ID: 1149558380

View in Genome Browser
Species Human (GRCh38)
Location 17:57590696-57590718
Sequence CTGGAGCCCCTTGGAAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 201}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149558373_1149558380 4 Left 1149558373 17:57590669-57590691 CCTTCTTTGTCCCCGCTTTGCTG 0: 1
1: 0
2: 1
3: 28
4: 204
Right 1149558380 17:57590696-57590718 CTGGAGCCCCTTGGAAGTGTGGG 0: 1
1: 0
2: 2
3: 15
4: 201
1149558377_1149558380 -8 Left 1149558377 17:57590681-57590703 CCGCTTTGCTGACTACTGGAGCC 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1149558380 17:57590696-57590718 CTGGAGCCCCTTGGAAGTGTGGG 0: 1
1: 0
2: 2
3: 15
4: 201
1149558371_1149558380 10 Left 1149558371 17:57590663-57590685 CCACCACCTTCTTTGTCCCCGCT 0: 1
1: 0
2: 1
3: 29
4: 322
Right 1149558380 17:57590696-57590718 CTGGAGCCCCTTGGAAGTGTGGG 0: 1
1: 0
2: 2
3: 15
4: 201
1149558375_1149558380 -6 Left 1149558375 17:57590679-57590701 CCCCGCTTTGCTGACTACTGGAG 0: 1
1: 0
2: 1
3: 13
4: 90
Right 1149558380 17:57590696-57590718 CTGGAGCCCCTTGGAAGTGTGGG 0: 1
1: 0
2: 2
3: 15
4: 201
1149558370_1149558380 11 Left 1149558370 17:57590662-57590684 CCCACCACCTTCTTTGTCCCCGC 0: 1
1: 0
2: 1
3: 14
4: 191
Right 1149558380 17:57590696-57590718 CTGGAGCCCCTTGGAAGTGTGGG 0: 1
1: 0
2: 2
3: 15
4: 201
1149558376_1149558380 -7 Left 1149558376 17:57590680-57590702 CCCGCTTTGCTGACTACTGGAGC 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1149558380 17:57590696-57590718 CTGGAGCCCCTTGGAAGTGTGGG 0: 1
1: 0
2: 2
3: 15
4: 201
1149558372_1149558380 7 Left 1149558372 17:57590666-57590688 CCACCTTCTTTGTCCCCGCTTTG 0: 1
1: 0
2: 0
3: 19
4: 221
Right 1149558380 17:57590696-57590718 CTGGAGCCCCTTGGAAGTGTGGG 0: 1
1: 0
2: 2
3: 15
4: 201
1149558369_1149558380 15 Left 1149558369 17:57590658-57590680 CCTTCCCACCACCTTCTTTGTCC 0: 1
1: 0
2: 5
3: 79
4: 587
Right 1149558380 17:57590696-57590718 CTGGAGCCCCTTGGAAGTGTGGG 0: 1
1: 0
2: 2
3: 15
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149558380 Original CRISPR CTGGAGCCCCTTGGAAGTGT GGG Intronic
900239778 1:1610434-1610456 CTTGAGCCACGTGGAACTGTGGG + Intergenic
900913569 1:5619005-5619027 CTTGAGGCCCTTGGAAGGTTTGG + Intergenic
901066438 1:6496882-6496904 CGGGACCCCCTGGGAAGTCTGGG - Intronic
901232058 1:7646822-7646844 GTGGAGGCCCTGGCAAGTGTGGG + Intronic
903190991 1:21655924-21655946 TTGGAGGCCCTGGCAAGTGTTGG - Intronic
903226406 1:21896375-21896397 CTGGGTCCCCCTGGAAGTGAGGG - Intronic
903438748 1:23371297-23371319 CTGGAGCCCCTGGGGGGAGTGGG + Exonic
903753551 1:25645251-25645273 CTGGAGCTCCTTGGCAGAGGTGG - Intronic
904774909 1:32900834-32900856 TGGGAGCCCCTTGTAAGGGTGGG + Intronic
907865541 1:58396236-58396258 CTGGAGCCCCTGGGAATGGCTGG - Intronic
913609184 1:120493702-120493724 CTGGAGACCCATGGATGTGTAGG - Intergenic
914582008 1:149028137-149028159 CTGGAGACCCATGGATGCGTAGG + Intronic
918217799 1:182408071-182408093 CTGGGGCCCCTTGGGACTGTGGG - Intergenic
919781080 1:201221624-201221646 CCGAAGCCCCTTGGCCGTGTAGG - Exonic
919855569 1:201703999-201704021 CTGGAGCCTCTTGGAAACTTTGG + Intronic
920498173 1:206470110-206470132 CAGGAACCCCAAGGAAGTGTGGG - Intergenic
920795729 1:209134288-209134310 CTGGAGCCCCATTGAAGTGGTGG - Intergenic
922215388 1:223516059-223516081 CAGGAGCCCCGAGGCAGTGTGGG - Intergenic
1063285730 10:4685743-4685765 CTGGACTACTTTGGAAGTGTTGG + Intergenic
1064096991 10:12431265-12431287 CTGCTGCCCCTTGGAAGCCTGGG + Intronic
1067534018 10:47094908-47094930 CGGGAGCCCCCTGGAAGGATGGG - Intergenic
1069437852 10:68401681-68401703 CTGGGGCCCTTTGGAACTGGTGG - Exonic
1071300082 10:84249761-84249783 ATGAAGCCTCATGGAAGTGTGGG - Intronic
1072010389 10:91298348-91298370 CAGGAGCCCCTGGAAAGTGGGGG + Intergenic
1073085705 10:100887240-100887262 CTGGAACCCCTTGGCTGTCTCGG + Intergenic
1073890911 10:108099694-108099716 CTGCACCCCCATGGAAGTATGGG - Intergenic
1075441043 10:122479667-122479689 GTGGAGCACTTTGGAGGTGTGGG + Intronic
1076798507 10:132810148-132810170 CTGGAGCCACGTGGCACTGTGGG + Intronic
1077235513 11:1480269-1480291 CTGGAGACCCTGAGAAGTCTTGG - Intronic
1077370106 11:2177773-2177795 CTTGAGCCCCTTGTGTGTGTGGG + Intergenic
1079712698 11:23707184-23707206 CTGGATCCCTTTTGAACTGTTGG - Intergenic
1084454133 11:69257693-69257715 CTGCATGCCCTGGGAAGTGTGGG + Intergenic
1084496336 11:69505771-69505793 CTGGAGGCCCTTGGTGATGTGGG - Intergenic
1087007853 11:93486645-93486667 CTGTAGGCCCTGGGCAGTGTAGG - Intronic
1089773481 11:120819757-120819779 CTGGGGCCACTTTGAAGTGAGGG - Exonic
1090350884 11:126107075-126107097 CTGGAGGCTCTGGGATGTGTCGG - Intergenic
1091637221 12:2206184-2206206 CTGGAGCTCCTTAGAAGGGCCGG - Intronic
1091690616 12:2594829-2594851 CAGATGCCCCTTGGAGGTGTTGG + Intronic
1092157688 12:6295112-6295134 GTGGGGCTCCTTGGAAGGGTGGG - Intergenic
1092491403 12:8949204-8949226 ATGGAGTCCGTTGGAGGTGTTGG - Intronic
1096287784 12:50315202-50315224 CTGGAGCTGCTTGAAAGAGTAGG - Intergenic
1096799541 12:54101023-54101045 GTGGGATCCCTTGGAAGTGTGGG - Intergenic
1098860627 12:75706072-75706094 CTGGAGCTTCCTGTAAGTGTTGG - Intergenic
1098989700 12:77051301-77051323 ATGGAGCCCCTTTCAAATGTGGG - Intronic
1101253069 12:102954140-102954162 CTGAAGCCCCTTGCATGTGGAGG + Intronic
1101530179 12:105566603-105566625 GTGGAGACCCTTGGAAGCCTTGG + Intergenic
1101680266 12:106956761-106956783 CTGGAGCCCTTCGGGAGTGGGGG + Intronic
1102325262 12:111975913-111975935 CTGAAGCCCCTTTGACGTGATGG - Intronic
1103384664 12:120522766-120522788 CTTGAGCCCCTTGGCAATGCAGG + Intronic
1103990033 12:124792849-124792871 CTGTAGCCCCATGGAAATGCGGG - Intronic
1104100564 12:125604682-125604704 CAGGAGCTCCTTGGATGTGGTGG + Intronic
1105952239 13:25240025-25240047 CTGGAACCCTTTGGCATTGTTGG + Intergenic
1107191037 13:37586234-37586256 TTGGAGGCCCTTGGAAGAGACGG - Exonic
1109198734 13:59408133-59408155 CTTCAGTCCCTTGGATGTGTGGG - Intergenic
1110522841 13:76501097-76501119 CTGCAGCCTCTGAGAAGTGTGGG - Intergenic
1115760689 14:36577656-36577678 CTTGAGCCCCTTGGCAATGCGGG + Intergenic
1116013426 14:39378000-39378022 CTGGAGCCCCTTGGAAAAACTGG - Intronic
1117467574 14:56008655-56008677 CTGGGGCCTGTTGGAAGGGTGGG - Intergenic
1117978321 14:61319758-61319780 CAGGAGCCCCCTGGACGTTTGGG + Intronic
1119178715 14:72588981-72589003 CTGCAGCTCCTTCGAAGAGTTGG + Intergenic
1121577412 14:94999452-94999474 CAGGAGCCCTTTGGAAATGAAGG - Intergenic
1121736854 14:96224834-96224856 GTGGAGCCCCTTGGAATTGAGGG - Intronic
1122402381 14:101475086-101475108 CTGGTGCCTCTTGGAAGGATGGG + Intergenic
1122815573 14:104310515-104310537 TTGCAGCCCCTTGGCAGTGCTGG + Intergenic
1129570267 15:76675604-76675626 CTGGAGCTACTTTGAAGTGAAGG + Intronic
1130791857 15:87163845-87163867 CTGGAAGCCCTTGCAAGTGGAGG - Intergenic
1131943788 15:97597025-97597047 CTGGAGCCACTTGAAGGTTTAGG - Intergenic
1132063521 15:98712195-98712217 CTGGAGATACTTGGAAGTTTAGG - Intronic
1132399475 15:101496600-101496622 CTGGAACCCCGGGGAAGTGAAGG - Intronic
1132574609 16:658709-658731 CTGGAGACCCCTGCAGGTGTGGG + Intronic
1133397632 16:5461056-5461078 CAGGAGCCCCTTGGAAATGACGG - Intergenic
1133590386 16:7237104-7237126 TTGCAGCCCCTGGGAAGTTTTGG - Intronic
1134061639 16:11202845-11202867 CTGGGGCCCCGTGGGAGTGGGGG + Intergenic
1134635004 16:15785530-15785552 CTGGAGGCCCTTGGAGATCTAGG - Intronic
1134849324 16:17468140-17468162 CTGGAGCTCCATGGAAGGGCAGG + Intronic
1136395757 16:29991641-29991663 CTGGAGGCCCCTGCAAGGGTAGG + Intronic
1136511768 16:30742367-30742389 CTGGAGGCCCTTGGGAATCTGGG - Intronic
1137782911 16:51113214-51113236 TTGGTGCCCCTTGGAGGTTTGGG - Intergenic
1139269773 16:65671254-65671276 CTGGTGCTCATTGGAAGTGCTGG + Intergenic
1139567985 16:67791607-67791629 CTGGAGCCCCTGGGAGGTCTAGG - Intronic
1141224411 16:82101476-82101498 CTGGAGCTCCTTAGGAGAGTAGG + Intergenic
1141642683 16:85350444-85350466 CTGGAGCCCCATGACAGTCTAGG - Intergenic
1142217482 16:88836996-88837018 ATAGAGCCCCGTGGAGGTGTGGG - Intronic
1143242548 17:5455999-5456021 TTGGGGCCCCTTGGAAGACTCGG + Exonic
1144728251 17:17512447-17512469 CTGGAGCCCCAGGGAGGTGCAGG - Intronic
1146469309 17:33111476-33111498 CTGGAGGGGCTGGGAAGTGTTGG - Intronic
1149558380 17:57590696-57590718 CTGGAGCCCCTTGGAAGTGTGGG + Intronic
1149657161 17:58316331-58316353 CTGGAGACCTCTGGAAGTGGTGG - Intronic
1149993046 17:61393393-61393415 CTGGGGTCTCTGGGAAGTGTGGG - Intergenic
1151258868 17:72901218-72901240 CTGGAGCGCATGGGAAGTGATGG + Intronic
1151505032 17:74522029-74522051 CTGCAGCCCCTCGGAGGTGGGGG + Exonic
1156294154 18:35774698-35774720 CTGGGGCTCCTGGGGAGTGTAGG - Intergenic
1157509162 18:48256146-48256168 CTTGAGCTTCTTGGAACTGTGGG - Intronic
1161119900 19:2519780-2519802 CTGGAGACCCAGGGAAGAGTTGG - Intronic
1163298671 19:16429572-16429594 CTGGAGGCTCTTGGCTGTGTGGG - Intronic
1163723629 19:18910262-18910284 CTGGAGCCCAGTGGGAGGGTGGG - Intronic
1164544882 19:29152095-29152117 ATGGAGCCCCTGGGAATTGTGGG + Intergenic
1164712533 19:30367663-30367685 CTTTAGCCCCTGGGAAGTGCTGG + Intronic
1164792720 19:31001958-31001980 CTGCAGCCACTTCGAAGTCTGGG - Intergenic
1164826220 19:31286771-31286793 CTGGACCCTCCTGGAAGGGTAGG - Intronic
1166289528 19:41853450-41853472 CTTGAGCCCCTTCTAAGGGTGGG - Intergenic
1168355932 19:55699753-55699775 CTGGAACCCTGTGGAAGCGTGGG - Intronic
926591849 2:14749031-14749053 CTAGAGGCCATGGGAAGTGTGGG + Intergenic
927501448 2:23585940-23585962 CTGGTGGCCTTTGGAAGGGTTGG + Intronic
927808654 2:26169922-26169944 CTGGAGCTCCTGGGAAGAGGAGG + Intergenic
928050059 2:27983125-27983147 TTGGAACCCCTTGGAAGTGCTGG - Intronic
929414943 2:41737732-41737754 CCCGACCCCCTTGGATGTGTGGG + Intergenic
929954411 2:46444379-46444401 ATGGAGACCCAGGGAAGTGTGGG + Intronic
930280875 2:49368113-49368135 CTGAAGCCAATTGGAAGTGGGGG - Intergenic
930739768 2:54819289-54819311 CTGGAGTCTCTTTAAAGTGTTGG + Intronic
930919238 2:56731674-56731696 TTGGAGCTCCTTGGAAGTGTTGG - Intergenic
931248949 2:60513596-60513618 CAGCAGGCCCTTGGAAGGGTGGG - Intronic
932069432 2:68603050-68603072 GTAGATCCCTTTGGAAGTGTTGG - Intronic
932840158 2:75074386-75074408 CTGGAGCCCCTGGGTCTTGTAGG + Intronic
934989841 2:98913474-98913496 CTGGAGCCTGTGGGGAGTGTGGG + Intronic
935686663 2:105689429-105689451 CTAGGGCCTCTTGGGAGTGTGGG - Intergenic
938703402 2:133898931-133898953 CTGCAACCCCTGGGAAGTGGGGG + Intergenic
944476627 2:200113087-200113109 CTGCAGCCCCTTCCAAGTGCTGG + Intergenic
1169199747 20:3703122-3703144 GTGGAGCCCCAAGGAAGGGTTGG - Intronic
1170865311 20:20150179-20150201 CTGAAGCCACTTTGGAGTGTAGG - Intronic
1171155353 20:22867326-22867348 CTGGAGCCCTATTGAAGTGGTGG - Intergenic
1171796891 20:29573322-29573344 GTGGGATCCCTTGGAAGTGTGGG + Intergenic
1171851357 20:30310841-30310863 GTGGGATCCCTTGGAAGTGTGGG - Intergenic
1172718681 20:36983017-36983039 CTGGAGCCCCTAGGATGAATGGG + Intergenic
1172853484 20:37983477-37983499 CTGGAGCACGTTGGTCGTGTAGG + Exonic
1174413028 20:50348331-50348353 CTGGAGCCCATGGGAGGGGTGGG - Intergenic
1176214948 20:63943591-63943613 CCAGAGCTCCTTGGAGGTGTTGG + Intronic
1180631002 22:17229877-17229899 CAGCAGCGCCTTGGAAGTGAAGG - Intergenic
1180960252 22:19759277-19759299 GTGGAGCACCCTGGAAGTGCAGG - Intronic
1182563077 22:31176957-31176979 ATGGAGCCCTTTGGAAGGTTAGG + Intronic
1182934816 22:34210875-34210897 CTGGAGACCTTGGGAAGTGGAGG - Intergenic
1183647580 22:39135293-39135315 CAGGAGCCCCCTGGAGGGGTCGG - Intronic
1185075943 22:48682328-48682350 CTGCAGCCCCTTGGGTGTGGGGG - Intronic
1185199213 22:49491617-49491639 CTGGCGCCCCTTGGAAGTGCTGG + Intronic
951703834 3:25524222-25524244 CTGGAGTCCATTAGAACTGTCGG - Intronic
954150606 3:48655349-48655371 CTCAAGCCCCCTGGAACTGTGGG + Exonic
957146217 3:76427297-76427319 CTGGAGACCATAGGAAGTGGGGG + Intronic
957254305 3:77816964-77816986 CTGGTGACATTTGGAAGTGTAGG - Intergenic
957494228 3:80969736-80969758 CTCGGGCCCCTTGGAAGTCAAGG + Intergenic
957644520 3:82903470-82903492 CTTGAGCCCCTGGGAGGTGGAGG - Intergenic
961917381 3:130391434-130391456 CTTGAGAGCCTTGGCAGTGTAGG - Exonic
962834857 3:139181135-139181157 CTGGAGTCCTTGGGAAGTATGGG + Intronic
967107978 3:186269326-186269348 CTGGAGTCCCTTTGAAGTGGTGG + Intronic
972332059 4:38073230-38073252 CTGGAGCCCTTGGGCACTGTTGG - Intronic
973800191 4:54470263-54470285 TTGGAGCCCTGTGGAAGTGGTGG + Intergenic
975855838 4:78623222-78623244 CTGGAGCCCCAGGGAAGAGTTGG - Intergenic
977080680 4:92523811-92523833 TTAGAACCTCTTGGAAGTGTAGG - Intronic
978702858 4:111670257-111670279 CTGGAGCTTCCAGGAAGTGTTGG - Intergenic
980099685 4:128529231-128529253 CTGGAAGCCCTTGGATGTTTAGG - Intergenic
981764612 4:148234332-148234354 CTGGAGACCCATTGAAATGTTGG - Intronic
982803107 4:159728901-159728923 CTGGGGCCCCTAGGAATTATAGG + Intergenic
984241806 4:177227646-177227668 CAGGAGCCCACTGGAGGTGTGGG + Intergenic
985609081 5:876611-876633 AAGGAGTGCCTTGGAAGTGTCGG - Intronic
986404954 5:7416350-7416372 CTAGAGCCCCTTGGAGGGCTGGG + Intronic
986610176 5:9559180-9559202 CTGGTGCACCATGGAGGTGTTGG - Intergenic
986765780 5:10924691-10924713 CTGGAGCCCCTGGGACTTGCTGG - Intergenic
987836821 5:23172796-23172818 CTGGAGCCCATTGGGGGTATAGG - Intergenic
992271085 5:75063554-75063576 CTGGAGCCCCGAGGCAGTGCAGG + Intergenic
992808014 5:80357346-80357368 TTCGAGGCCCTTGTAAGTGTGGG - Intergenic
995496672 5:112752461-112752483 CTGCTGCACCTTGTAAGTGTGGG - Intronic
997725162 5:136114094-136114116 CAGGAGCTCCATGGATGTGTGGG + Intergenic
998907989 5:146927363-146927385 CTAGAGCCACTAGCAAGTGTTGG - Intronic
999318784 5:150600719-150600741 CTGGAGCCACTTGGAGGACTCGG - Intergenic
999632152 5:153582349-153582371 CTTGAGCCCTGTGAAAGTGTTGG + Intronic
1002213794 5:177613743-177613765 CTGGAGCCCCGTTGATGTGGTGG - Intergenic
1002438170 5:179246199-179246221 ATTGAGCTCCTTGGATGTGTAGG - Intronic
1002460751 5:179372464-179372486 CTTGAGCCCCTTGCCAGTGTGGG + Intergenic
1005042539 6:21612132-21612154 CTGGAGCCCATTGTAGATGTGGG + Intergenic
1006034525 6:31201215-31201237 CAGGAGCCTCTTGAATGTGTTGG - Intronic
1006786264 6:36669365-36669387 ATGGAGACCCTAGGAAGTGCTGG - Intergenic
1008330406 6:50238352-50238374 TTGTAGCCCCTTGGAAGCCTGGG - Intergenic
1010204537 6:73310395-73310417 CTGGAGCCCCTGGAAAGCGCTGG - Intergenic
1012277711 6:97293989-97294011 ATGGAGCCCCATGGACCTGTGGG - Intergenic
1016934164 6:149436499-149436521 CTGGAGCCACTTGGAATCCTGGG - Intergenic
1018663792 6:166114509-166114531 CTGGTGTCCCTTGGAATTTTGGG - Intergenic
1022172527 7:27843674-27843696 CTGTAGCCTCTTGGAGGTGGGGG - Intronic
1022280428 7:28903231-28903253 CTGGAGCTTCTTGGCAATGTAGG + Intergenic
1023078857 7:36508918-36508940 ATGCAGCCCCTTGGCAGTTTGGG + Intergenic
1024657645 7:51465308-51465330 CCAGAGCCCCTTGGAAGGGAGGG - Intergenic
1025257606 7:57395779-57395801 CTGGAGCCCCTGGGAGGGGCGGG + Intergenic
1029377370 7:100187600-100187622 CCTGAGCCCCTTGGCATTGTGGG + Intronic
1030097130 7:105910440-105910462 CTGGAGCCCCATGCTAGTGTTGG + Intronic
1032487240 7:132297081-132297103 CTGGACCCTCTTGGCATTGTGGG - Intronic
1033039018 7:137901529-137901551 CTGCCACCCCATGGAAGTGTGGG + Intronic
1033306471 7:140229722-140229744 GAGGAGCCCCTTTGAAGTGTGGG - Intergenic
1035251921 7:157603365-157603387 GAGGAGCCCCTGGGAAGTGAGGG + Intronic
1035303678 7:157916335-157916357 CTGGAGCCTCTGGGAGGTGTTGG + Intronic
1036631111 8:10515926-10515948 CTTGAGCACCTTGGATGTGATGG + Intergenic
1039891714 8:41690130-41690152 AAGAAGCCCCTTGGAAGTGCTGG + Intronic
1039971589 8:42325245-42325267 CTGCAGCCCCTTGGGAGTCAGGG + Intronic
1041264472 8:56051047-56051069 CTGAAGGCCCTACGAAGTGTTGG - Intergenic
1042600371 8:70493629-70493651 GTGGAGCCCACAGGAAGTGTGGG + Intergenic
1043383991 8:79730720-79730742 GTGGGTCCTCTTGGAAGTGTTGG - Intergenic
1044695473 8:94918305-94918327 CTGGAAACCCTGGGAAGTGCAGG - Intronic
1045320592 8:101079308-101079330 CTGGAGCCCCTTGCAAGGACTGG + Intergenic
1045569326 8:103353220-103353242 CTGGAGTCTGTTGGAAGTTTTGG - Intergenic
1045641965 8:104261208-104261230 CTGGAGCCGCCTTGCAGTGTGGG - Intergenic
1046746788 8:117884406-117884428 CTGCAGCCACTTGGAGGTGCTGG + Intronic
1047248989 8:123167375-123167397 CTGGGGCCCCAAGGAACTGTGGG + Intergenic
1048136657 8:131752843-131752865 CTGTAGCCCCTGAGAAGTGGAGG + Intergenic
1048330182 8:133465831-133465853 CAGGGGCCCCTTGGAGCTGTAGG - Intronic
1048985621 8:139733278-139733300 CTGGAGCCCCTAGGAACTGAAGG + Intronic
1049068280 8:140337016-140337038 GTGCAGCCCCTTGTCAGTGTCGG + Intronic
1049399814 8:142419976-142419998 CGGGAGCCCCTGGGCAGTGGAGG + Intergenic
1053789137 9:41674127-41674149 GTGGGATCCCTTGGAAGTGTGGG - Intergenic
1054156003 9:61640634-61640656 GTGGGATCCCTTGGAAGTGTGGG + Intergenic
1054177419 9:61885480-61885502 GTGGGATCCCTTGGAAGTGTGGG - Intergenic
1054475773 9:65571636-65571658 GTGGGATCCCTTGGAAGTGTGGG + Intergenic
1054660113 9:67695328-67695350 GTGGGATCCCTTGGAAGTGTGGG + Intergenic
1054776767 9:69130588-69130610 TTGGAGGCCTTTGGAAGTGCAGG + Intronic
1056396282 9:86184317-86184339 CTGGAGCCAGCTGGAAGTCTGGG + Intergenic
1059015637 9:110512578-110512600 CTGATGCCTCTTGGAATTGTAGG - Intronic
1060392796 9:123292195-123292217 CTGGAGCTCCTGGGAGATGTGGG - Intergenic
1185930634 X:4199437-4199459 CTTGACCCCCTTAGAAGTGAGGG - Intergenic
1187505474 X:19875189-19875211 CTGGGGGCCCTTGGATGGGTTGG - Intronic
1194070210 X:89314376-89314398 CTGCAGGACCTTGGAAATGTAGG - Intergenic
1195206143 X:102601702-102601724 CTGATGGCACTTGGAAGTGTAGG + Exonic
1197095939 X:122595208-122595230 CTGGAGCCTTTTGGAGGTGGAGG - Intergenic
1200724448 Y:6650005-6650027 CTGCAGGACCTTGGAAATGTAGG - Intergenic