ID: 1149558803

View in Genome Browser
Species Human (GRCh38)
Location 17:57593703-57593725
Sequence CTAATTAGGACAAGTGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149558803_1149558808 10 Left 1149558803 17:57593703-57593725 CCTGCTACACTTGTCCTAATTAG 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1149558808 17:57593736-57593758 CCCTAAAAACTGGCCTATCCTGG 0: 1
1: 0
2: 0
3: 7
4: 122
1149558803_1149558806 0 Left 1149558803 17:57593703-57593725 CCTGCTACACTTGTCCTAATTAG 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1149558806 17:57593726-57593748 CAGTGAGGTTCCCTAAAAACTGG 0: 1
1: 0
2: 0
3: 5
4: 105
1149558803_1149558812 28 Left 1149558803 17:57593703-57593725 CCTGCTACACTTGTCCTAATTAG 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1149558812 17:57593754-57593776 CCTGGCTTGTTTTATTTGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149558803 Original CRISPR CTAATTAGGACAAGTGTAGC AGG (reversed) Intronic