ID: 1149558803 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:57593703-57593725 |
Sequence | CTAATTAGGACAAGTGTAGC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 74 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 8, 4: 65} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1149558803_1149558808 | 10 | Left | 1149558803 | 17:57593703-57593725 | CCTGCTACACTTGTCCTAATTAG | 0: 1 1: 0 2: 0 3: 8 4: 65 |
||
Right | 1149558808 | 17:57593736-57593758 | CCCTAAAAACTGGCCTATCCTGG | 0: 1 1: 0 2: 0 3: 7 4: 122 |
||||
1149558803_1149558806 | 0 | Left | 1149558803 | 17:57593703-57593725 | CCTGCTACACTTGTCCTAATTAG | 0: 1 1: 0 2: 0 3: 8 4: 65 |
||
Right | 1149558806 | 17:57593726-57593748 | CAGTGAGGTTCCCTAAAAACTGG | 0: 1 1: 0 2: 0 3: 5 4: 105 |
||||
1149558803_1149558812 | 28 | Left | 1149558803 | 17:57593703-57593725 | CCTGCTACACTTGTCCTAATTAG | 0: 1 1: 0 2: 0 3: 8 4: 65 |
||
Right | 1149558812 | 17:57593754-57593776 | CCTGGCTTGTTTTATTTGCAAGG | 0: 1 1: 0 2: 0 3: 11 4: 230 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1149558803 | Original CRISPR | CTAATTAGGACAAGTGTAGC AGG (reversed) | Intronic | ||