ID: 1149557272

View in Genome Browser
Species Human (GRCh38)
Location 17:57582717-57582739
Sequence CTGATTGACATCAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 2, 1: 4, 2: 9, 3: 26, 4: 239}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149557272_1149557275 28 Left 1149557272 17:57582717-57582739 CCATCTTCCCTGATGTCAATCAG 0: 2
1: 4
2: 9
3: 26
4: 239
Right 1149557275 17:57582768-57582790 ATTTTTATATTTTTAACAAATGG 0: 3
1: 6
2: 54
3: 466
4: 4653
1149557272_1149557276 29 Left 1149557272 17:57582717-57582739 CCATCTTCCCTGATGTCAATCAG 0: 2
1: 4
2: 9
3: 26
4: 239
Right 1149557276 17:57582769-57582791 TTTTTATATTTTTAACAAATGGG 0: 3
1: 4
2: 39
3: 554
4: 5172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149557272 Original CRISPR CTGATTGACATCAGGGAAGA TGG (reversed) Intronic
904473055 1:30747698-30747720 AGGATGGAAATCAGGGAAGATGG + Intronic
905256062 1:36685849-36685871 CTGATTGACATCAGGGAAGATGG + Intergenic
906230885 1:44163053-44163075 CATAATGACATCAGGGAAGGTGG - Intergenic
908029455 1:59984487-59984509 CTGATTGACATCAATGAGGTTGG + Intergenic
908453656 1:64280961-64280983 CTGGTTGACATGAGGGATGATGG + Intergenic
910525628 1:88174622-88174644 CTGATTGACACCAGGGAAGATGG + Intergenic
910705950 1:90129891-90129913 TTGATTGATATCAGGGAGGACGG + Intergenic
912668160 1:111601628-111601650 CTACCTGTCATCAGGGAAGATGG - Intronic
915977920 1:160402596-160402618 ATGCTTGACACCAGGGAAAAGGG - Intronic
916975023 1:170067294-170067316 CTAAGTGACATCAGTGAAAACGG + Intronic
917650432 1:177071357-177071379 GTGATTGTGGTCAGGGAAGAGGG + Intronic
917896023 1:179488080-179488102 CTGATTGACATTATGATAGATGG - Intronic
919148515 1:193664950-193664972 CTTATTGATATAATGGAAGAAGG - Intergenic
919164967 1:193880950-193880972 GTGATTATCATCAGGGAAGAAGG - Intergenic
921431130 1:215067427-215067449 CTCATTGTCAAGAGGGAAGAGGG + Intronic
924646717 1:245884619-245884641 GTGATTGACAAAAGGGAAGATGG + Intronic
1063084207 10:2800376-2800398 CAGAATGACGTCAGGGAAGAAGG + Intergenic
1063560929 10:7126789-7126811 TTCATTGGCATCTGGGAAGAGGG - Intergenic
1065070001 10:22013771-22013793 TTATTTGACATCAGGGAGGATGG + Intergenic
1067191050 10:44068719-44068741 CTGACTAACTTTAGGGAAGAAGG + Intergenic
1067290008 10:44933625-44933647 CTGGTTGACACCTGGGGAGAGGG - Exonic
1070260943 10:74855169-74855191 CTCACTGACATCAAAGAAGACGG - Intronic
1071062319 10:81587119-81587141 CTAATAGACAGTAGGGAAGAAGG - Intergenic
1071679137 10:87686758-87686780 CTGATTAACGTCAGAGAAGAGGG + Intronic
1072514029 10:96159609-96159631 TTGTTTGCCATCAGGCAAGAAGG - Exonic
1073254207 10:102140670-102140692 CTCTTTGACTTCAGGGATGATGG - Exonic
1074278492 10:112027691-112027713 CTGAGTGGCATCAAAGAAGAGGG + Intergenic
1075864925 10:125710001-125710023 CTGATGGACTTCAAAGAAGATGG - Intergenic
1076207632 10:128615811-128615833 CTGTTTGAGGTCATGGAAGAGGG + Intergenic
1076848394 10:133081151-133081173 CAGGTTGAGATCAGGGTAGATGG + Intronic
1076870171 10:133189117-133189139 CTGCCAGACATCAGGGCAGACGG + Intronic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1078498020 11:11840409-11840431 CTGGTTGACATCAGGAAAGATGG + Intergenic
1079513989 11:21245222-21245244 CTATTTCACAGCAGGGAAGAAGG - Intronic
1081984638 11:47292771-47292793 CTGATTGACACGAGGGGAGGGGG - Intronic
1082252156 11:49994710-49994732 GTGGTTGACAAAAGGGAAGATGG - Intergenic
1083409152 11:62480026-62480048 CTGCTTGAAATCAGGGGTGAGGG - Intronic
1083768864 11:64855271-64855293 CTGGTGGCCATCAGGGCAGAAGG - Intronic
1084406203 11:68975053-68975075 CAGATTGAAGACAGGGAAGAGGG + Intergenic
1084444882 11:69197749-69197771 CTGGGTGGCCTCAGGGAAGATGG + Intergenic
1085227737 11:74937524-74937546 CTGATAGAGGTCTGGGAAGATGG - Intronic
1085509457 11:77080805-77080827 CTGATTGACAGCAGCTCAGAGGG + Intronic
1085968198 11:81554784-81554806 CTGATGGAAATCAGGGATGGAGG - Intergenic
1086766618 11:90703590-90703612 CTGACTGAGATCTGGGAAGCAGG + Intergenic
1088894918 11:114070723-114070745 AGGATTGACGTCAAGGAAGATGG - Intronic
1090441574 11:126729096-126729118 CTGCTAGAGATGAGGGAAGATGG - Intronic
1091927438 12:4366504-4366526 GTTAGTGAAATCAGGGAAGAAGG + Intergenic
1092214422 12:6670969-6670991 CTGATCCACATCAGAGAGGAAGG - Intronic
1092292002 12:7165601-7165623 CTGATTAAGATGGGGGAAGAGGG + Intergenic
1092655781 12:10683649-10683671 CTGATTTATACCAGGGTAGATGG + Intergenic
1096098684 12:48956098-48956120 CTGATTGAGGACAGGGAAGGAGG + Intronic
1096751208 12:53760014-53760036 AAGATTGACATCAGGGAAAGAGG + Intergenic
1097262636 12:57728151-57728173 GGGATGGACATCAGGGAGGACGG - Intronic
1097767425 12:63542271-63542293 GTGGTTGACAAAAGGGAAGATGG - Intergenic
1097964593 12:65565124-65565146 CTGCTTAAAATCAGCGAAGAAGG + Intergenic
1099666632 12:85638989-85639011 CTGACTTTCATCAGGGAATAAGG - Intergenic
1101366992 12:104081956-104081978 CTGGTTGACATCAGGTCAAATGG + Intronic
1101797489 12:107988870-107988892 CTGGTTAACATGAGGGAAAATGG + Intergenic
1103037323 12:117667112-117667134 CTGAGAGACAGCCGGGAAGAGGG + Intronic
1103139201 12:118534134-118534156 GTGGTTGACAAAAGGGAAGATGG - Intergenic
1103205626 12:119126471-119126493 AGGATTGAAATCAGGGAACATGG + Intronic
1104659054 12:130596059-130596081 CTGTGTAACATCAGGGACGATGG - Intronic
1104715970 12:131016457-131016479 CTCACTGACATCACGGCAGAGGG - Intronic
1105590878 13:21791804-21791826 CTGGTTGAAATCAGGGAACTTGG + Intergenic
1105653954 13:22413923-22413945 TTGAGTGACATCAGTGAAAATGG - Intergenic
1106790127 13:33146624-33146646 GTGAGTGACATCAGTGAAAAAGG + Intronic
1107117050 13:36758208-36758230 CTGATGGATATCAGGGAAGATGG + Intergenic
1107326170 13:39245335-39245357 CTGGTACACATCAGGGCAGAGGG - Intergenic
1111174401 13:84574640-84574662 CTGATGGATATTAGGAAAGAAGG + Intergenic
1113507986 13:110830435-110830457 CAGAGGGACACCAGGGAAGAGGG + Intergenic
1116785483 14:49283313-49283335 CTGATTGAGATCACAGAAGATGG + Intergenic
1120349825 14:83341551-83341573 CTCATTCACATAAGGGAATAAGG + Intergenic
1120625604 14:86821995-86822017 CTGATTGACCTCAGGGTTGAGGG + Intergenic
1120766066 14:88327164-88327186 CTTCTGGACTTCAGGGAAGAAGG - Intergenic
1121835938 14:97092388-97092410 CTGGTTCATCTCAGGGAAGATGG - Intergenic
1124050479 15:26192658-26192680 CTGATTCACATTAGTGAATATGG - Intergenic
1125171926 15:36775108-36775130 CTGATTGATCTCAGGGAAATGGG - Intronic
1126252003 15:46578479-46578501 CTGACTCACACCCGGGAAGAAGG + Intergenic
1126281427 15:46955728-46955750 CTCAGTGACTTCAAGGAAGACGG + Intergenic
1127306769 15:57713759-57713781 ATGATTGTAATTAGGGAAGAAGG + Intronic
1128693301 15:69742050-69742072 CTCCTTGGCATCAGGGAAGCAGG + Intergenic
1130957848 15:88639654-88639676 CAGATGGGCACCAGGGAAGAGGG - Intronic
1132928831 16:2448059-2448081 CTGGTTGACAACAGAGAACAGGG + Intronic
1133675278 16:8065252-8065274 GTGAATGAAATCTGGGAAGAAGG + Intergenic
1137292465 16:47061253-47061275 CTGCTGGACCTCAGGGAAGGAGG - Intergenic
1139492662 16:67294785-67294807 ATGCTAGACAGCAGGGAAGAAGG + Intronic
1142389663 16:89790807-89790829 ATGAGTGAAATCAGGAAAGAGGG - Intronic
1142863755 17:2778246-2778268 CTACTTGATATCTGGGAAGAAGG - Intronic
1144087007 17:11819049-11819071 ATGTTTGAAATCAGAGAAGAGGG - Intronic
1144760079 17:17702154-17702176 CTGGCTGACATGAGGGGAGAGGG + Intronic
1145890646 17:28412973-28412995 ATCCTTGACATAAGGGAAGAAGG - Intergenic
1146228016 17:31084142-31084164 CTGGTTCCCATCAGGGAAAATGG + Intergenic
1147451571 17:40508559-40508581 CTGATTGACATGAGAGAAGATGG - Intergenic
1147690974 17:42314294-42314316 CTGGTTGAGCTCAGGGAATATGG - Exonic
1149557272 17:57582717-57582739 CTGATTGACATCAGGGAAGATGG - Intronic
1150021326 17:61616271-61616293 CTGGTTGACATCAGGTAACTGGG + Intergenic
1150593720 17:66585258-66585280 CTGGTTGACAGAAGGGAAGATGG + Intronic
1153625317 18:7017726-7017748 CTGATTGGAATCAGGGCAAATGG - Intronic
1153887111 18:9476362-9476384 CAGAATTACTTCAGGGAAGACGG - Intronic
1154302122 18:13203444-13203466 CTGATTGAGAGCAGGGCAGAAGG + Intergenic
1154348668 18:13565291-13565313 CTGTCTGGGATCAGGGAAGATGG - Intronic
1155639513 18:27997231-27997253 CTGAGTGACATCAGTGAATGAGG + Intronic
1156846777 18:41674781-41674803 CTAATGGACAGCGGGGAAGAGGG - Intergenic
1156901569 18:42306336-42306358 CTTAATGACATCAGAGAAGCGGG + Intergenic
1157476284 18:48025525-48025547 CTGAGTGACATAGGTGAAGATGG - Intergenic
1157924425 18:51747591-51747613 CTGATGTTCATCAGGGATGATGG + Intergenic
1158047878 18:53178093-53178115 CTGATTGAACTGAGTGAAGAAGG - Intronic
1158716783 18:59887690-59887712 CTGAAGGACATAATGGAAGAAGG - Intergenic
1159218740 18:65431031-65431053 ATGATTGGCAGCAGGGAGGAGGG + Intergenic
1160104814 18:75963610-75963632 CTGATTGACATAAATGAAGGTGG + Intergenic
1164589804 19:29500504-29500526 CTGAGCCAGATCAGGGAAGAGGG + Intergenic
1167078265 19:47262172-47262194 CTGAGTGACATCATGGAGCAGGG - Intronic
1168284287 19:55322688-55322710 CTGGGTGAGCTCAGGGAAGAAGG + Exonic
1168705654 19:58468867-58468889 CTGAGGGACATCATGGAAGGTGG + Intronic
925210176 2:2038783-2038805 CTGATGTCCAGCAGGGAAGAGGG - Intronic
925464794 2:4097440-4097462 CTGTTTGACCTCAGGCAAGCTGG + Intergenic
926188220 2:10708184-10708206 CTGATGGGCATCAGGGACCAAGG + Intergenic
926391580 2:12399506-12399528 CGCATTGCCATCAGGGAGGAAGG - Intergenic
928062882 2:28132689-28132711 CTAATTGTCCTCAGGGAAAATGG - Intronic
928131159 2:28651524-28651546 AAGATTGACATCAGGGAGAAGGG - Intergenic
929240809 2:39651349-39651371 ATGAATGACATGATGGAAGAAGG - Intergenic
929974009 2:46614093-46614115 CTGATTGACATCAGAGAGCTAGG + Intronic
930417136 2:51103278-51103300 TTGAGTGTCCTCAGGGAAGAGGG - Intergenic
930851003 2:55960141-55960163 CTGATTGACTTCTGGGAAACAGG + Intergenic
931669300 2:64632404-64632426 TTGATTGACCTCAGGGCAGCTGG + Exonic
933022255 2:77208488-77208510 CTGAGTGAGAAAAGGGAAGAAGG + Intronic
933751883 2:85607967-85607989 CTGATTGACAGCACGCCAGAGGG - Exonic
933935185 2:87198044-87198066 CTGCTTCACATCCAGGAAGAAGG - Intergenic
934513598 2:94969068-94969090 CTGTTTGACATCAGGCAACAAGG - Intergenic
936650767 2:114423473-114423495 CTGGTGAACCTCAGGGAAGAAGG + Intergenic
936965027 2:118118926-118118948 TTGATTGACGGCAGGGATGAGGG + Intergenic
938843766 2:135187336-135187358 GTGGATGACATCAGGCAAGATGG + Intronic
941012221 2:160313407-160313429 GTGATAGACGACAGGGAAGAAGG - Intronic
941078896 2:161037304-161037326 CAGATTGAGCTCAAGGAAGAAGG + Intergenic
943482016 2:188430637-188430659 CTGAGTGACAGAAGGGCAGAAGG - Intronic
944994980 2:205283838-205283860 CTGGCTTACTTCAGGGAAGAGGG - Intronic
947842628 2:233218087-233218109 CTGACAGAGATAAGGGAAGATGG + Intronic
948396073 2:237646166-237646188 ATTATTGTCATTAGGGAAGATGG + Intronic
948571900 2:238922927-238922949 CTGAGTGCCAGCAGGGAGGATGG - Intergenic
948584440 2:239010319-239010341 ATTATTAACATCAGGGAAGATGG + Intergenic
1169656181 20:7926226-7926248 CTGTTTGACAGTAGAGAAGAAGG - Intronic
1173059352 20:39646837-39646859 GTGACTGTCATCAGGGAAAAAGG - Intergenic
1173939561 20:46898448-46898470 GGGATGGAGATCAGGGAAGAGGG - Intronic
1173955262 20:47027357-47027379 CTGATTCACATTAGGGAACTCGG - Intronic
1175014514 20:55775024-55775046 GTGCTGGACATCTGGGAAGATGG + Intergenic
1175523564 20:59618442-59618464 CAGAGTGAGACCAGGGAAGAGGG + Intronic
1176126958 20:63479890-63479912 CTGTGTGAGACCAGGGAAGAGGG - Intergenic
1176686516 21:9852697-9852719 CTGATTGACCCAAGGGAGGAAGG + Intergenic
1178289070 21:31351068-31351090 TTCATTTACATTAGGGAAGATGG - Intronic
1178797892 21:35762369-35762391 GTCATTTACATCAGGCAAGAAGG + Intronic
1180106390 21:45621416-45621438 GGGATTGGTATCAGGGAAGACGG - Intergenic
1181376156 22:22459807-22459829 CTAAGAGACACCAGGGAAGAGGG + Intergenic
1181421917 22:22806719-22806741 CAGAGTGGCATCATGGAAGATGG + Intronic
1181479235 22:23187398-23187420 CTGATTGACATTGGGGAGGAGGG + Intronic
1182105578 22:27686680-27686702 CTGCCTGACGTCAGGGCAGACGG - Intergenic
1182795190 22:32986671-32986693 CTGTTTGACCTCAGGCAAAATGG + Intronic
1183514603 22:38257317-38257339 GTGATTGGCATCAGGGAGGATGG + Intronic
1185281546 22:49972010-49972032 CTGACTGACCTCAGGGCAGGCGG - Intergenic
950849266 3:16047186-16047208 CTGATTGACATCAGGAAAAATGG + Intergenic
951030504 3:17876474-17876496 CTGATTGACATCAAAGAAGATGG - Intronic
952112566 3:30140954-30140976 TTGATTCACAAGAGGGAAGAAGG - Intergenic
952210597 3:31225796-31225818 CTGTGTGGCAGCAGGGAAGAGGG - Intergenic
954229929 3:49209017-49209039 CTGGTTGAATTCTGGGAAGATGG + Intronic
954624609 3:52015784-52015806 CTGGTAGCCCTCAGGGAAGATGG - Intergenic
955252361 3:57297101-57297123 GTGTTTGACGTCAGGGAAGAGGG - Intronic
956190703 3:66605304-66605326 ATAAATGACAGCAGGGAAGATGG + Intergenic
956646930 3:71465553-71465575 CTGTTTTACATCACTGAAGATGG + Intronic
956749854 3:72336905-72336927 CTGCTTGACTCCAGGGAAGCCGG + Intergenic
957378639 3:79393874-79393896 CTGAATAACATCTGTGAAGACGG + Intronic
958764503 3:98349490-98349512 CTGATTGACATCAGAGAGTATGG + Intergenic
959500518 3:107101632-107101654 GTGGTTGACAAAAGGGAAGATGG - Intergenic
959929513 3:111963900-111963922 GTGATAAACATCAGGGAAGCAGG - Intronic
960397154 3:117151576-117151598 ATGACTTACTTCAGGGAAGAAGG + Intergenic
962845739 3:139272329-139272351 CTGAATGGCATCAGGTAGGAAGG - Intronic
963554282 3:146768285-146768307 CTGGTTGCCAACAGGGAACAAGG - Intergenic
964490297 3:157228826-157228848 CTGATTGATATGGGGAAAGAAGG - Intergenic
964600167 3:158491576-158491598 CTGATTGACAACTGGTAAAAGGG + Intronic
964909162 3:161756941-161756963 CTGTTTGAAATCAGGTAAAATGG - Intergenic
970005127 4:11403435-11403457 GTTATAAACATCAGGGAAGAAGG + Intronic
970101747 4:12531242-12531264 CTGCTGCACATCAGAGAAGAGGG + Intergenic
970205017 4:13646947-13646969 ATGATTGACATTTGGGAAAATGG + Intergenic
970791154 4:19859554-19859576 CTGTTTGCCATCAAGGAAGTGGG + Intergenic
970907615 4:21235400-21235422 ATGTTTGACAAAAGGGAAGAAGG - Intronic
971429476 4:26550083-26550105 ATAATTGACATCAGGGAAGATGG - Intergenic
973022460 4:45220461-45220483 CAGCTTGACTTCAGTGAAGATGG - Intergenic
974888154 4:67846629-67846651 CCAATTGACATCATGGAAAATGG - Intronic
975995799 4:80312431-80312453 CTGATTGTTACCAGGGAACATGG + Intronic
981183254 4:141770124-141770146 CTGATAGACAAAAGGAAAGAAGG - Intergenic
982031344 4:151304164-151304186 CTGAGTGACATCAGAAAAAATGG + Intronic
984582078 4:181521726-181521748 ATGACTGACATGTGGGAAGAAGG - Intergenic
986238180 5:5932146-5932168 CTGATTGACACCGAGGATGAAGG - Intergenic
986238761 5:5937927-5937949 CTATTTGAAAGCAGGGAAGAGGG - Intergenic
986428841 5:7661704-7661726 CTGATTGACATCAGGACAGATGG - Intronic
987188209 5:15446279-15446301 CTCACTGACAACAGGGAATAAGG + Intergenic
988720194 5:33869776-33869798 CTGATAAACATCAGGAAACAGGG + Intronic
989230332 5:39078478-39078500 CTGATTGACATTAGGGAAGATGG - Intergenic
990442756 5:55862978-55863000 CTGATTGCCAACAAGGAGGAAGG + Intronic
990982967 5:61618143-61618165 CCCACTGACTTCAGGGAAGATGG + Intergenic
991614205 5:68479148-68479170 GTGATAGACATCATGGGAGAAGG + Intergenic
991636930 5:68715660-68715682 CTGATTTAGATTAGGGAAGGAGG + Intergenic
991664315 5:68982586-68982608 CTGATTGAAATAATGGAAGAAGG + Intergenic
994022613 5:95044836-95044858 CTGATTCACGTTAGGGATGACGG - Intronic
995189790 5:109308246-109308268 TTCTTTGAAATCAGGGAAGAGGG + Intergenic
996282914 5:121753749-121753771 TTGATTGACATCAGTGAAACAGG - Intergenic
996438438 5:123461418-123461440 ATGACTCACCTCAGGGAAGAGGG + Intergenic
996672717 5:126136863-126136885 CTTACTGACATCATGGAACAGGG + Intergenic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
998427441 5:142040797-142040819 ATGAATCACATTAGGGAAGAGGG - Intergenic
1001299190 5:170521882-170521904 CTGAGTGACTACATGGAAGAAGG - Intronic
1001667367 5:173444527-173444549 GTGATTGAGAGCAGGGCAGAGGG + Intergenic
1003544809 6:7051100-7051122 CGGATTGGCAACAGGGAAGCAGG - Intergenic
1004096427 6:12559627-12559649 CAGAGTGATATCAGGGAAAATGG + Intergenic
1004493856 6:16144823-16144845 CTTATTGACAACAGCGAATAAGG + Intronic
1007872285 6:45053955-45053977 CTGATGGTCTTCAGGGGAGAAGG - Intronic
1008489690 6:52073379-52073401 TTTATTGCCATCAGGGAAGCTGG + Intronic
1009846164 6:69137911-69137933 CTGAATGACAGCACGGAAGAAGG - Intronic
1009879121 6:69543241-69543263 CTGTTTGGCATCAGAGAAAATGG - Intergenic
1010842715 6:80666708-80666730 CTGTCTGTCATCAGGAAAGATGG - Intergenic
1012829147 6:104184699-104184721 CTGATTAACAGCTGGGCAGAGGG + Intergenic
1013627317 6:111950955-111950977 CTGATTGACACAGAGGAAGAGGG + Intergenic
1014009978 6:116464448-116464470 CTGATTTAGATTAGGGGAGAAGG + Intergenic
1014009993 6:116464576-116464598 CTGATTTAGATTAGGGGAGAAGG + Intergenic
1016262019 6:142183088-142183110 CTGATAGGCGTCAAGGAAGATGG + Intronic
1016631149 6:146233344-146233366 ATGATTGACATCACAGAAAATGG - Intronic
1017735773 6:157361763-157361785 CTGATTGAGATCAAGTAACATGG + Intergenic
1017795470 6:157840268-157840290 CTGAGGGAGCTCAGGGAAGAGGG + Intronic
1018138986 6:160807745-160807767 CTGAATTACAAAAGGGAAGATGG - Intergenic
1023859162 7:44206846-44206868 CTGACTGACATCAAGGTAGAGGG - Intronic
1023895523 7:44429794-44429816 CTGAATGACATGAGAAAAGAGGG + Intronic
1023906152 7:44522965-44522987 CAGAGTGACATTAGGGAAAATGG + Intronic
1024174636 7:46826448-46826470 CTGTTTCCCATCAGGGAAAAGGG + Intergenic
1024191603 7:47017175-47017197 CTGAATAACAAAAGGGAAGATGG + Intergenic
1024331444 7:48159563-48159585 GTGGCTGACATCAGGGAAGATGG + Intergenic
1024467422 7:49727220-49727242 GTGATTGATATCAAGAAAGACGG + Intergenic
1024951150 7:54861610-54861632 CTGAGTGACATCATGGAAGAGGG - Intergenic
1025746656 7:64248792-64248814 CTGGCTCAGATCAGGGAAGAAGG + Intronic
1027660098 7:80978651-80978673 AAGACTGACATCAGGGAATATGG - Intergenic
1027839706 7:83293332-83293354 CTGGTTCACATCAGGAAAGATGG + Intergenic
1027969940 7:85066477-85066499 CTGACTAACATTAGGGAACATGG - Intronic
1028812439 7:95103040-95103062 CTGACTTCCATCAGAGAAGAGGG + Intronic
1030111092 7:106027521-106027543 CTGACTGACTTCAGAGAAGTGGG + Intronic
1030173438 7:106627628-106627650 GTGACTGGCACCAGGGAAGAAGG + Intergenic
1030634336 7:111931515-111931537 CTGATTAACTTCAGGAAGGAAGG - Intronic
1032485206 7:132281366-132281388 CTGATTGACATCAGAGAAGATGG - Intronic
1032865417 7:135919606-135919628 CTGAGTGACAGAAGGGAAGGTGG - Intergenic
1033307826 7:140238176-140238198 ATGTTTGACGTCTGGGAAGATGG + Intergenic
1035269045 7:157709204-157709226 CTGACTCCCATCAGGGGAGATGG + Intronic
1035999904 8:4591005-4591027 TTGATTGACAGCAGGGAAGAAGG - Intronic
1038673196 8:29598699-29598721 CCTATTGACATCAGAGATGAAGG - Intergenic
1040459706 8:47635420-47635442 CTTAATCACATCAGGGTAGATGG - Intronic
1040813588 8:51482944-51482966 CTGACTGACATCTGGGAAGCAGG + Intronic
1041159013 8:55018359-55018381 CAGAGTGATATCAGAGAAGAAGG + Intergenic
1044105753 8:88204230-88204252 CTGATAGACATCAGAGAAAATGG + Intronic
1046238118 8:111453926-111453948 CTGCTTGACATCACAAAAGATGG + Intergenic
1046503656 8:115110913-115110935 ATGACTGGCATCAGGGAACACGG + Intergenic
1046888042 8:119390441-119390463 TTGAATGCCATCATGGAAGATGG + Intergenic
1048518950 8:135136414-135136436 CTGAATGATGTGAGGGAAGAGGG + Intergenic
1048886406 8:138913537-138913559 CTCACTGTCATCTGGGAAGATGG + Intronic
1049704829 8:144036812-144036834 GTGTTTGTCATCAGGGAACACGG + Intronic
1052539706 9:29794341-29794363 CTGATTATCATCAGGAAAGTAGG - Intergenic
1055028226 9:71744986-71745008 CTGATAGGGATCTGGGAAGAAGG + Intronic
1055644385 9:78348973-78348995 CTGATGGGCATCATGGAGGATGG + Intergenic
1058074741 9:100638886-100638908 CAGTTTTACATCTGGGAAGACGG - Intergenic
1059613790 9:115927147-115927169 CTGACAGCCATCAGGGAAGATGG + Intergenic
1059694943 9:116722109-116722131 CTGGTAGACAGCTGGGAAGAGGG - Intronic
1060882437 9:127127273-127127295 CTGCTTGAAATCAGTGGAGAAGG - Intronic
1060969921 9:127732091-127732113 CTGCTCGTCTTCAGGGAAGAAGG + Exonic
1185817845 X:3172858-3172880 CTGCTTGACATCGCAGAAGATGG - Intergenic
1189362625 X:40364392-40364414 ACGATAGACATCAGGGCAGAAGG - Intergenic
1189459475 X:41227219-41227241 CTGCTTGGCATCAGGTAATAAGG + Intronic
1190633983 X:52416860-52416882 CTGAGTGACACGGGGGAAGAAGG + Intergenic
1192499045 X:71636619-71636641 CTTCTTGACATCAGGGAAGCAGG + Intergenic
1193534124 X:82691822-82691844 CTGATTGACATCAGGGAAAAAGG + Intergenic
1195663612 X:107407536-107407558 CTTATTGACATAAAGGAGGAAGG + Intergenic
1195703510 X:107722374-107722396 CTGAGTGACACAAGGGATGACGG + Intronic
1198549515 X:137730000-137730022 TTGATACACATCAGGGATGATGG + Intergenic
1199149744 X:144416378-144416400 CTGAATGAAAGCAGGGCAGAAGG - Intergenic
1199499674 X:148496130-148496152 ATGATTGACATAAGGTCAGATGG + Intergenic
1199570678 X:149264210-149264232 CTTTTTGACATTAGGGGAGAAGG - Intergenic
1199707582 X:150444074-150444096 TTCATTGACATCAGGGAGGATGG + Intronic