ID: 1149558803

View in Genome Browser
Species Human (GRCh38)
Location 17:57593703-57593725
Sequence CTAATTAGGACAAGTGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149558803_1149558812 28 Left 1149558803 17:57593703-57593725 CCTGCTACACTTGTCCTAATTAG 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1149558812 17:57593754-57593776 CCTGGCTTGTTTTATTTGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 230
1149558803_1149558808 10 Left 1149558803 17:57593703-57593725 CCTGCTACACTTGTCCTAATTAG 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1149558808 17:57593736-57593758 CCCTAAAAACTGGCCTATCCTGG 0: 1
1: 0
2: 0
3: 7
4: 122
1149558803_1149558806 0 Left 1149558803 17:57593703-57593725 CCTGCTACACTTGTCCTAATTAG 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1149558806 17:57593726-57593748 CAGTGAGGTTCCCTAAAAACTGG 0: 1
1: 0
2: 0
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149558803 Original CRISPR CTAATTAGGACAAGTGTAGC AGG (reversed) Intronic
901673517 1:10869399-10869421 CTGCTGATGACAAGTGTAGCTGG - Intergenic
906232266 1:44173971-44173993 CAAATTAGGAAAAGTGGGGCAGG + Intergenic
912929295 1:113942169-113942191 CTACTCAGGACAGGAGTAGCAGG - Intronic
1075001478 10:118801958-118801980 CAAATTAGGAAAAGTGAAGGAGG - Intergenic
1075577464 10:123588458-123588480 GGAAATAGGACAAGTGGAGCTGG + Intergenic
1076704962 10:132296395-132296417 CTAGTTACGACAAATGTACCCGG + Intronic
1082051234 11:47772031-47772053 CTAATTGGGGCCAGTGTTGCAGG - Intergenic
1094669285 12:32553274-32553296 GGAATTAGGACAAGTATAGCAGG + Intronic
1095180259 12:39139455-39139477 CTAATTAGGATAAGTGCAAGGGG + Intergenic
1100910290 12:99353074-99353096 CTAATTAGGAGAAGGGTAACCGG - Intronic
1103241159 12:119414313-119414335 CTAATAAAGACAAGAGTGGCCGG - Intronic
1106219397 13:27733204-27733226 TTAAATAGGACAAGTCTAGAAGG + Intergenic
1107429432 13:40326882-40326904 CTAAAGAGGACATGTGTGGCTGG - Intergenic
1110403084 13:75116535-75116557 CCTATTAGGACCAGTGTACCAGG - Intergenic
1110737700 13:78957162-78957184 CTAATTAGGTCATGTTTGGCAGG - Intergenic
1111928606 13:94490006-94490028 CTAATTATGACAAATATAGGTGG + Intergenic
1127159606 15:56167500-56167522 CTAATTATGAAAAATGTAACTGG + Intronic
1128158317 15:65406208-65406230 CTATTTATGGCAAGTGTTGCTGG + Intronic
1131682234 15:94736264-94736286 CCAATCAGGACAAATGTAGTAGG + Intergenic
1135481361 16:22823129-22823151 CTAATTATGGCAAGTGTTGCCGG - Intronic
1135979150 16:27133445-27133467 CCAATTAAGACCAGGGTAGCAGG + Intergenic
1139962230 16:70724597-70724619 CTAATTAGGAGATGAGAAGCCGG + Intronic
1143625118 17:8105304-8105326 ATAATTGGGGCAAGAGTAGCAGG - Intronic
1143642621 17:8207761-8207783 CTCATGAGGACAAGTGCAGATGG + Exonic
1144116315 17:12095732-12095754 CTAATTGGGACAAATGAAGATGG + Intronic
1149558803 17:57593703-57593725 CTAATTAGGACAAGTGTAGCAGG - Intronic
1155565754 18:27132456-27132478 CTAAGGAAGACAAGTGAAGCTGG - Intronic
1162613529 19:11776070-11776092 CTAATTAGGTCAAGCTTGGCAGG - Intronic
1164076557 19:21824224-21824246 CTAATCAGGACAGGTGATGCAGG - Intronic
930412974 2:51050502-51050524 CTAATAAAGACAATTGTGGCTGG + Intergenic
932574484 2:72955226-72955248 CTAATTAGGAGCAGTTTAACAGG - Intronic
943981386 2:194555790-194555812 CTATTTAGCACAAGGGCAGCAGG + Intergenic
944863379 2:203836752-203836774 TGAATTTGGACAAGTGTGGCTGG + Intergenic
1169723967 20:8709502-8709524 CAAATTAGGACAGGTGCTGCTGG - Intronic
1174026156 20:47577617-47577639 TTAATTAGGAAAAGGGAAGCAGG - Intronic
1174643338 20:52064197-52064219 CTAAAAAGGCCAAGTGTTGCTGG + Intronic
1174959809 20:55142945-55142967 CTAATTATGCCAAGTTTATCAGG + Intergenic
1179513408 21:41890035-41890057 CTCATTAGGAAGGGTGTAGCTGG + Intronic
966183862 3:177211037-177211059 CTAGGTAGGACAAGTTTAGTGGG - Intergenic
966990939 3:185229437-185229459 GTAATTAAGTCAAGTGCAGCAGG + Exonic
970223841 4:13837094-13837116 CTAATTAGGTCAGTTGTATCTGG - Intergenic
971453785 4:26824310-26824332 CTTATTAAGACAACTGCAGCTGG + Intergenic
975017541 4:69441706-69441728 CTAATTAAGACAAAGGTAACTGG + Intergenic
981448293 4:144866300-144866322 CTAATTCTGAAAAGTGTTGCGGG + Intergenic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
988602044 5:32649230-32649252 ATAATTTGGAAAAGTGTGGCCGG + Intergenic
989262672 5:39435917-39435939 ATAAGTTGGACAAGTTTAGCTGG - Intronic
990222982 5:53616557-53616579 CTAATGACCAAAAGTGTAGCTGG + Intronic
990631716 5:57677611-57677633 TTAAATAGGACAAGTGAGGCTGG + Intergenic
994018130 5:94992387-94992409 CTCTTTAGAACAAGTGTAGGAGG + Intronic
996832876 5:127759141-127759163 CTAGATAAGACAACTGTAGCTGG - Intergenic
1000818620 5:165955881-165955903 CTAATTAGGACAAGCCTGGCAGG + Intergenic
1002294963 5:178225222-178225244 CTACTGAAGACAAGTGTGGCAGG - Intronic
1009369950 6:62887018-62887040 GTACTTAGGAAAAATGTAGCAGG + Intergenic
1009442187 6:63694145-63694167 ATAATTAGAACCAGAGTAGCAGG + Intronic
1009442288 6:63695485-63695507 GTAATTAGAACAAGAGTAGCAGG + Intronic
1013747506 6:113363113-113363135 CTAAAAAGGATAATTGTAGCTGG - Intergenic
1021207184 7:17796856-17796878 CGAATGAGAACAAGAGTAGCAGG - Exonic
1026385390 7:69842323-69842345 ATAATTAGGACAAGTTTATCTGG - Intronic
1032313812 7:130815188-130815210 ATAATTAGAACAAGAGTAGCAGG + Intergenic
1033761896 7:144444732-144444754 CTAATCAGCACAATTTTAGCAGG + Intergenic
1036566059 8:9938944-9938966 CTAATTAAGAAAAGTGGACCGGG - Intergenic
1037622276 8:20575036-20575058 CCATTTTGGACAAGTTTAGCTGG + Intergenic
1045848930 8:106670613-106670635 CTAATTAGGACCTTTGTAGATGG + Intronic
1050996708 9:12229729-12229751 ATTATTAGGACAGGTGTAGCCGG - Intergenic
1051890755 9:21940325-21940347 GTAATCAGGCCAAGTGTAACGGG + Intronic
1056343886 9:85670446-85670468 TTAATTAAAGCAAGTGTAGCAGG + Intronic
1186946781 X:14577446-14577468 CTAATTAAGACTGGTGTACCAGG - Intronic
1188402322 X:29760764-29760786 TTTTTTAAGACAAGTGTAGCAGG - Intronic
1197375051 X:125672782-125672804 GTAATTTGGGCAATTGTAGCAGG + Intergenic
1198304061 X:135363148-135363170 TTAATTAGTGCAAGTGAAGCAGG - Exonic
1202251722 Y:22880035-22880057 CTAATAATGACAATTGTACCTGG - Intergenic
1202404710 Y:24513784-24513806 CTAATAATGACAATTGTACCTGG - Intergenic
1202466069 Y:25156298-25156320 CTAATAATGACAATTGTACCTGG + Intergenic