ID: 1149563888

View in Genome Browser
Species Human (GRCh38)
Location 17:57628257-57628279
Sequence CCTGGAGGTCTGGGAGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 299}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149563878_1149563888 2 Left 1149563878 17:57628232-57628254 CCCCTGCCTTGTCGTCATGCCTA 0: 1
1: 0
2: 0
3: 3
4: 96
Right 1149563888 17:57628257-57628279 CCTGGAGGTCTGGGAGTGTCAGG 0: 1
1: 0
2: 2
3: 39
4: 299
1149563879_1149563888 1 Left 1149563879 17:57628233-57628255 CCCTGCCTTGTCGTCATGCCTAG 0: 1
1: 0
2: 0
3: 10
4: 67
Right 1149563888 17:57628257-57628279 CCTGGAGGTCTGGGAGTGTCAGG 0: 1
1: 0
2: 2
3: 39
4: 299
1149563881_1149563888 -4 Left 1149563881 17:57628238-57628260 CCTTGTCGTCATGCCTAGACCTG 0: 1
1: 0
2: 1
3: 3
4: 66
Right 1149563888 17:57628257-57628279 CCTGGAGGTCTGGGAGTGTCAGG 0: 1
1: 0
2: 2
3: 39
4: 299
1149563880_1149563888 0 Left 1149563880 17:57628234-57628256 CCTGCCTTGTCGTCATGCCTAGA 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1149563888 17:57628257-57628279 CCTGGAGGTCTGGGAGTGTCAGG 0: 1
1: 0
2: 2
3: 39
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149563888 Original CRISPR CCTGGAGGTCTGGGAGTGTC AGG Intronic
900213327 1:1467982-1468004 CCTGGAGGCCTGTGAGGGTCAGG + Intronic
900218545 1:1495080-1495102 CCTGGAGGCCTGTGAGGGTCAGG + Intronic
900220888 1:1508800-1508822 CCTGGAGGCCTGTGAGGGTCAGG + Intergenic
900225895 1:1533521-1533543 CCTGGAGGCCTGTGAGGGTCAGG + Intronic
900786403 1:4653272-4653294 CCTGGAGGCCTGGGGGTGAAAGG + Intergenic
902237146 1:15064744-15064766 CAAGGAGGCCTGGGAGAGTCCGG - Intronic
902331220 1:15732085-15732107 CCTGGGGGTCTGGGTGGGTCAGG - Intronic
903499130 1:23792099-23792121 CCTGGGGGTCTGGGAATGGATGG + Intronic
903694382 1:25196306-25196328 CCTGGGGACCTGGGAGTGTGGGG + Intergenic
906120960 1:43390073-43390095 CCTCTAGGTCTGGGGGTGGCCGG + Intronic
907388401 1:54140505-54140527 CCTGGAGGGCAGAGAGTGTTTGG - Intronic
908688634 1:66752542-66752564 GCCGGAGGTCTGGGAGGCTCCGG + Exonic
910458901 1:87427075-87427097 CCTGCAGCTCTGTGAGTGACTGG - Intergenic
912931586 1:113968563-113968585 ACAGGAGGGCTGGGAGTATCTGG - Exonic
914755458 1:150559456-150559478 CCTGGAGCCCAGTGAGTGTCTGG + Exonic
914875943 1:151512771-151512793 CCTGGATGTTTGGGAGTCTGGGG + Intronic
916421291 1:164640157-164640179 CCTGGAGGTCTGGATGTGCTAGG + Intronic
916444761 1:164862021-164862043 CCTGGAGGCCTTGGAATGTTTGG + Intronic
916482337 1:165225841-165225863 CCTGCAGGGGTGGGAGTGTAGGG - Intronic
918047713 1:180951533-180951555 CCTGGAGGGCTGGGACTCTTTGG + Exonic
919352082 1:196470537-196470559 CCTGGAGGCCTCAGTGTGTCAGG - Intronic
919639648 1:200035927-200035949 CCGGGAGGCCTGGGAGTCTGTGG - Intronic
919670479 1:200333141-200333163 CCTGGATGTGTGGAGGTGTCTGG + Intergenic
921987385 1:221327024-221327046 CCAGGAGGTCTGGCTGTGTGAGG - Intergenic
923456468 1:234169525-234169547 GCTGGATTTCTGGGAGTTTCTGG + Intronic
923758644 1:236818420-236818442 CCTGGAGGTGAGGCAGTGGCAGG - Intronic
924661227 1:246019174-246019196 CCTGGAAGTCTGGCAATGTTTGG + Intronic
1062829665 10:597262-597284 CCTGGAGGCCTGGGAGGGTGTGG - Intronic
1063174524 10:3539589-3539611 CCTGGTGGCCTCAGAGTGTCTGG + Intergenic
1064374767 10:14785432-14785454 TCTGGAGGTCTGGGGGTGTGGGG + Intergenic
1066641693 10:37560500-37560522 TCTGGAGGTCTGGGAGTTAGAGG - Intergenic
1067238184 10:44469103-44469125 CAGGGACATCTGGGAGTGTCTGG + Intergenic
1067283915 10:44893925-44893947 CTTGCAGGCCTGGGAGTGACAGG - Intergenic
1067721400 10:48730252-48730274 CCTGGAAGGCTGGGTGAGTCTGG + Intronic
1067809785 10:49417864-49417886 TCTGGAGGTGGGGGCGTGTCGGG - Intergenic
1068132831 10:52916092-52916114 CCTGGAGGGGTGGGAGTGGAAGG + Intergenic
1069615740 10:69805085-69805107 CCCGGAGGACTGGGAGTGTGAGG + Intronic
1069782718 10:70966920-70966942 GCTGGAGGTCTGGGAGTGATGGG + Intergenic
1069957504 10:72061004-72061026 CCTGGTGGCCTGGGAGCGTGAGG - Exonic
1072438989 10:95437670-95437692 CCTAGAGGTCTGAAAGTATCTGG - Intronic
1072720044 10:97774807-97774829 CCTGGAGGGGTGGGAGAGTCAGG - Intergenic
1072725021 10:97807354-97807376 CCTGAAGGTCTGGAAGTGGGCGG + Intergenic
1073036310 10:100566542-100566564 CTTGGAGGTCTGTGAGGGGCTGG + Intergenic
1074789152 10:116868841-116868863 ACTGCAGCTCTGGGGGTGTCTGG - Intronic
1074871043 10:117576254-117576276 CCTGGAGGCCTGGGAGTACGGGG + Intergenic
1075634939 10:124024158-124024180 GCTGAAGGTCTGGGAGCGTTTGG - Intronic
1076040497 10:127243630-127243652 CCAGGAGGGCTGGGGGTGTGCGG + Intronic
1076338227 10:129724962-129724984 CCTGGAGGGCAGGGTGAGTCTGG + Intronic
1076719472 10:132386932-132386954 CCTGGTGGATTGGGGGTGTCTGG + Intergenic
1076788133 10:132761430-132761452 CATGGAGCTCTGGGGGTGGCAGG + Intronic
1077060100 11:614158-614180 GCTGGAGGTGTGGGCGTGCCCGG - Exonic
1077296168 11:1827210-1827232 CCTGGAGAGCAGGGGGTGTCGGG - Intergenic
1077383195 11:2257049-2257071 CCTGGGGCTCTGGGAGTGGAGGG + Intergenic
1078455907 11:11475000-11475022 GCAGGAGGCCTGGGTGTGTCAGG - Intronic
1079349656 11:19681647-19681669 CCTGCAGTTCTGGGAGGATCTGG + Intronic
1081234831 11:40635094-40635116 CCTGGAGGTATAGGAGTGTTGGG - Intronic
1081774765 11:45669693-45669715 CCTGGAGCTATGGGAGCATCAGG - Intergenic
1081851215 11:46276521-46276543 CCCGGGGCCCTGGGAGTGTCTGG + Intergenic
1082807465 11:57460104-57460126 GCTTGAGGTCTGGGAGTGGAAGG + Intergenic
1083261121 11:61523700-61523722 ACTGGAGGTCGGGGTGTGGCGGG + Intronic
1083661991 11:64255699-64255721 TCTGGAGGTCGAGGAGTGTGGGG - Exonic
1083844456 11:65322723-65322745 CAGGGAGGTCAGGGAGTGTCAGG + Intergenic
1084198375 11:67539353-67539375 CCTGCAGGGCAGGGAGTGTGAGG - Intergenic
1084261278 11:67980402-67980424 CCTGGAGGACTGTGGGTGTAAGG - Intergenic
1084358358 11:68653844-68653866 CCTGGGCGGCTGGGAGTGGCTGG + Intergenic
1084657282 11:70526993-70527015 CGTTGAGGACTGGGAGCGTCTGG - Intronic
1084889295 11:72228816-72228838 GCTGGAGCTGTGGGAGTCTCAGG - Exonic
1085283599 11:75346101-75346123 GCTGCAGGTGTGGGAGTGTGAGG - Intronic
1085450293 11:76627931-76627953 GCTGGAGGTCTATGAGTGTGTGG - Intergenic
1085620871 11:78037226-78037248 CCACGAGGTCTGAGAGTGGCTGG - Intronic
1089322233 11:117634196-117634218 CCTGGAGGTGTAGGAGAGTGTGG + Intronic
1091772593 12:3162804-3162826 CCTGGAGGCCTGGGAGAGAAGGG - Intronic
1091787619 12:3252502-3252524 CCCGGAGCTCTGGGAGTGCAGGG - Intronic
1092104882 12:5914352-5914374 CCTGTAGGTCTGGCAGAGCCTGG - Intronic
1092238365 12:6823261-6823283 CCTAGAGGTCTGGAAGAGTGCGG + Intronic
1092243414 12:6849564-6849586 CCTGAAGATCTGGGAGTCTCAGG + Exonic
1094514415 12:31118896-31118918 CCTGGAGGACTGGGGGTTTTAGG + Intergenic
1095098299 12:38159424-38159446 CCTGGGGGTCTTGGAGTCCCTGG + Intergenic
1097942062 12:65321084-65321106 ACTGGAGGACTGGGAGTGAAAGG - Intronic
1100355653 12:93826781-93826803 CGCTGAGGTCTGGGAGTGTCTGG - Intronic
1101708569 12:107243585-107243607 CCAGCTGGGCTGGGAGTGTCGGG - Intergenic
1102140962 12:110614342-110614364 CCTGGAGCCCTGGGAGTCCCGGG - Exonic
1102356048 12:112236907-112236929 CCTGGAGCTCTGGGAGAAGCTGG - Intronic
1102448092 12:113019001-113019023 CCTGGAGCTCTGGGGATGTGGGG + Intergenic
1102470438 12:113156940-113156962 CCCGGAGGCCAGGGAGTGTTAGG - Intronic
1102477844 12:113200484-113200506 CCTGGAGGTCCAGCAGTGTTGGG - Intronic
1103023863 12:117558024-117558046 CCTGGGGCCCTAGGAGTGTCTGG - Intronic
1104080925 12:125430034-125430056 CCTTGAGCTCTGGGAGTGAAGGG + Intronic
1104185724 12:126428759-126428781 CCTGGGAGCCTGGGAGTGTTTGG + Intergenic
1104859892 12:131918410-131918432 CCTGGAGGTGTGGGAGTCTGTGG + Intronic
1104894956 12:132159521-132159543 CATGGAGGTATGGGCGTGGCGGG + Intergenic
1105584456 13:21731034-21731056 CCTGCAGGTCTTAGAATGTCTGG - Intergenic
1106131290 13:26941694-26941716 CCTAGAGATCAGGAAGTGTCAGG + Intergenic
1107490670 13:40877701-40877723 CCTGGAGGACTGTGAGTATAAGG - Intergenic
1108094354 13:46884988-46885010 ACTGGAGGTCTTGGAATGTATGG - Intronic
1110892132 13:80706440-80706462 CCTGGAGGACTGTGGGTATCAGG + Intergenic
1111289162 13:86140798-86140820 CCTGGAGGGCTGGGGATGCCAGG - Intergenic
1113240892 13:108335746-108335768 CCTGGAGGGCTGGAAGGGTGTGG + Intergenic
1113426030 13:110209399-110209421 CCTGGAGGGCCGGGAGGGCCTGG + Exonic
1113722504 13:112570212-112570234 CCTGGAGTTCTGGGAAGGACTGG - Intronic
1113789953 13:113022991-113023013 CCTCGAGGGCTGGGAGAGTTCGG + Intronic
1114065810 14:19059270-19059292 GCTGGAGGCCTGGGAGTCACAGG + Intergenic
1114334321 14:21672184-21672206 CCTGGAAGGCTGTGTGTGTCAGG - Intergenic
1119167626 14:72508177-72508199 CCTGGAGGTCAGGGAGCCTCTGG - Intronic
1121920344 14:97875047-97875069 CCTGGAGGGCTGGAACTGTGAGG - Intergenic
1122383911 14:101331030-101331052 TCTGGATGCCTGGGAGGGTCTGG - Intergenic
1123626096 15:22227761-22227783 CCTGAGGGCCTGGGGGTGTCAGG + Intergenic
1124031962 15:26019992-26020014 TCTGGAGGTTTGGAAGTGCCAGG + Intergenic
1124224699 15:27883098-27883120 CCTGCAGGCCAGGGAGTGTGGGG - Intronic
1125479353 15:40069686-40069708 CCTGGAGTGGTGGGAGTGCCGGG - Intergenic
1125579730 15:40776604-40776626 CCTGGAGGCCCGGGAGCGGCAGG - Exonic
1126170732 15:45693265-45693287 CATGGAGGTCAGGGAGAGCCGGG + Intergenic
1126415339 15:48412432-48412454 CCTAGAGCTCAGGGAATGTCTGG + Intronic
1129265669 15:74391985-74392007 GCTGGAGGTGTGGGGGTGTGGGG - Intergenic
1129325821 15:74799834-74799856 CATGCAGGTCTGTGAGTGGCTGG - Intronic
1129392792 15:75228926-75228948 CCTGGAGGTCAGGGCGGGCCTGG + Intergenic
1129753897 15:78084391-78084413 GATGGAGGTCTGGGTGTCTCTGG + Intronic
1131151855 15:90052186-90052208 CCTCGAGCTGTGTGAGTGTCTGG - Intronic
1133076253 16:3283281-3283303 CCTGAAATTCTGGGAGTGACTGG - Exonic
1133527284 16:6617875-6617897 CATGGAGGTCTAGAAGTGTCTGG + Intronic
1133745061 16:8680080-8680102 GCTGGAGGTGGGGGAGGGTCGGG - Intronic
1136290450 16:29268377-29268399 CCCGGAGTTCTGGGAATGTGTGG + Intergenic
1136995471 16:35185901-35185923 CCTGGGGGTCTTGGTGTGTGTGG + Intergenic
1137379075 16:47981163-47981185 GCTGAAGGTCTGTGAGGGTCTGG - Intergenic
1137683099 16:50368474-50368496 CCGGGAGGCCTGGGAGCGTTCGG - Intronic
1137706402 16:50538762-50538784 CCTGGAGGCAGGGAAGTGTCGGG - Intergenic
1138458447 16:57134244-57134266 CCTGGCGATCAGGGAGTGTAAGG - Intronic
1139433511 16:66923775-66923797 GTTAGAGGTCTGGGAGTGCCAGG - Intronic
1139910696 16:70395614-70395636 CCTGGGGCTCAGGGAGTGGCTGG - Intronic
1139931082 16:70526622-70526644 CCTGGAGGTCTGGGTGGCTCAGG + Exonic
1141033501 16:80609363-80609385 TCTGGAGGCCTGAGAGTGCCTGG - Intronic
1141767143 16:86066122-86066144 CATGGAGGTCAGGGAGCGCCTGG - Intergenic
1141830419 16:86507293-86507315 CCAGTAGGCCTGGGAGTCTCAGG - Intergenic
1142096332 16:88241898-88241920 CCCGGAGTTCTGGGAATGTGTGG + Intergenic
1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG + Exonic
1142806462 17:2373529-2373551 CCTGGAGGGTTGGGGGTCTCGGG + Intronic
1142903653 17:3028306-3028328 CATGGATGTCTGGCAATGTCTGG + Intronic
1143218764 17:5244211-5244233 TCTGGTGGTCTGGTAGTCTCTGG - Intergenic
1144968717 17:19093819-19093841 CCTGGAGGTCTGCGAGTTGGAGG + Exonic
1144979198 17:19158247-19158269 CCTGGAGGTCTGCGAGTTGGAGG - Exonic
1144989024 17:19219985-19220007 CCTGGAGGTCTGCGAGTTGGAGG + Exonic
1146079061 17:29761005-29761027 CCTGGAGGTCTCCGTGCGTCTGG - Intronic
1146502990 17:33380482-33380504 CAGGGAGGTCAGGGAGTGACAGG + Intronic
1146798946 17:35803568-35803590 CCTGGAGGTCTGGGTCTCCCAGG - Intronic
1146821287 17:35985140-35985162 CCTGGAGCTCTGGGGGCCTCAGG + Intronic
1146828121 17:36041626-36041648 CCTGGAGGTCTGGGTGTCCCAGG + Intergenic
1147181100 17:38686187-38686209 CTTGGAGGGCTGGAGGTGTCGGG - Intergenic
1147320126 17:39640957-39640979 CCTGGAGAAGTGGGAGTGTAGGG - Intronic
1147763711 17:42818680-42818702 CCTGGAAGTGTGGGAGAGTCAGG + Exonic
1147968973 17:44209598-44209620 CCTGGAGGTCGGGGAGGGTCAGG - Intronic
1148198637 17:45733120-45733142 CCTGGAGCCCTGGGAGAGCCTGG + Intergenic
1148693468 17:49545867-49545889 CCCGGAGGGGTGGGGGTGTCTGG - Intergenic
1149089945 17:52765586-52765608 CTTGGAGGGCTGGTAGTGTCTGG - Intergenic
1149563888 17:57628257-57628279 CCTGGAGGTCTGGGAGTGTCAGG + Intronic
1149591310 17:57831827-57831849 CCTGGTGGTCTGCCAGTGTATGG - Intergenic
1151346790 17:73507301-73507323 CCTGGAGTTCTGGAAGTGAGTGG - Intronic
1151598290 17:75091088-75091110 CCTCGGGGCCTGGGAGTGCCAGG + Intronic
1151829110 17:76539107-76539129 CCTGGGGGTCTTGGAGGGGCTGG + Intronic
1152210446 17:79000451-79000473 GCGGGGGGTATGGGAGTGTCAGG - Intronic
1152306133 17:79521043-79521065 CCTGGCTGTCTGGGAGGGGCCGG + Intergenic
1152337285 17:79706171-79706193 CCTGGGGGTCTGAGGGTGCCAGG - Intergenic
1152603898 17:81279180-81279202 CCTGGAGGTCAGGGTCTATCTGG - Intronic
1152680747 17:81666626-81666648 CCTGAAGGTCCGGGATTGGCCGG - Exonic
1155354141 18:24935316-24935338 CCTGAAGGTCTGGCAGCTTCAGG - Intergenic
1156373836 18:36494752-36494774 CCTGAAGCTCTGGGACTGCCAGG - Intronic
1157282524 18:46355599-46355621 CCTGGAGGTCCCCAAGTGTCTGG - Intronic
1157521010 18:48345546-48345568 GATGGAGGTCTGGGGGTGTGGGG - Intronic
1160340039 18:78081940-78081962 CCTGGAAGTGTGGAAGTGTCTGG + Intergenic
1160658619 19:287904-287926 CCTGGAGGTCTGTGTGGGGCCGG - Intronic
1161425842 19:4202648-4202670 CTGGGAACTCTGGGAGTGTCTGG - Intronic
1161473467 19:4472633-4472655 CCTAGGGGTCTGGGGTTGTCCGG + Intronic
1162398532 19:10431541-10431563 GCTTGAAGTCTGGGAGTGACAGG + Intronic
1165470995 19:36004540-36004562 CCTGAAGGTCTGGGAGTGGAAGG - Intronic
1165651770 19:37497374-37497396 TCTGGAGGTCAGGAAGTTTCTGG + Intergenic
1165804201 19:38570702-38570724 CCTGAAGGGCTGGGAGGGTCAGG + Intronic
1166071366 19:40390056-40390078 CCTGGGGGTTTGGGGGTGCCAGG - Exonic
1166738342 19:45099247-45099269 CCTGGAGGTCAGGGACTGCTGGG - Intronic
1167483541 19:49747024-49747046 CCTGGAGGGCTTGGAGGGCCGGG - Intronic
1167499012 19:49835373-49835395 CCTGGAGACCTTGGAGTGTACGG + Intronic
1167603838 19:50469469-50469491 CCTGGAGGGCAGGGAGTTCCTGG + Intronic
1167708277 19:51094721-51094743 TCTTGAGGTCAAGGAGTGTCTGG + Intergenic
925905876 2:8539511-8539533 CCTGCTGGCCTGGGAGGGTCTGG - Intergenic
926052044 2:9751550-9751572 TCTGGAGCTCAGGGAGTATCTGG - Intergenic
926162412 2:10498235-10498257 CGTGGAGGTCGAGGAGTGGCTGG - Intergenic
926250408 2:11152709-11152731 TCAGGAGGTTGGGGAGTGTCTGG - Intergenic
926699471 2:15793609-15793631 CCAGGAGCTCTGGGAGAGTAGGG - Intergenic
927131751 2:20066115-20066137 CTTGGTGGCCTGGGATTGTCCGG - Intergenic
929154597 2:38778118-38778140 CTTGGAGGTCTGAGAGTCGCGGG - Intronic
929601219 2:43206054-43206076 CCTGGAGGTCCTGCAGTGTGTGG - Intergenic
932582240 2:72999562-72999584 ACTGCAGGTCTAGAAGTGTCTGG + Intronic
934924138 2:98369992-98370014 CCTGGAGGGGTGGGAGTATTGGG - Exonic
935627181 2:105180902-105180924 CCTGGATGTCCGGGTGTGTCCGG + Intergenic
937799151 2:126060951-126060973 ACTGGAGTTCTGGGAGCTTCTGG + Intergenic
939426716 2:142047848-142047870 CCTGGAGGTCTCAGAGTTCCAGG - Intronic
940874254 2:158884308-158884330 CCTGGAGGTCTGCGGGTATAAGG + Intergenic
941162187 2:162048489-162048511 CGTGGAGGGCTGTGAGTTTCAGG - Intronic
941484965 2:166068431-166068453 CCTGGATGTAAGGGAGAGTCTGG + Intronic
948320557 2:237065457-237065479 GCTGGAGGGCTGGGTGTGACAGG + Intergenic
948928608 2:241116061-241116083 GCTGGAGGACTGGGTGTCTCTGG - Intronic
949010697 2:241676764-241676786 CCTGGTGGGCTGGGTGGGTCTGG - Intronic
949072139 2:242031746-242031768 CCAGGAGGCCTGCGACTGTCCGG - Intergenic
1169143480 20:3238635-3238657 CCTGGAGTTTTGGGAGTCCCGGG - Intronic
1169877531 20:10314307-10314329 CCTGGGTGTCTGGGGGTGTGGGG + Intergenic
1172006594 20:31822646-31822668 CCTGGAGGCAGGGGGGTGTCAGG - Intronic
1172025576 20:31945990-31946012 CCTGGAGGTCTGGCAGGGATGGG + Intronic
1172162659 20:32879281-32879303 CCTGGAGGCCTCAGAGTGGCTGG + Intronic
1172308965 20:33902287-33902309 CATGGGGGCCTGGGAGGGTCAGG - Intergenic
1172445369 20:34990519-34990541 CCTGGGGCTCTGGGAGGGACGGG + Intronic
1172775324 20:37403640-37403662 CCTGGAGCTCTGTGGGTCTCTGG + Exonic
1172776030 20:37407581-37407603 CATGGAGGTGTGGGAGGGCCTGG - Intergenic
1173800640 20:45892329-45892351 GCTGGAGCTGTGGGTGTGTCTGG + Intronic
1175106361 20:56617745-56617767 CCTGGAGGCCTGGGGGTGTGGGG + Intergenic
1175257418 20:57655697-57655719 CCTGGGAGTCTGGGAGTGGTTGG - Intronic
1177393812 21:20508212-20508234 TCTGGAGGCCTGGGAGTGTCAGG + Intergenic
1178085848 21:29111367-29111389 GCTGGTGTTCTGGGTGTGTCAGG + Intronic
1179135676 21:38678280-38678302 GCTGGAGGTCTGGTGGTGTGGGG + Intergenic
1180157642 21:45985845-45985867 CCTGGGGGACTTGGAGTCTCAGG + Intronic
1180169356 21:46049962-46049984 CCGGGAGGTCTGGGGGTGCTGGG - Intergenic
1180484291 22:15781862-15781884 GCTGGAGGCCTGGGAGTCACAGG + Intergenic
1180995745 22:19964428-19964450 ACCTGAGGTCTGGGAGTGTGGGG + Intronic
1181162256 22:20965779-20965801 CCAGGAGCCCTGGGAGGGTCAGG + Intronic
1181329562 22:22079468-22079490 CCTGAGGGTCTGGGGGTGTTCGG + Intergenic
1181485104 22:23225563-23225585 CCTGTAGGTCTGGAGGTGGCTGG + Intronic
1183568032 22:38630723-38630745 CCTGGAGGGCAGGGAGTCTATGG - Intronic
1184120702 22:42448107-42448129 ACAGGAGTTCTGGGAGTGACGGG - Intergenic
1184132467 22:42525295-42525317 ACGGGAGTTCTGGGAGTGACGGG - Intergenic
1184817502 22:46883472-46883494 CCTTTAGGGATGGGAGTGTCAGG + Intronic
1185064918 22:48627345-48627367 GCTGCAGGTCTGGGGGTGGCGGG + Intronic
1185343290 22:50300886-50300908 CCAGGTGGCCTGGGTGTGTCAGG - Intronic
1185393099 22:50573191-50573213 CCTGGAGATGTGGGGGTGCCAGG + Intronic
950100966 3:10356616-10356638 CCAGGAGCTCTGGGAGGGCCCGG + Intronic
950306228 3:11917073-11917095 CCTGGAGGTCTGCAGGTGCCTGG + Intergenic
950441865 3:13015250-13015272 CCTGGATGGCAGGGAGTGTTGGG - Intronic
950673253 3:14539746-14539768 CCTGGGGCTCTGGGAATGTGTGG - Intronic
952213046 3:31248752-31248774 CCTGGGAGGCTGTGAGTGTCTGG - Intergenic
952649429 3:35707338-35707360 GCTGCATGTCTGGGAGGGTCGGG + Intronic
953457143 3:43052442-43052464 CCTGGAGGTCTGGGTGAGGGAGG - Intronic
954615665 3:51967674-51967696 CGTGGGGCTCTGGGAGTGGCAGG - Intronic
956758121 3:72410280-72410302 CCTGGAGGGCAGGGACTGTTAGG - Intronic
958892412 3:99795585-99795607 CCTGGAGGTCCTGGAGGGCCTGG - Exonic
960158388 3:114321428-114321450 CCTGGAGGGCTGGGTGGTTCTGG + Intergenic
961548430 3:127652379-127652401 CCAGCAGTTCTGGGAGGGTCGGG + Intronic
963886651 3:150590188-150590210 CCTGGAGGTATTGCAGTTTCTGG + Intronic
964253365 3:154746522-154746544 CCTGGGAGGCTGGGAGTGTGTGG - Intergenic
965473024 3:169118905-169118927 CCTGGAGGCCTGGTAGTTTGTGG - Intronic
966911252 3:184561673-184561695 CCTGGCGGTCTGTGAGTGGGTGG + Intronic
967118067 3:186360092-186360114 CCTGGGCCTCTGGGAGTGTCCGG + Intronic
967217243 3:187220927-187220949 CCTGGTGGGCTGGCAGTGTGGGG - Intronic
969024504 4:4162670-4162692 CCTGGAGGACTGTGGGTGTAAGG - Intergenic
969308232 4:6337578-6337600 CCTCAAGGTCTGGGGGAGTCTGG - Intronic
969622430 4:8285433-8285455 CATGGAGGGATGGGAGCGTCTGG - Intronic
969793640 4:9509203-9509225 CCTGGAGGACTGTGGGTGTAAGG + Intergenic
973220735 4:47723258-47723280 CCTGGAAGTCAGAGAGTTTCAGG + Intronic
973874083 4:55197644-55197666 CCTGGAGAGGTGGGAGTGTTGGG - Intergenic
980924846 4:139125705-139125727 CCTGGAAGACTGAAAGTGTCTGG + Intronic
987018315 5:13843806-13843828 CCTGGTTGTATGGGGGTGTCCGG - Intronic
988544914 5:32146430-32146452 GATGGAGGTCTGGTAGTGTATGG - Intronic
989198988 5:38744527-38744549 CCTGGAGGTTTGGGACTTTATGG - Intergenic
996366332 5:122705156-122705178 CCAGGAGGACTGGGAAGGTCAGG + Intergenic
1001243815 5:170090669-170090691 CTTGGTGATCAGGGAGTGTCAGG - Intergenic
1002897028 6:1385189-1385211 CCCGGAGGTCTGGGGGTTTCTGG + Intergenic
1004108779 6:12693683-12693705 CCTGGCATTATGGGAGTGTCAGG + Intergenic
1005511646 6:26517239-26517261 CCTGGAGGTCAGGGAAAGTATGG + Intergenic
1006377667 6:33680488-33680510 CCAGGAGGTGTGGGAGTGGAGGG + Intronic
1006415897 6:33903733-33903755 CCTTGAGGTGTGGGTGTGGCAGG + Intergenic
1006788780 6:36685337-36685359 TCTGCAGGGATGGGAGTGTCCGG + Intronic
1007115370 6:39339492-39339514 GCTGGAGGGCTGGGAGAGGCAGG + Intronic
1007774423 6:44217003-44217025 CTGAGAGGTCAGGGAGTGTCAGG + Intergenic
1008544944 6:52576416-52576438 ACTGCGGGTCTGGGAGTCTCTGG + Intronic
1013428275 6:110034293-110034315 CCTGGAGGATTGGGAGTGGTGGG - Intergenic
1018215395 6:161521675-161521697 TCTGAAGGTCAGGGAGTGGCTGG + Intronic
1019445008 7:1066636-1066658 GCTGGTGGTCTGGGAGCCTCTGG - Intronic
1020208586 7:6139929-6139951 CAGGGAGGTCTGGGAGTGGCGGG - Intronic
1021080269 7:16356413-16356435 CTTGGAGGTGGGGGAGTATCTGG + Intronic
1022042637 7:26595035-26595057 CTTGGAGGTTTGGGAGGGTCAGG - Intergenic
1022572765 7:31470351-31470373 CCAGGGGCTCTGGGAGTGGCTGG + Intergenic
1023212383 7:37821318-37821340 CCTGAAGATCTGGGAGTCTCAGG - Intronic
1023847321 7:44129753-44129775 CGTGGAGGTCAGGGAGGGGCTGG + Intergenic
1023899258 7:44462617-44462639 CCTGGGAGTTTGGGAGTGTGTGG + Intronic
1024090971 7:45939534-45939556 CATGGAAGTCTGGGAGTGGAAGG + Intergenic
1025638934 7:63349603-63349625 ACTGGAGGTCTGGGAAGGTCTGG + Intergenic
1025643765 7:63398489-63398511 ACTGGAGGTCTGGGAAGGTCTGG - Intergenic
1028234158 7:88340367-88340389 CCTGGATGTTTGGCAATGTCTGG - Intergenic
1028755375 7:94427642-94427664 CCTGGAGGTCCAGGAGGGCCAGG - Exonic
1028985021 7:97002809-97002831 CCGGGAAGGCTGGGATTGTCCGG - Intergenic
1029078335 7:97953241-97953263 CCTGGAGGACTGTGGGTGTAAGG - Intergenic
1029146039 7:98446845-98446867 CCTGGTGGTCTTGGAGGGGCAGG + Intergenic
1029561913 7:101308601-101308623 TCTGGAGGTCCGCGAGGGTCGGG - Intergenic
1031886455 7:127251034-127251056 CCTGAAGGTGCGGGAGTCTCTGG - Intronic
1034204838 7:149306380-149306402 CCTGGAGGTCTTGGAGAATGAGG + Intergenic
1034303995 7:150036796-150036818 CCTGGAGGACTGTGGGTGTTAGG - Intergenic
1034304513 7:150038692-150038714 CCTGGAGGACTGTGGGTGTTAGG - Intergenic
1034438249 7:151073965-151073987 CCTGGGGCTCAGTGAGTGTCGGG - Intronic
1034801971 7:154060509-154060531 CCTGGAGGACTGCGGGTGTTAGG + Intronic
1034802421 7:154062198-154062220 CCTGGAGGACTGCGGGTGTTAGG + Intronic
1035663621 8:1364534-1364556 CCTGGAGGACTGGGGCTGGCGGG + Intergenic
1038324245 8:26560429-26560451 TCTGCAGGTCTGGGAAGGTCTGG + Intronic
1039200905 8:35092554-35092576 CCTGGAGGGCAGAGAGTGGCAGG + Intergenic
1039921128 8:41895524-41895546 CCTGGAGGTCTGGGTCTTTGCGG + Intronic
1040567882 8:48582886-48582908 CTTGTGGGTCTGGGAGAGTCAGG + Intergenic
1041332289 8:56739906-56739928 CCTGCAGCTCTGGGACCGTCAGG - Intergenic
1045496997 8:102717398-102717420 GCTGGAGGACTGGGAGTGGCTGG + Intergenic
1046836517 8:118807746-118807768 CCTGGAGTACTGGGTGCGTCAGG - Intergenic
1047710816 8:127550584-127550606 CCTGAAGATCTGACAGTGTCAGG - Intergenic
1048470270 8:134698694-134698716 CCTGGATCCCTGGGGGTGTCCGG - Intronic
1048512798 8:135077900-135077922 CTTGGAGGACTGTGAGTGTTGGG - Intergenic
1048808495 8:138263295-138263317 CCTGGAGGGTTGGCTGTGTCCGG - Intronic
1049138366 8:140927506-140927528 CCTGGGGGTCTGATGGTGTCAGG + Intronic
1049286322 8:141777176-141777198 CCCGGAGGCCTGGGCGTGCCTGG + Intergenic
1049372516 8:142274603-142274625 CCTAGGGCTCTGGGAGTGGCGGG - Intronic
1049512719 8:143037843-143037865 CCTGGAGGTCGGGCAGGGGCAGG + Intergenic
1049540607 8:143207172-143207194 CCTGGAGGGCTGGGTGAGGCTGG + Intergenic
1049580499 8:143408561-143408583 CCTGGGGGTTGGGGACTGTCTGG - Intergenic
1049594565 8:143477464-143477486 CCTGGAGGTCTGAGTCTGGCTGG - Intronic
1049865045 8:144929830-144929852 CCAGCAGGTCTGGGGGTGTCAGG - Intergenic
1050232691 9:3544515-3544537 CATGGAGGACTGGGAGTCTTGGG + Intergenic
1051920346 9:22257340-22257362 CCTGGAGATCTGTGAGGGTGGGG + Intergenic
1053218216 9:36290271-36290293 CCTGGAGCTCTGAGATTTTCTGG - Intronic
1056538927 9:87554818-87554840 ACCGGAGGTCTGAGAGTGTCAGG + Intronic
1057314581 9:93960324-93960346 CCTGGAGGGCTGGGAGCGGCGGG - Intergenic
1057910982 9:99020580-99020602 CTTGTAGGTCTGGGAGAATCAGG + Intronic
1060622670 9:125082088-125082110 CCTGGAGGTCTAGGAGAATATGG + Intronic
1060891787 9:127193708-127193730 CCTGGAGGTCTGGGTGGGCTTGG + Intronic
1061379196 9:130243948-130243970 CCTGCAGCTCTGGGTGTGCCCGG - Intergenic
1061486891 9:130924603-130924625 CCTCGAGGGCTGGGAGGGCCGGG + Intronic
1061991187 9:134159529-134159551 CCTGGAGGTCCTCGAGTGGCAGG + Exonic
1062059204 9:134485946-134485968 GCTGCAGGTCAGGGAGTGCCGGG + Intergenic
1062289862 9:135789646-135789668 CCAGGAGGTCTGGAAGCCTCTGG + Intronic
1186820345 X:13281791-13281813 CCTGGAGAACTGGCAGGGTCAGG - Intergenic
1188756333 X:33968674-33968696 CCTGGAGGCCTGCGAGCATCTGG + Intergenic
1189249309 X:39587698-39587720 CCAGGAAGGCTGGGAGTGTCTGG - Intergenic
1189327546 X:40122054-40122076 CTTGGAGGGCTGGAAGTGGCTGG - Intronic
1189327728 X:40123034-40123056 CTCGGAGGCCTGGGAGTCTCGGG + Intronic
1190362450 X:49662098-49662120 CCAGGAGCTCTGTGAGTGTTAGG - Intergenic
1190765661 X:53473621-53473643 CCTTGAGGGCTGGGAAAGTCAGG + Intergenic
1191690292 X:63932497-63932519 CCTGAAGCTCTGGGAGTAGCAGG - Intergenic
1192142183 X:68655142-68655164 ACTGGAGGTGTGCAAGTGTCTGG - Intronic
1192917898 X:75673556-75673578 CCAGGAGCCCTGGGAGTGGCTGG - Intergenic
1195651567 X:107290362-107290384 CCTGGTGTGATGGGAGTGTCAGG + Intergenic
1197897822 X:131334560-131334582 ACTGGAGGTCTGGGATTGGAGGG - Intronic
1199503572 X:148536350-148536372 CCTGGAGGGCTGGGGGTGCCTGG + Intronic