ID: 1149557942

View in Genome Browser
Species Human (GRCh38)
Location 17:57587563-57587585
Sequence CTGCAGCCACCTTTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 311}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149557942_1149557949 -4 Left 1149557942 17:57587563-57587585 CCCAGCCCCAAAGGTGGCTGCAG 0: 1
1: 0
2: 1
3: 32
4: 311
Right 1149557949 17:57587582-57587604 GCAGAGGCGCAGGTGTGAGCTGG 0: 1
1: 0
2: 3
3: 56
4: 461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149557942 Original CRISPR CTGCAGCCACCTTTGGGGCT GGG (reversed) Intronic
900137027 1:1122047-1122069 TTGCAGCTGCCTTTGGAGCTCGG + Intergenic
900426915 1:2585197-2585219 CTGCCGCCTCCTTGGGAGCTGGG - Intergenic
900570738 1:3357106-3357128 ATGCAGCCTTCCTTGGGGCTGGG - Intronic
900902321 1:5525590-5525612 CTGCAGCCATCTTTTGAGATAGG + Intergenic
901588942 1:10323012-10323034 CTGCCTCCACCTTCTGGGCTGGG + Intronic
901647801 1:10726064-10726086 CTCCAACCACCTATGGGGCAGGG + Intronic
902895918 1:19480004-19480026 CTGCAGTCGGCTTGGGGGCTGGG - Intronic
903124692 1:21239653-21239675 CTGCACCAGCCTTGGGGGCTGGG + Intronic
904038208 1:27570009-27570031 CTCCAGCCCCCTTTGGGTCCTGG - Intronic
905387225 1:37613289-37613311 CACCAGCCACCTCTGGGGCCAGG + Intronic
906057679 1:42929447-42929469 CTGCAGTGACCTTACGGGCTTGG + Intronic
906614932 1:47227510-47227532 CTGCAGCCTCCTCTGGAGCTTGG + Intronic
907093559 1:51752877-51752899 ATATAGCCACCTTTGGGGTTAGG + Intronic
907451985 1:54551389-54551411 CTGCTGCCACGCTCGGGGCTGGG + Intronic
907627020 1:56040363-56040385 CTGGAGCCCCCTTCGGGCCTTGG - Intergenic
910244289 1:85122286-85122308 CAGGACCCTCCTTTGGGGCTAGG + Intronic
910978773 1:92937533-92937555 TTTCAGCCTCCTTTTGGGCTAGG + Intronic
911401978 1:97386456-97386478 TTGCAGCCACTTTTAAGGCTGGG + Intronic
912664560 1:111567544-111567566 ATACAGTTACCTTTGGGGCTAGG - Intronic
913053930 1:115140241-115140263 CTGCAGCCTGCTTGCGGGCTTGG + Intergenic
913147978 1:116011118-116011140 CAGCAGCCAGCTGAGGGGCTAGG + Intronic
914937639 1:151994208-151994230 CTGCGGCCACCTACGGGTCTAGG + Exonic
915316787 1:155033296-155033318 TTGCTGCCATGTTTGGGGCTGGG - Intronic
915475950 1:156152978-156153000 GAGCAGCCACCTTTGGGGGTTGG + Intronic
915890647 1:159770336-159770358 CTGCATCCAGCTTGGGGACTGGG + Intergenic
916145542 1:161735836-161735858 CTGCAGCCCCCTGAGGAGCTGGG - Intergenic
916291983 1:163176975-163176997 CAGCAGCCACCTTTGGAGCATGG - Intronic
918177691 1:182059998-182060020 CTGAAGCCTGCTCTGGGGCTGGG + Intronic
918211949 1:182359016-182359038 CTTCAGCCACCTGAGGAGCTAGG + Intergenic
919966245 1:202528664-202528686 CTTCAGCCAGCTATGGGGATGGG - Intronic
920106789 1:203559121-203559143 CTGCAGCCATCTCTGAGGCCAGG + Intergenic
920598830 1:207301895-207301917 CAGTACCCACCTTTGGGGTTTGG - Intergenic
922558371 1:226549598-226549620 CTGCAGCCCCCTTTGGTTCGCGG + Intronic
923229509 1:231971616-231971638 CTGCAGACACTTTAGGTGCTGGG + Intronic
923546644 1:234928177-234928199 ATCCTGCCACCTTGGGGGCTGGG - Intergenic
1063138879 10:3239450-3239472 CTGCAGCCACGATGGGTGCTGGG + Intergenic
1063745756 10:8878875-8878897 CCTCAGCCTCCTTAGGGGCTGGG - Intergenic
1067082563 10:43219755-43219777 CTACAGCCACCTAGGGTGCTGGG + Intronic
1067436861 10:46284670-46284692 CTGCACCCGCCTTCGGGGCGGGG + Intergenic
1067800440 10:49354744-49354766 CTGCAGCCACCTTGGGGCACAGG + Intergenic
1068531983 10:58199380-58199402 CTTTAGCCACCCTTGTGGCTGGG - Intronic
1068533008 10:58210100-58210122 CTGCAGCCACTGTGGGGGATGGG + Intronic
1068912896 10:62397621-62397643 CTGCATGCACTTTTGTGGCTGGG - Intronic
1069905747 10:71731104-71731126 CTGTGGCCGCCTCTGGGGCTTGG - Intronic
1070824625 10:79384113-79384135 AGCCAGCCACCTTGGGGGCTGGG - Exonic
1070979427 10:80632638-80632660 CTGCAGCCTCTTTTAGGGCCCGG + Intronic
1073452362 10:103617466-103617488 CTGCTGCCACCTCTGGGGCCTGG - Intronic
1074391820 10:113064265-113064287 CTGCAGCCACCATTTGGGCCTGG - Intronic
1074442051 10:113486605-113486627 ATGCAGGCAACTGTGGGGCTAGG - Intergenic
1074681632 10:115913315-115913337 TTGGAGCCACCTTTGGGGGCTGG - Intronic
1075323678 10:121512643-121512665 CTTCAGCCTCCTGTGGAGCTAGG + Intronic
1075649025 10:124115510-124115532 CTGAGGCCACCTCTGTGGCTGGG - Intergenic
1075846962 10:125552529-125552551 CTGCATGCTCCTTGGGGGCTGGG - Intergenic
1077177186 11:1196272-1196294 CCGCAGCCACCTGTGGGCCTGGG - Intronic
1077266239 11:1652084-1652106 CTGAAGCCACCTTGGAGCCTGGG + Intergenic
1077404466 11:2377053-2377075 CTGCCACCCCCTTGGGGGCTCGG + Intronic
1077467298 11:2739447-2739469 GTCCATCCACCTTTGGGGGTGGG - Intronic
1078587971 11:12610479-12610501 CTGCGGCCACTTTGGGGGATGGG - Intergenic
1079444191 11:20545101-20545123 CTGCAGCCTGCATTGGGCCTGGG - Intergenic
1083246111 11:61429634-61429656 CCGGAGCCGCCTTGGGGGCTAGG - Intronic
1083333745 11:61911291-61911313 CTCCTGCCACCTTTGGCGTTGGG - Intronic
1084505991 11:69568370-69568392 CTGCAGGCACCTTTGATGTTGGG - Intergenic
1084884713 11:72196092-72196114 CTGCAGCCATGAGTGGGGCTGGG + Exonic
1085515309 11:77108171-77108193 CTCCAGCCAGCTTTGGAGCTGGG + Intronic
1089573324 11:119423779-119423801 CTGCAGCCCCCTGAAGGGCTGGG - Exonic
1089660232 11:119980887-119980909 CTGCAGCCACCTCTGGGGTGGGG - Intergenic
1090836516 11:130458126-130458148 CCGCAGCCGCCTCTGTGGCTGGG - Intronic
1093067716 12:14675934-14675956 CTGCATCCTCTTTTGGAGCTGGG - Intronic
1094650581 12:32371986-32372008 GTGCAGCCACCTGTGGTGGTAGG - Intronic
1094781303 12:33795195-33795217 CTGCTGGCACATTTGGGGGTGGG - Intergenic
1095225797 12:39675239-39675261 CTGCAGCCACTGTGGGGGATGGG - Intronic
1095435313 12:42180471-42180493 CTGCAGTCAGCGTTGTGGCTGGG - Intronic
1097256186 12:57676396-57676418 CAGCTACCACCTTTGGAGCTGGG + Intergenic
1100585473 12:95975674-95975696 CTGCTGCCAACTTTGGTGCTAGG - Intronic
1101432103 12:104635156-104635178 CTGGGGTCACCTTTGGAGCTTGG - Intronic
1101509384 12:105379328-105379350 CTCCAGCCATCTTTTGGCCTTGG + Intronic
1102790296 12:115639110-115639132 CTGCAGCTACCTATAGGGATTGG - Intergenic
1103727859 12:123007647-123007669 CTGAGGCCACCCCTGGGGCTTGG - Intronic
1103929991 12:124445043-124445065 CTGCTGCCTCATTTGGGGGTCGG - Intronic
1103933360 12:124462372-124462394 CTGCAGCCAGCGGAGGGGCTTGG - Intronic
1105378444 13:19864542-19864564 CTGCAGGCTCCCTTGGAGCTGGG + Intergenic
1105656865 13:22451334-22451356 CTGCAGCCCTCCTTAGGGCTGGG - Intergenic
1106144575 13:27039822-27039844 TTGCCTCCACCTTTGGGACTGGG - Intergenic
1106250502 13:27978564-27978586 CCGCAGCCTTCTTTGGGGCCGGG - Intronic
1106699248 13:32211341-32211363 CTGCAGCCTCCTGAGGAGCTGGG - Intronic
1107549018 13:41457902-41457924 CTGCAGCCTCCTTTCCGGCCCGG + Intronic
1107832956 13:44390584-44390606 CTGCAGCCTCCTTTGTGCCCTGG + Intronic
1107893014 13:44930647-44930669 CAGCAATCACCCTTGGGGCTGGG - Intergenic
1108722183 13:53143433-53143455 CTGCAGCCATCTCTAGTGCTGGG - Intergenic
1110038420 13:70718256-70718278 CTGCAGCAAACTTTTGCGCTGGG - Intergenic
1113093660 13:106640239-106640261 CTGCAGCCTCCTGTGTAGCTGGG + Intergenic
1113294045 13:108938533-108938555 CTGCAGAGAACTTGGGGGCTAGG - Intronic
1113890142 13:113731368-113731390 CTGCAGCCACCTTGGCGCCCTGG + Intronic
1114550751 14:23531569-23531591 CTGCAGACGCCTCTGGGCCTGGG + Exonic
1116706408 14:48307808-48307830 CTGCAGAAACATTTGGGGCTGGG + Intergenic
1117338344 14:54773763-54773785 CTGATGCCACCTGTGGGGCGAGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1122072224 14:99212334-99212356 CTGCAGCCTCCCCTGGGCCTGGG + Intronic
1122128912 14:99593829-99593851 CTGCACCCATCTCTGGGGCTGGG + Intronic
1122278753 14:100609353-100609375 CTGCAGGCCCCTTCAGGGCTGGG - Intergenic
1122705548 14:103618669-103618691 CTTCAGCCTCCTTAGGAGCTGGG - Intronic
1123053878 14:105560235-105560257 CTGCAGCCTCCTGTGGGGCCGGG + Intergenic
1123078461 14:105680652-105680674 CTGCAGCCTCCTGTGGGGCCGGG + Intergenic
1123144342 14:106113691-106113713 CTTCAGCTACCTTAGGTGCTGGG + Intergenic
1123705904 15:22951124-22951146 CTCCAGCCGCCATTGGGGATTGG - Intronic
1124556466 15:30730519-30730541 CTGCAGCCATCTTGGGTGCTTGG - Intronic
1124674811 15:31675225-31675247 CTGCAGCCATCTTGGGTGCTTGG + Intronic
1125656487 15:41361899-41361921 CTCCTGGCACATTTGGGGCTTGG + Intronic
1129178490 15:73856855-73856877 CTGAAGCCGGCTTTGGGGCTGGG + Intergenic
1131033929 15:89208763-89208785 CTGCACCTACCTTTTGGGCCAGG - Intergenic
1131505415 15:93013817-93013839 CTTCAGCCTCCTGAGGGGCTGGG - Intronic
1132939575 16:2500153-2500175 CTGCACCCACCTTGGGCTCTGGG + Intronic
1132986225 16:2769012-2769034 GAACAGCCTCCTTTGGGGCTGGG - Exonic
1133200362 16:4200495-4200517 CTGCACTCACCTTTTGGGCTTGG - Intronic
1133723546 16:8516995-8517017 CTGGAACCATCTTTGTGGCTGGG + Intergenic
1133855782 16:9547956-9547978 CTGCAGCTAGGTCTGGGGCTGGG + Intergenic
1134243475 16:12522924-12522946 CTGCAGCCACCCATGTAGCTGGG + Intronic
1136313475 16:29432401-29432423 TAACAGCCTCCTTTGGGGCTGGG - Intergenic
1136326917 16:29534167-29534189 TAACAGCCTCCTTTGGGGCTGGG - Intergenic
1136376506 16:29868691-29868713 CTGCCACCACCATTGGGGATGGG + Intergenic
1136441608 16:30274151-30274173 TAACAGCCTCCTTTGGGGCTGGG - Intergenic
1137682778 16:50365219-50365241 CTGGAGCCAACTATGGGGCAGGG - Intronic
1138001059 16:53280371-53280393 TTGCAGCAACCTTGGGGGATAGG + Intronic
1138346774 16:56325034-56325056 CTGCAGGCATCCTTGGGGATGGG - Intronic
1139392864 16:66616521-66616543 AGGCAGCCCCCTTTGGGCCTGGG + Exonic
1139871673 16:70113450-70113472 CTGCAGCCACCATTGCATCTTGG - Intergenic
1139888399 16:70227885-70227907 TAACAGCCTCCTTTGGGGCTGGG - Intergenic
1139911412 16:70399605-70399627 CTCCTGCTAGCTTTGGGGCTTGG - Exonic
1140364262 16:74369033-74369055 CTGCAGCCACCATTGCATCTTGG + Intergenic
1142274228 16:89107816-89107838 ATGCAGCCACATTTGGGGCTGGG - Intronic
1143514859 17:7414502-7414524 GGGCAGCCAACTCTGGGGCTCGG + Intronic
1143516683 17:7422764-7422786 CTGCAGCCACCGGTGAGGCCTGG + Intergenic
1144780931 17:17808084-17808106 CTCCAGCTACTTTTGGGTCTGGG + Intronic
1146472372 17:33134810-33134832 GTGGAGCAACCTTTGGGGCAGGG - Intronic
1147462154 17:40580004-40580026 CTGCAGCCATATTGGGGGTTAGG + Intergenic
1147649096 17:42051777-42051799 CAGCAGCCACTGGTGGGGCTGGG - Intronic
1147988642 17:44320427-44320449 CTGCAGCCACCTGGTGGGGTGGG + Exonic
1148560360 17:48602509-48602531 CAGCCGCCAGGTTTGGGGCTAGG + Intronic
1148901965 17:50885045-50885067 CAGCATCCACCTTTGAGGCTGGG - Intergenic
1148978273 17:51548447-51548469 CAGCAGGCACCTTTGGGGACTGG + Intergenic
1149557942 17:57587563-57587585 CTGCAGCCACCTTTGGGGCTGGG - Intronic
1149659761 17:58328066-58328088 CTGCAGCCTCCTTTGTGGGTGGG - Exonic
1150226865 17:63529164-63529186 CTGCAGCCCCCTTTGGTGGATGG - Intronic
1151200155 17:72462001-72462023 ATGCAGCCTCCCTTGGGGCAGGG - Intergenic
1152521215 17:80858063-80858085 CGGCAGCCACCTCTGGGTCGTGG + Intronic
1153595642 18:6722547-6722569 CTTCAGCCTCCTGTGTGGCTGGG + Intergenic
1155120843 18:22816926-22816948 CTGCAGCCACAATTCGGGCAGGG + Intronic
1155130526 18:22930269-22930291 GTGCTGCCACCTTCAGGGCTAGG - Intronic
1155886721 18:31217382-31217404 CTGCAGCCACGATGGGGGATGGG - Intergenic
1156588068 18:38454884-38454906 CTCCAGAGACCTTTGGGGATTGG - Intergenic
1157304801 18:46509166-46509188 CTGAAGCCAGCCTTGGGGATGGG - Intronic
1157672123 18:49539566-49539588 CTGCAGCCTCCTAAGGTGCTGGG + Intergenic
1160144179 18:76350357-76350379 CTGGGGCCACCTGTGGGGCCTGG - Intergenic
1160853313 19:1205321-1205343 CCGCATCCCCCTTTGGGGCGAGG - Intronic
1161272422 19:3397437-3397459 CTGCAGCCAGGCTGGGGGCTGGG + Intronic
1162015719 19:7845534-7845556 CCACAGCCACCCTTGAGGCTAGG + Intronic
1162034334 19:7931302-7931324 CGGCTGCCACCTGTGGGGCGCGG + Intronic
1162826033 19:13252871-13252893 CTGAAGCCACCCTTGAGGTTGGG + Intronic
1163657119 19:18553264-18553286 CAGCCTCCACCTTTGGGACTCGG + Intergenic
1163953660 19:20614060-20614082 CTGCAGCCAGCGGTGGGTCTGGG - Intronic
1164859869 19:31554440-31554462 CTGCAGCGACTCTTGGGGTTGGG + Intergenic
1165000709 19:32759501-32759523 CCGCAGCCTCCTTTGAGGCCAGG - Intronic
1165105988 19:33469952-33469974 CTGCACCCACCTGTGGGTCCTGG + Intronic
1165858051 19:38891868-38891890 CTGCAGCCATCTTTTAGCCTGGG - Intronic
1166531299 19:43545106-43545128 CTGATGCCACTTTAGGGGCTTGG + Intronic
1167658621 19:50782726-50782748 CTGAACCCACAGTTGGGGCTTGG - Intergenic
1168320219 19:55504614-55504636 CTGCAGCCTCCTGTGTAGCTGGG + Intronic
925132225 2:1502147-1502169 CTGCAGCCGCCTCTGGGGTAGGG - Intronic
925689281 2:6504873-6504895 TTGCAGCCACCTATGGAGATGGG - Intergenic
926105283 2:10146014-10146036 CTGCAGCCACCTCTGACTCTCGG - Intronic
927304992 2:21560648-21560670 CCGCAGCCATCTTTGGTGTTGGG + Intergenic
927871782 2:26628665-26628687 CTGCAGCCACTCCTGGAGCTGGG + Intronic
929577274 2:43059827-43059849 CTGCTGCCAGCTCTGGGCCTAGG - Intergenic
929633235 2:43488126-43488148 ATGCAGTCACCTTTGGAGGTTGG - Intronic
930018897 2:46989088-46989110 CTGCTGCCACCTAGGGGACTGGG + Intronic
930773947 2:55154627-55154649 CTGCAGCCACCTTTTCTGCTAGG + Intergenic
932323257 2:70837482-70837504 CTACTGCCACCTTTGGTACTTGG + Intergenic
932519798 2:72398579-72398601 CTGCAGCCACCTAAGTAGCTGGG - Intronic
932689017 2:73896730-73896752 TTCTGGCCACCTTTGGGGCTAGG + Exonic
933741474 2:85538012-85538034 CTGCAGCCTGTTCTGGGGCTGGG - Intergenic
933967510 2:87442108-87442130 CTGCAGGGAGCTTTGGGGTTGGG + Intergenic
934648461 2:96073025-96073047 CTGCAGCCTCCTCTGGGGGAAGG - Intergenic
935809549 2:106783836-106783858 CAGCAGTCAGCTGTGGGGCTTGG - Intergenic
936326285 2:111508388-111508410 CTGCAGGGAGCTTTGGGGTTGGG - Intergenic
937322025 2:120966655-120966677 TTGCAGCCAAGCTTGGGGCTGGG + Intronic
938383008 2:130847151-130847173 GTGCAGCCGGCTTTGGGGCCAGG - Intronic
938854875 2:135299176-135299198 CTGCATCCACTGTGGGGGCTTGG + Intronic
941624419 2:167815055-167815077 CTGCAGGGAGCTCTGGGGCTGGG - Intergenic
945132567 2:206589395-206589417 CTGCAGCCTCTTTTGGAGATAGG - Exonic
945285572 2:208078274-208078296 CCGCAGCCACCTTGGGGGAGGGG - Intergenic
946116581 2:217468011-217468033 CTGCAGCCAGCTTTAGAGGTAGG - Intronic
946366297 2:219251161-219251183 CTGTAGACACCTGGGGGGCTGGG + Exonic
946369374 2:219271306-219271328 CTGTAGACACCTGGGGGGCTGGG - Intronic
948201229 2:236130911-236130933 CTGCTGGGACCCTTGGGGCTGGG - Exonic
948600969 2:239107287-239107309 CTGCAGCCAGATTCGGGGCAGGG + Intronic
949052396 2:241904115-241904137 CTGGAGCCATATCTGGGGCTGGG + Intergenic
1171018116 20:21560243-21560265 CTGCAGCCCCTGGTGGGGCTGGG + Intergenic
1172407857 20:34702866-34702888 CTCCGGCCTCCTTTTGGGCTAGG + Intronic
1175069692 20:56322782-56322804 CTCCAGGCACCACTGGGGCTGGG + Intergenic
1176244753 20:64092092-64092114 CTGCAACCTCCTTGGGAGCTGGG - Exonic
1177794428 21:25758727-25758749 ATGCAGCCACCTTTTGGCATTGG + Intronic
1179443052 21:41409109-41409131 CTCCAGCCACCTGAGTGGCTGGG - Intronic
1179916056 21:44479006-44479028 CTGCAGCCTGCCTTTGGGCTTGG - Intergenic
1180987408 22:19912992-19913014 CTGCAGCCTACTTAGAGGCTTGG + Intronic
1182712615 22:32332106-32332128 CTGCAGCCATGTCTGCGGCTTGG - Intergenic
1183512283 22:38243288-38243310 CTGCTGCCGCCTCTGGGGCACGG + Intronic
1184032219 22:41901825-41901847 TTGCAGCCACCCTTTGGACTGGG + Intronic
1184171761 22:42764293-42764315 CTGCAGCCAGGTGTGGGGGTGGG - Intergenic
1184230817 22:43157411-43157433 TTGCAGCGACCTTGGGGGATGGG + Intronic
1184371452 22:44084658-44084680 CTGCAGTCATCTGTGGGGATGGG + Intronic
1184399856 22:44267488-44267510 CTGCAGCCATGTCTGTGGCTTGG - Intronic
1184762558 22:46552959-46552981 CTGGGGCCACCTTTGGAGATTGG - Intergenic
1184787539 22:46679090-46679112 CTGCAGCCGCCCCTGGGGGTGGG - Exonic
952407054 3:33014208-33014230 GTGCAGCCACCTGGGGGGCTGGG - Exonic
953418394 3:42735990-42736012 CTGCAGCCTGCTTTGGGGTGAGG - Intronic
953649224 3:44785311-44785333 CTGCAGTCACCTGTGAGCCTAGG - Intronic
954574983 3:51671071-51671093 CCGCAGCCAGCGCTGGGGCTAGG + Intronic
954712733 3:52513060-52513082 TTACAGAGACCTTTGGGGCTGGG - Intronic
955784458 3:62522250-62522272 CTGCAGCCTCCTGAGAGGCTGGG + Intronic
956012699 3:64848600-64848622 CTTCAGCCACCTGAGGTGCTAGG - Intergenic
956134071 3:66081840-66081862 CTGCATCCTCATGTGGGGCTTGG - Intergenic
956959631 3:74383599-74383621 CTGCAGCCACCTGAGTAGCTGGG + Intronic
959727535 3:109560990-109561012 CTGCAGCCACTGTGGGGGATGGG + Intergenic
961108201 3:124260315-124260337 GTGCTGCCACATTTGGGCCTGGG - Intronic
961529215 3:127529677-127529699 CAGCAGCCTCCTTTGAGGCCCGG - Intergenic
963936628 3:151060492-151060514 CTGCAGCCACGTTAGGGAGTGGG - Intergenic
967641393 3:191868812-191868834 GTACAGCCACCTTCGGGGCTGGG + Intergenic
968612574 4:1563882-1563904 CTGCCTCCACCGTAGGGGCTGGG - Intergenic
968645314 4:1737736-1737758 CTGCAGGCCGCTCTGGGGCTTGG + Intronic
968727378 4:2254041-2254063 CTGCAGCCACCACTGGGACGAGG + Intronic
970170473 4:13284307-13284329 CTGTAGCCACCTCAGGGGCTTGG - Intergenic
974028838 4:56757613-56757635 CTGGTGCCACCTGTGGGGCGTGG - Intergenic
974375934 4:61075625-61075647 CTTCAGCCACCTGAGTGGCTGGG - Intergenic
978083435 4:104621535-104621557 GTGCAGCCAGCCTTGGGACTTGG - Intergenic
978179534 4:105776198-105776220 CTGAAGGCAACTTTGGAGCTTGG - Intronic
979434605 4:120673703-120673725 CTGCAGCCACTGTGGGGGATGGG - Intergenic
979444855 4:120800399-120800421 CTTCAGCCTCCTTTGTAGCTGGG - Intronic
980853842 4:138415337-138415359 ATGCAGCCTCCTTTGGGAGTAGG + Intergenic
981616494 4:146648845-146648867 CTACAGCCAATTCTGGGGCTGGG - Intergenic
982228173 4:153184468-153184490 ATACAGCCACATTGGGGGCTAGG + Intronic
989460740 5:41696045-41696067 CTGCTTCCTCCTGTGGGGCTGGG + Intergenic
990400362 5:55431348-55431370 CAGCAGCCACCTTACAGGCTAGG + Intronic
990404241 5:55472004-55472026 CTTCAGCCACCTGAGGAGCTGGG - Intronic
992744700 5:79807576-79807598 AGGCACCCACATTTGGGGCTGGG + Intergenic
992775497 5:80085288-80085310 CTTCAGCCACCTGAGGAGCTGGG - Intergenic
994465995 5:100131820-100131842 CTGCAGCCACTTTTTGCTCTAGG - Intergenic
995138419 5:108705521-108705543 CTGCAGCCACCATTGCCACTAGG + Intergenic
995447191 5:112258302-112258324 CTGCAGCTACATTTGGGGTATGG - Intronic
997613318 5:135230140-135230162 CTGCAGCCACACCTGGGGCCTGG - Intronic
997724003 5:136105273-136105295 CAGCAGAGACCTTTGGGACTGGG + Intergenic
998020053 5:138761869-138761891 CCGCAGCCTCCTATGGAGCTGGG + Intronic
998918648 5:147043275-147043297 ATGCAGCCACATTGGGGGTTGGG - Intronic
998931597 5:147187463-147187485 CTGCAGCCTCCCCTGGGGGTGGG + Intergenic
999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG + Intronic
999499954 5:152136977-152136999 CAGCAGCCACCTCTGGAGCAGGG - Intergenic
1001036406 5:168299895-168299917 CTCCAGCCACATGTGGTGCTAGG + Intronic
1001277809 5:170363322-170363344 ATACAGCCACCTTGGGGGTTAGG - Intronic
1001407919 5:171488907-171488929 CTGCAGGTACCTGTGGGGCGGGG + Intergenic
1001801778 5:174550654-174550676 CTGCAGCAACCTGGGAGGCTTGG + Intergenic
1002322161 5:178382591-178382613 CTCCACCCACCTTTGGTGCTGGG - Intronic
1002560268 5:180076917-180076939 CTGCAGCCACAGCTGGGGGTGGG - Intergenic
1002851505 6:1000887-1000909 CTGCAGCCACCTCTGTGTCTTGG + Intergenic
1004368988 6:15036063-15036085 CTTCAGCCTCCTATGTGGCTGGG - Intergenic
1005035282 6:21550580-21550602 CTGCAGCCTCCTGAGTGGCTGGG - Intergenic
1005259473 6:24042695-24042717 CTGCAGCCACTGTGGGGGCTGGG + Intergenic
1006735041 6:36267591-36267613 CTTCAGGCACCTGGGGGGCTGGG - Intronic
1006774331 6:36580322-36580344 CTGCAGCCTCCCTTATGGCTGGG + Intergenic
1007851972 6:44811804-44811826 TTGCAGCCACTTTTGGCACTTGG + Intronic
1013841710 6:114404005-114404027 CTGCAGCCAACCTTGAGACTGGG - Intergenic
1014258673 6:119190248-119190270 CTTCATCCACCTTAGGGCCTGGG - Intronic
1014625596 6:123721018-123721040 CTGTAGCCACCTTAGGGCTTTGG + Intergenic
1014750074 6:125245583-125245605 CTGCAGCCACTGTGGGGGTTGGG + Intronic
1015268632 6:131316136-131316158 CTTCAGCCCCCTTAGGAGCTGGG + Intergenic
1016050720 6:139527395-139527417 ATTCAGCACCCTTTGGGGCTGGG - Intergenic
1017034574 6:150255810-150255832 CTGCAGTCTCCTGTGGGCCTGGG - Intergenic
1017576636 6:155812694-155812716 CTGCAGGCACCTTTGGAAATGGG - Intergenic
1018537386 6:164835965-164835987 ATGCTATCACCTTTGGGGCTAGG + Intergenic
1019013551 6:168862681-168862703 AAGCTACCACCTTTGGGGCTTGG - Intergenic
1019257902 7:63379-63401 CTGGAGCTACCCTGGGGGCTGGG + Intergenic
1021340527 7:19458021-19458043 CTGCAGCCACCATTGAGCCATGG - Intergenic
1022091151 7:27108805-27108827 ATGCAGGAACCTTTGGGGCCTGG - Intronic
1022184368 7:27952667-27952689 CTGCAACCAGCTATAGGGCTGGG + Intronic
1022727624 7:32995462-32995484 CTGCAGCAACCTTATGGGGTAGG - Intronic
1023286728 7:38629178-38629200 CAGCAGCCTCCATTTGGGCTGGG + Intronic
1023725118 7:43135379-43135401 CAGCAGCCACCTTGGAAGCTGGG + Intronic
1025045959 7:55692179-55692201 CTGCAGCAACCTTATGGGGTAGG + Intergenic
1026099878 7:67375986-67376008 CTTCAGCCACCTTAGTAGCTGGG + Intergenic
1026851417 7:73725904-73725926 CTGCTGCCACCTTCTGGGCAGGG + Intergenic
1027468105 7:78540253-78540275 CTGTAGCCACTGTTGGGGATGGG + Intronic
1027698588 7:81440699-81440721 CAGCAGTTACCTTTGGGACTTGG + Intergenic
1029909875 7:104134297-104134319 CTTCAGCCTCCTGTGTGGCTGGG - Intronic
1030086168 7:105817687-105817709 CTGGAGCAACATTTGAGGCTGGG + Intronic
1030322288 7:108181920-108181942 CAGGAGCCACCATTGGGACTAGG + Exonic
1031993521 7:128212971-128212993 CTCCAGCCACCCTTGGCACTGGG - Intergenic
1032097597 7:128947346-128947368 CTGCAGCCGCCCGTGGTGCTGGG + Exonic
1032193141 7:129775712-129775734 CTGCAGCCACCCAGGTGGCTTGG + Intergenic
1035373150 7:158391970-158391992 CTGAAGCCACCCTGGGGGCCTGG - Intronic
1035436705 7:158864929-158864951 CTGCAGCCACCTGTGGGCAGTGG - Intronic
1036657707 8:10688553-10688575 CAGCAGCCACCATTGCGCCTAGG - Intronic
1037151341 8:15638639-15638661 CTGCAGCCTCCTTAGTAGCTGGG + Intronic
1037253102 8:16920006-16920028 CGGCAGGCACCAGTGGGGCTGGG + Intergenic
1040387276 8:46922044-46922066 GTGCAGAGACCTTTGGGGATGGG + Intergenic
1040919404 8:52599719-52599741 CTGAGGCCACCTTGGGGCCTGGG - Intergenic
1041763710 8:61394503-61394525 CTGCAGCCACTGTGGGGGATTGG + Intronic
1041928855 8:63266038-63266060 CTGCAGCCTGCTCTGGGGCGGGG + Intergenic
1042225478 8:66511648-66511670 CTGAAGCCAGCTTAAGGGCTGGG - Intronic
1045506837 8:102784735-102784757 GGGGAGCCACCTTTGGGGCTGGG - Intergenic
1046554814 8:115761612-115761634 CTGCAGCCACTGTTGTGGCACGG + Intronic
1048048052 8:130791773-130791795 CTGTAAACACCTGTGGGGCTCGG - Intronic
1048174898 8:132142797-132142819 CTGCTGCTACCTTTGAAGCTGGG + Intronic
1049542729 8:143215780-143215802 CTGCAGCCCTCATGGGGGCTGGG + Intergenic
1050116100 9:2264924-2264946 ATGCAGCCACCTTCCCGGCTAGG + Intergenic
1050462178 9:5886276-5886298 CTGCTGCCACCTAGTGGGCTTGG - Intronic
1053148732 9:35729743-35729765 CAGCAGCCACTTTAGCGGCTGGG + Intronic
1053474046 9:38369364-38369386 ATGCAGCCAGGTTTGGGGATGGG - Intergenic
1055052703 9:71996016-71996038 CTGCAGCCACCTTTAATGCAGGG - Intergenic
1055619842 9:78113484-78113506 CTTCAGCCACCCATGTGGCTGGG + Intergenic
1056818336 9:89817768-89817790 CTGGAGCCAACTTTGAGGCCAGG + Intergenic
1057356924 9:94339666-94339688 CTGAAGCCACCCTTGCGCCTCGG - Intergenic
1057650828 9:96917973-96917995 CTGAAGCCACCCTTGCGCCTCGG + Intronic
1057883276 9:98808821-98808843 CTGCTGCCACCTTTGCCGCTGGG + Intronic
1057995753 9:99820706-99820728 CAGCAGCAACCTTTGGGACTAGG + Intergenic
1058161504 9:101574947-101574969 CTGTAGCCAACTTTGGGGGATGG - Intronic
1058383266 9:104403331-104403353 ATACAGCCACATTAGGGGCTAGG + Intergenic
1058907291 9:109492160-109492182 CGCCAGCCACCATTGGGCCTGGG - Intronic
1059234417 9:112750424-112750446 CAGCAGCCACGCTTGGGGCTGGG - Intergenic
1060743738 9:126116496-126116518 CTGCCCCCACCTGAGGGGCTTGG + Intergenic
1060779216 9:126399405-126399427 CTGTGGCCCTCTTTGGGGCTGGG + Intronic
1061759221 9:132838447-132838469 GTACAGTCACTTTTGGGGCTGGG + Intronic
1062290327 9:135791538-135791560 CCGCACCCACCTCTGGTGCTAGG - Intronic
1062436789 9:136549963-136549985 CTGCAGGCACCCCTGGGCCTGGG - Intergenic
1190596761 X:52059672-52059694 CTGCCCCCACCTCTCGGGCTTGG + Intergenic
1190612063 X:52194401-52194423 CTGCCCCCACCTCTCGGGCTTGG - Intergenic
1190928448 X:54928957-54928979 CTGAAGCCACCACTGGAGCTGGG - Exonic
1191688947 X:63920502-63920524 CTGCAGTCTCCTTAGGGGATGGG + Intergenic
1191713561 X:64178088-64178110 CTGGTTCCACCTTTGGGGCTGGG - Intergenic
1191879314 X:65828628-65828650 CTGCAGCCACTATGGGGGATGGG - Intergenic
1192594170 X:72388688-72388710 ATGCAGCCACATTAGGGGTTAGG - Intronic
1193690402 X:84634622-84634644 CTGCAGCCTCTGTTGGGGATAGG - Intergenic
1196734911 X:118974888-118974910 CTGCAGCCACCTTTGGGTGGGGG - Exonic
1196971184 X:121110132-121110154 CTGCAGCCACTGTGGGGGATGGG - Intergenic
1197494703 X:127163652-127163674 CTTCAGCCACCTGAGTGGCTGGG + Intergenic
1200309667 X:155065305-155065327 GTGCACCCACCCTTGGGCCTGGG - Exonic
1202301864 Y:23424453-23424475 CTTCAGCCAGCTATGGGGATGGG - Intergenic
1202568947 Y:26246145-26246167 CTTCAGCCAGCTATGGGGATGGG + Intergenic