ID: 1149557855

View in Genome Browser
Species Human (GRCh38)
Location 17:57587020-57587042
Sequence CTGGGTAAAAACGCAGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149557855 Original CRISPR CTGGGTAAAAACGCAGTTCC TGG Intronic
901106722 1:6762102-6762124 CTTGTTAAAAATGCAGCTCCTGG - Intergenic
901308995 1:8254563-8254585 CAGGGTAAAAAGGCAGTCCGTGG - Intergenic
901755797 1:11440736-11440758 CTGGGTAAGGGCACAGTTCCGGG + Intergenic
904849980 1:33451344-33451366 CTGGGTAGAAACCCAGTAGCAGG - Intergenic
908174266 1:61538712-61538734 CTGGGTGAAACTGCAGCTCCAGG + Intergenic
911190412 1:94942938-94942960 CTGGGTAAATACACACTTCTGGG + Intergenic
911401080 1:97376215-97376237 GTGGGTATAAATGCAGGTCCTGG - Intronic
912722512 1:112032143-112032165 CTGTCTAAACACTCAGTTCCAGG + Intergenic
915252736 1:154602230-154602252 CTTGGTAGATACTCAGTTCCTGG + Exonic
915528400 1:156489869-156489891 CTGGGTAATAAGGCAGGGCCTGG - Intronic
917626627 1:176852968-176852990 CTGGGTATAAATGAAGTCCCTGG + Intergenic
917823179 1:178787865-178787887 CTGGGTAAAAAAGCATTTAGAGG - Intronic
918009920 1:180577158-180577180 CCTGGTAAAAACGTAATTCCTGG - Intergenic
918943679 1:191032824-191032846 TTGGGTATATACCCAGTTCCTGG - Intergenic
919306260 1:195842824-195842846 CTGGGTAAATACCCAGTACTGGG + Intergenic
921220901 1:212973265-212973287 CTGGGAAAACCCGCAGTTCCAGG - Intronic
921624977 1:217370013-217370035 CTGGGTAAAGCCCCAGTTACGGG + Intergenic
1065539664 10:26750070-26750092 ATGGGTAAAAACACAATTCAAGG + Intronic
1066117296 10:32252140-32252162 CTGGGTGACAAAGCAGTACCCGG + Intergenic
1067035554 10:42913536-42913558 CTGGGAAAAAAAGCAGTCCTTGG + Intergenic
1069693315 10:70368921-70368943 CTGGTTAAAAATGCAGATTCAGG - Intronic
1071455899 10:85851398-85851420 CTCACTAAAAACGCACTTCCTGG + Intronic
1073652074 10:105371788-105371810 CTTGTTAAAAATGCAGTCCCAGG + Intergenic
1074367706 10:112873096-112873118 CTCAGTAAAACCTCAGTTCCAGG - Intergenic
1076048100 10:127311160-127311182 CTTGGTAGAAATGCAGTTGCAGG - Intronic
1078983778 11:16568896-16568918 CTGGGTAAAATCACAATTGCGGG - Intronic
1086516168 11:87615798-87615820 CTTGTTAAAAATGCAGTTTCTGG - Intergenic
1098713305 12:73795836-73795858 CTAGTTAAAAATCCAGTTCCTGG - Intergenic
1108948764 13:56060258-56060280 CTGGGTAAGAATCCACTTCCTGG + Intergenic
1111189789 13:84792154-84792176 CTGGGGAAAAACCCCGTTCTGGG + Intergenic
1114870435 14:26649276-26649298 TTGGGTAAAAATGCAGATTCTGG + Intergenic
1116028161 14:39538368-39538390 CTGGGGAAAAAGGCAGTTGAAGG - Intergenic
1116312859 14:43347582-43347604 ATGGGGAAAAATGCAGTACCCGG + Intergenic
1118473027 14:66093053-66093075 CTGGGTGACAACACATTTCCTGG - Intergenic
1121047058 14:90796022-90796044 CTGCGTTCAAACGCAGCTCCAGG - Intronic
1202897141 14_GL000194v1_random:16735-16757 CTGGGTAAGCATGCAGTCCCAGG + Intergenic
1125426860 15:39557411-39557433 CTTGTTAAAAACGCAGATCCTGG + Intergenic
1127333151 15:57958072-57958094 CTTGTTAAAAACGCAGTTCCTGG + Intronic
1129779276 15:78259379-78259401 CTGGGTAAAGGCCAAGTTCCAGG + Intergenic
1131563199 15:93462207-93462229 CTGTGGAAGAACGCAGCTCCTGG - Intergenic
1132083201 15:98884879-98884901 CTGGATTAAAAGGCTGTTCCAGG + Intronic
1134530082 16:14975774-14975796 GCGGTTAAACACGCAGTTCCCGG - Intronic
1135669888 16:24366213-24366235 CTTGGCAAAAACTCAGTTCCAGG - Intergenic
1137977520 16:53043942-53043964 CTGGGGCCAAAGGCAGTTCCAGG + Intergenic
1138247000 16:55475166-55475188 CTGGGCTAAAAGGCAGATCCAGG - Intronic
1141490287 16:84368197-84368219 CTCGTTAAAAACCCAGCTCCCGG + Intergenic
1143734470 17:8900787-8900809 CTGGGTAGAAACTCCGTTCTGGG - Intronic
1143829189 17:9637594-9637616 CTGGTTTAAAATGCAGATCCTGG + Intronic
1146159579 17:30552684-30552706 CTGGGGACAACCCCAGTTCCTGG - Intergenic
1149557855 17:57587020-57587042 CTGGGTAAAAACGCAGTTCCTGG + Intronic
1152704966 17:81838724-81838746 CTGGGTACCAACGCAGGTCCAGG - Intergenic
1153734330 18:8048919-8048941 CTGGGTAAAATATCAGTTCCGGG + Intronic
1158087703 18:53672687-53672709 CTAGTTAAAAATGAAGTTCCAGG - Intergenic
1158926348 18:62266697-62266719 TTAGGTAAAACCTCAGTTCCAGG + Exonic
1160246203 18:77162186-77162208 CTGGATAAATACGCAGCACCTGG + Intergenic
1164606629 19:29603677-29603699 CTGGATAAAAACGAATCTCCAGG + Intergenic
1166439427 19:42798498-42798520 CTTGGTAAAAACACAGTGCAGGG + Intronic
1166457465 19:42954049-42954071 CTTGGTAAAAACACAGTGCAGGG + Intronic
1166474410 19:43109268-43109290 CTTGGTAAAAACACAGTGCAGGG + Intronic
1166495054 19:43294821-43294843 CTTGGTAAAAACACAGTGCAGGG + Intergenic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
928901817 2:36326517-36326539 CTGAGGAAACACGCATTTCCTGG + Intergenic
933249780 2:80016336-80016358 CTGGGTCAATACGGAGTGCCAGG + Intronic
947241514 2:227999490-227999512 CTAGGTAAAAAGTCATTTCCTGG + Intronic
948321236 2:237071563-237071585 CTGGGTATAAAGCCATTTCCAGG + Intergenic
948909609 2:240996474-240996496 CTGGGTAACAACCCATTTCTGGG - Intergenic
1171363911 20:24610766-24610788 CTGGGCAAATACACAGTGCCTGG - Intronic
1172206542 20:33166745-33166767 ATGGGTAAACACGCTGTTCCTGG - Intronic
1173307805 20:41867019-41867041 CTGGGTAAATACCCAGTTAAGGG + Intergenic
1174189518 20:48730209-48730231 CTGGGTAGAAGTGCAGGTCCAGG - Intronic
1175794099 20:61760549-61760571 CTGGGTAAAAATGAAGGTGCTGG + Intronic
1176616826 21:9032724-9032746 CTGGGTAAGCATGCAGTCCCAGG + Intergenic
1176678503 21:9803731-9803753 CTGGGTAATAAAGAAATTCCGGG - Intergenic
1178924670 21:36764787-36764809 CTGGGTAGAAAGGGAGTTCTGGG + Intronic
1182328615 22:29533644-29533666 CTGGGAAAAAACTCATCTCCAGG + Intronic
1183916657 22:41125999-41126021 ATGGACAAAAAGGCAGTTCCTGG + Exonic
949765456 3:7521268-7521290 CCAGGTAAAACCGCAGTTCTTGG + Intronic
950876173 3:16276570-16276592 ATGGGTAAAAACTCAGCTTCTGG + Intronic
951508313 3:23473906-23473928 CTGGGTAAATACCCAGTAGCGGG + Intronic
952180017 3:30907356-30907378 CTGGTTTAAAATGCAGGTCCTGG - Intergenic
952878069 3:37964800-37964822 CTGGGTTAATAAGCAGCTCCTGG - Intronic
953212589 3:40889289-40889311 CTGGTTAGAAATGCAGATCCTGG - Intergenic
954880094 3:53829538-53829560 CTGTTTAAAAAGGCAGTTTCAGG - Intronic
956411448 3:68984122-68984144 CTGGTTAAGAACGCAGGTTCTGG - Intronic
959631684 3:108514197-108514219 CTGGGAAATACCTCAGTTCCGGG - Intronic
966448758 3:180033809-180033831 CTGGATAAAAACATAGCTCCAGG + Intronic
967952254 3:194850463-194850485 CTGGGAAAAGGCCCAGTTCCTGG + Intergenic
969592025 4:8127518-8127540 CTGGGCAAAAGCGCAGTTTGGGG + Intronic
971286976 4:25300200-25300222 TTGGGTTTAAATGCAGTTCCTGG - Intergenic
974059016 4:57013275-57013297 CTGGGTCAAAACCCAGGGCCAGG - Intronic
978694026 4:111554162-111554184 CTGGTTAAAAATCCAGTTCGTGG - Intergenic
985397052 4:189555238-189555260 CTGGGTAATAAAGAAATTCCAGG + Intergenic
990280174 5:54242038-54242060 CTGGGTAAACACCCAATTCACGG + Intronic
992586535 5:78245708-78245730 TTAGGTAAAAACCCTGTTCCTGG + Intronic
996992125 5:129647892-129647914 CTGGGTAAACTCAAAGTTCCTGG + Exonic
1000116203 5:158155863-158155885 AGGGGTAAAAAAGCAGTTCTTGG - Intergenic
1007423538 6:41733818-41733840 CTCGGTTAGAACGCAGTTCTTGG - Intronic
1008073025 6:47116836-47116858 CTGGGCAACATCTCAGTTCCTGG - Intergenic
1008547645 6:52597658-52597680 GTGGTTGAAAACGCAGGTCCTGG - Intergenic
1015842522 6:137489710-137489732 CTGGGAAAAAAAGAAGTTCGAGG + Intergenic
1016777638 6:147922400-147922422 GTGGGGAAAAATACAGTTCCGGG + Intergenic
1017335480 6:153253820-153253842 CTGGGTAAAAACTGAGTACAAGG + Intergenic
1018509605 6:164510874-164510896 TTAGGTTAAAACACAGTTCCAGG - Intergenic
1018918913 6:168157209-168157231 CAGTGTAAAATGGCAGTTCCAGG + Intergenic
1019000812 6:168749593-168749615 CTGGGTAAAAACCCAGTAGTGGG + Intergenic
1019261197 7:82813-82835 CTGGATAAAAACACCTTTCCTGG - Intergenic
1021343653 7:19494190-19494212 CTGGGTGAAGACGAAGTTCTAGG - Intergenic
1021782571 7:24120265-24120287 CTCATTAAAAATGCAGTTCCTGG - Intergenic
1025951019 7:66145571-66145593 CTTAAAAAAAACGCAGTTCCTGG - Intronic
1027585084 7:80047248-80047270 CTGTGTATAAACACAGTTTCAGG + Intergenic
1042508343 8:69584990-69585012 CATGGTAAAAAAGTAGTTCCTGG - Intronic
1046498675 8:115046849-115046871 CTGGGTAAATACCCAGTAGCAGG - Intergenic
1046623413 8:116551928-116551950 GTGGTTAAAAATGCAGATCCTGG - Intergenic
1046724572 8:117660456-117660478 TTGGGTAAAAACGGAGTTTTAGG + Intergenic
1055211842 9:73804449-73804471 CTGAGTAAAAAGGAAGATCCAGG - Intergenic
1060113662 9:120924713-120924735 CTTTGTAAAAACACAGTTGCTGG - Intronic
1062302054 9:135879478-135879500 CTGGGTAAAATTGCAGATTCTGG - Intronic
1203663670 Un_KI270754v1:6270-6292 CTGGGTAATAAAGAAATTCCGGG - Intergenic
1186943775 X:14541971-14541993 CTGGTTAAAAAGGCAAATCCTGG + Intronic
1188905146 X:35782690-35782712 CTAGGTAATAACACAGTACCTGG + Intergenic
1202164739 Y:21975264-21975286 ATGGGTTACAACGCAGTGCCTGG + Intergenic
1202226617 Y:22611110-22611132 ATGGGTTACAACGCAGTGCCTGG - Intergenic
1202316502 Y:23584552-23584574 ATGGGTTACAACGCAGTGCCTGG + Intergenic
1202554262 Y:26085506-26085528 ATGGGTTACAACGCAGTGCCTGG - Intergenic