ID: 1149561599

View in Genome Browser
Species Human (GRCh38)
Location 17:57611510-57611532
Sequence TCCGTGTGGGAGGGGGCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149561599_1149561613 19 Left 1149561599 17:57611510-57611532 CCTAGAGCCCCCTCCCACACGGA 0: 1
1: 0
2: 0
3: 6
4: 188
Right 1149561613 17:57611552-57611574 CACCAGTAGAATGTGTGGGAGGG 0: 1
1: 0
2: 1
3: 10
4: 172
1149561599_1149561611 15 Left 1149561599 17:57611510-57611532 CCTAGAGCCCCCTCCCACACGGA 0: 1
1: 0
2: 0
3: 6
4: 188
Right 1149561611 17:57611548-57611570 GTGTCACCAGTAGAATGTGTGGG 0: 1
1: 0
2: 2
3: 8
4: 137
1149561599_1149561610 14 Left 1149561599 17:57611510-57611532 CCTAGAGCCCCCTCCCACACGGA 0: 1
1: 0
2: 0
3: 6
4: 188
Right 1149561610 17:57611547-57611569 AGTGTCACCAGTAGAATGTGTGG 0: 1
1: 0
2: 2
3: 12
4: 150
1149561599_1149561612 18 Left 1149561599 17:57611510-57611532 CCTAGAGCCCCCTCCCACACGGA 0: 1
1: 0
2: 0
3: 6
4: 188
Right 1149561612 17:57611551-57611573 TCACCAGTAGAATGTGTGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149561599 Original CRISPR TCCGTGTGGGAGGGGGCTCT AGG (reversed) Intronic