCTGTGG - Intronic
1020102344 7:5401220-5401242 TTCGAGTCGGGGGGGGGCGGGGG + Intronic
1020169420 7:5833424-5833446 CGCGAGGCGGGGGGTGGGGGTGG + Intergenic
1020252919 7:6483877-6483899 CGCGAGCCGTGGGGTGGCCGAGG + Intronic
1022045209 7:26617260-26617282 CTCCGGCCGTTGGGTGGTGGCGG + Intergenic
1022989553 7:35694691-35694713 TTCCAGCTTGGGGGTCGCGGTGG - Exonic
1025917039 7:65873704-65873726 GGCCAGGCGGGGGGCGGCGGCGG + Intronic
1026941587 7:74290395-74290417 CTCCTCCCGGGGAGGGGCGGCGG + Intronic
1029620608 7:101688076-101688098 GTGCAGCAGGGGGGTGGCGGGGG - Intergenic
1029652526 7:101903241-101903263 CACAAGGCGGGTGGTGGCGGGGG + Intronic
1030629319 7:111878603-111878625 CTACTGCCGGGGGATGGGGGAGG - Intronic
1031980699 7:128122504-128122526 AGCCGGCCGGGGGGTGGGGGGGG - Intergenic
1031986211 7:128166408-128166430 TTTCTGGCGGGGGGTGGCGGGGG - Intergenic
1032092921 7:128920638-128920660 CTCGAACCGGGAGGTGGCAGTGG + Intergenic
1032543151 7:132721025-132721047 CTCCTGCCGGGAGGAGGCAGTGG + Intronic
1032727030 7:134599631-134599653 CTGCTGCCGTGGGGTGGGGGAGG + Intergenic
1033186488 7:139231579-139231601 CTCCAGCCGGGGGGGCTCGCGGG - Exonic
1034464146 7:151215868-151215890 TTCCTGCCAGGGGGTGGGGGCGG + Intronic
1034951044 7:155297512-155297534 GTCCTGCCGGGAGGAGGCGGAGG - Intergenic
1035252511 7:157606339-157606361 CCCCAGCGTGGGGGTGGGGGTGG + Intronic
1035416772 7:158695838-158695860 CTGCATCCGGGGGCTGGAGGTGG - Intronic
1035833937 8:2728070-2728092 CCACAGCCGGGAGGGGGCGGGGG - Intergenic
1036454051 8:8892888-8892910 CACGAGCTGGGGGGAGGCGGGGG + Exonic
1036726297 8:11223949-11223971 CTCCGGGCGTGGGGTGGTGGTGG - Intergenic
1037290781 8:17347485-17347507 CTACAGCCGGGGGGTAGAGCAGG - Intronic
1038418454 8:27415243-27415265 ATCCAGCTGGGTGGTGGTGGTGG + Intronic
1038672288 8:29592017-29592039 CTCCATCCAGGGTGTGGCTGTGG + Intergenic
1039843270 8:41308561-41308583 CTCCGGCCGGGGGATGGAGGGGG + Intronic
1040051915 8:43023482-43023504 CTCCAGCCTGGGGGAGGGGAGGG - Exonic
1040908874 8:52497950-52497972 CCCCACCTGGGGGGTGGGGGAGG + Intergenic
1041714448 8:60921504-60921526 GCCCAGCAGGGCGGTGGCGGTGG + Intergenic
1043678489 8:82992116-82992138 CTCCAGTTGGTGGGTGACGGTGG + Intergenic
1043678705 8:82995078-82995100 CTCCAGCTGGTGGGTGACGGTGG + Intergenic
1044193188 8:89343358-89343380 CCACAGCTGGGGGATGGCGGAGG + Intergenic
1044666731 8:94640459-94640481 CCGCAGCCAGGAGGTGGCGGGGG - Intergenic
1047206264 8:122804960-122804982 CTACAGCTGGGGGATGGCTGGGG - Intronic
1047997106 8:130347599-130347621 CTTCAGCCTGGGGGTGATGGTGG - Intronic
1048299111 8:133238682-133238704 CTCCAAAGGCGGGGTGGCGGTGG - Exonic
1048534273 8:135277725-135277747 CTCCAGCCTGGGGTTGGGAGTGG + Intergenic
1048757289 8:137754064-137754086 CTGCTGCCGGGGGTTGGAGGAGG - Intergenic
1049054772 8:140227238-140227260 CTCCAGCTGGGGTGGGGTGGAGG + Intronic
1049206653 8:141366717-141366739 CCCCAGCTGCGGGGTGGTGGTGG + Intronic
1049336662 8:142090189-142090211 CCCCAGCCAGAGGGTGGAGGCGG + Intergenic
1049532143 8:143160066-143160088 CCCCAGCCCAGGGGTGGGGGTGG - Intronic
1049668386 8:143858947-143858969 CTCCTGGCGGCGGGCGGCGGCGG + Exonic
1049668802 8:143860546-143860568 CTCCTGGCGGCGGGCGGCGGCGG + Exonic
1049669217 8:143862148-143862170 CTCCTGGCGGCGGGCGGCGGCGG + Exonic
1049669632 8:143863750-143863772 CTCCTGGCGGCGGGCGGCGGCGG + Exonic
1049670042 8:143865343-143865365 CTCCTGGCGGCGGGCGGCGGCGG + Exonic
1049683884 8:143931555-143931577 CTCCAGCCGGGTGACGGTGGCGG + Exonic
1049741061 8:144241136-144241158 CTCCAGCCCTGGGGTGTCTGGGG - Intronic
1050721830 9:8600043-8600065 CTGCAGCCAGGGGATGGGGGAGG - Intronic
1051143990 9:14007438-14007460 CTCCAACGGGGGGGGGGGGGGGG + Intergenic
1052406066 9:28062895-28062917 CTACAGCTGGGGGTTGGTGGTGG - Intronic
1055644051 9:78346266-78346288 CCCCAGCCATGGGGTGGCTGTGG + Intergenic
1056592425 9:87974310-87974332 CGTTAGCCGGAGGGTGGCGGGGG + Intronic
1057227004 9:93297767-93297789 CTCCAGGAGGGAGGTGGCGTGGG - Intronic
1057337403 9:94166533-94166555 CTCCAGCGGGCGGGTGGCCCCGG + Intergenic
1058053353 9:100427419-100427441 CCGCAGCCGGGCGGGGGCGGGGG + Intronic
1058836572 9:108862958-108862980 CTCCGGCCTGGTGGTGGAGGTGG + Exonic
1059234547 9:112750847-112750869 GACCAGCCGGCGGGTGGCGGCGG + Exonic
1059942233 9:119369464-119369486 CTCCGGGCGGGGAGCGGCGGAGG + Exonic
1060206513 9:121685560-121685582 CTCCAGCTGGTGGGTGGTAGGGG + Intronic
1060223328 9:121775697-121775719 CTAAAGCCAGGGGGTGGCAGTGG - Intronic
1060406319 9:123374752-123374774 CTCCAGCCAGGGTGGGGCGGGGG + Intronic
1060587428 9:124795246-124795268 CTCCAGCCAGGAGCTGGGGGAGG + Intronic
1060790289 9:126481452-126481474 CTCAGGCTGGGGGGTGGCAGAGG - Intronic
1060823627 9:126675069-126675091 CTCCAGTCATGGGGTGGGGGTGG + Intronic
1060846051 9:126838579-126838601 CGCCAGCTGTGGGTTGGCGGTGG + Intergenic
1061002436 9:127910052-127910074 CTGCCTCCTGGGGGTGGCGGGGG + Exonic
1061438229 9:130579902-130579924 CTACAGCCGGGAGGAGCCGGGGG + Intronic
1061675504 9:132213428-132213450 CCCCAGCCGGTGGGTGGCCGTGG - Intronic
1061773313 9:132944455-132944477 CTCCAGCCGGGGAGGCTCGGAGG - Intronic
1061998850 9:134205622-134205644 CTCCACCCAGGGAGGGGCGGTGG + Intergenic
1062022552 9:134326344-134326366 CGCCGGCGGGGGGGTGGCGGGGG - Intronic
1062414061 9:136439177-136439199 CTCCAGTCGAGGCCTGGCGGGGG + Exonic
1185468771 X:370480-370502 CACCAGCCAAGGGGTGACGGTGG + Intronic
1189014198 X:37078381-37078403 CTACAGCCGGGCGGTGGCCATGG + Intergenic
1189335961 X:40171201-40171223 CTCCAGCAGGAGGGTGGCCCGGG - Intronic
1189479764 X:41383575-41383597 CTTCAGCCTGGGGGTGGAGAGGG + Intergenic
1190537117 X:51440528-51440550 CTCCTGCTGGGGGATGGGGGAGG - Intergenic
1191210158 X:57876173-57876195 CTCCAGCCAGGAGGTGGCAACGG - Intergenic
1191757841 X:64613638-64613660 CTCCAGCCTGGGTGTCGCAGGGG - Intergenic
1192560285 X:72123824-72123846 CTCCTGATGGGGGGTGGGGGTGG - Intergenic
1193749625 X:85326410-85326432 CTACTGCTGGGGGGTGGGGGCGG + Intronic
1195327900 X:103773002-103773024 CAACAGCCGGGGGCTGGGGGAGG - Intergenic
1195329157 X:103782791-103782813 CTGCAGCCGGGGGGTGGGGAGGG - Intronic
1199104112 X:143841313-143841335 CTGCAGCTGGGGTGTGGGGGAGG + Intergenic
1200746666 Y:6910079-6910101 CTGAAGCCTGGGAGTGGCGGTGG + Intergenic
1200766536 Y:7084963-7084985 CTCCTGCCGGTGAGTGGAGGTGG - Intronic
1201328431 Y:12792103-12792125 CTCCGGCAGGTGGGGGGCGGGGG + Intronic
1201416562 Y:13753240-13753262 CTCCTGCCGGGGAGGGGAGGGGG + Intergenic