ID: 1149570766

View in Genome Browser
Species Human (GRCh38)
Location 17:57670768-57670790
Sequence CAGGTACCACATGCAGATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149570766_1149570772 18 Left 1149570766 17:57670768-57670790 CCTAAATCTGCATGTGGTACCTG 0: 1
1: 0
2: 0
3: 20
4: 150
Right 1149570772 17:57670809-57670831 ACATAACTATTTCAGAAATAGGG 0: 1
1: 0
2: 4
3: 47
4: 404
1149570766_1149570771 17 Left 1149570766 17:57670768-57670790 CCTAAATCTGCATGTGGTACCTG 0: 1
1: 0
2: 0
3: 20
4: 150
Right 1149570771 17:57670808-57670830 TACATAACTATTTCAGAAATAGG 0: 1
1: 0
2: 3
3: 28
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149570766 Original CRISPR CAGGTACCACATGCAGATTT AGG (reversed) Intronic
900633192 1:3649618-3649640 CAGGTACCCCAAGCAGATATGGG - Intronic
901428023 1:9195724-9195746 CAGGTCCTTCATGGAGATTTAGG - Intergenic
902927703 1:19707657-19707679 CACATGCCACATGCAGGTTTAGG + Intronic
902934146 1:19752376-19752398 CTGAAACCACATGCAGATTTGGG + Intronic
903105336 1:21073626-21073648 CACACGCCACATGCAGATTTCGG + Intronic
903854205 1:26326810-26326832 CACACGCCACATGCAGATTTTGG - Intronic
904341243 1:29836289-29836311 CATGGAGCAGATGCAGATTTGGG + Intergenic
905248081 1:36628568-36628590 CAGGGACCACAAGCAGGTTGTGG - Intergenic
910686833 1:89926148-89926170 CAGTTACTACATGCAGACTTGGG + Intronic
912214068 1:107587300-107587322 CTGCTACCTTATGCAGATTTGGG + Intronic
915173533 1:153995755-153995777 CACATGCCACATGCAGATTTTGG - Intronic
916155588 1:161843219-161843241 CAGGAAACTCATGCAGACTTGGG + Intronic
916800436 1:168210739-168210761 CACATGCCACATGCAGATTTTGG - Intergenic
917991002 1:180378787-180378809 CATGTGCTACCTGCAGATTTGGG + Intronic
918849617 1:189669399-189669421 CAGGTAGAACATGCAGCATTTGG - Intergenic
919892677 1:201987133-201987155 CAGGCTCCAGATGCAGAGTTGGG - Intronic
924809181 1:247386282-247386304 AAGGTAGCAGATGGAGATTTAGG + Intergenic
1070324461 10:75378826-75378848 AAGGCCCCACAAGCAGATTTTGG + Intergenic
1071488821 10:86122309-86122331 CAGGTACCACATGCTGAGCCAGG + Intronic
1073052079 10:100673856-100673878 CAGGTACAACTTACAAATTTGGG + Intergenic
1073666563 10:105540705-105540727 CTTGTATCACATGCAGACTTGGG - Intergenic
1074285242 10:112091701-112091723 CAGGTACCACAGGCATTTTCTGG - Intergenic
1078680439 11:13470489-13470511 AAGGTAGCAAATGGAGATTTGGG + Intergenic
1079049154 11:17138183-17138205 TACACACCACATGCAGATTTTGG + Intronic
1081009255 11:37787516-37787538 CAGGTACCACTTGAGGTTTTAGG + Intergenic
1083098728 11:60281132-60281154 GATGTATCACATGCAGAATTTGG + Intronic
1083484897 11:62977125-62977147 CAGGTAACACATGCAGGGTGGGG - Exonic
1084955182 11:72687419-72687441 CAGGTACCAGGTGCAGAGTGTGG - Exonic
1086700742 11:89898077-89898099 CAGGTTCAACATACAAATTTAGG - Intergenic
1086705427 11:89946450-89946472 CAGGTTCAACATACAAATTTAGG + Intergenic
1086849572 11:91793407-91793429 CAGGAACCACAAGCAAAATTAGG + Intergenic
1086956976 11:92943319-92943341 TAGGTACCTAATACAGATTTTGG + Intergenic
1087158405 11:94926344-94926366 CAGGCACCACATGCAGAGCTGGG + Intergenic
1088649726 11:111946747-111946769 CACACGCCACATGCAGATTTTGG + Intronic
1092263842 12:6966581-6966603 CATGGAACACATGCAGATTAGGG + Intronic
1093187836 12:16042145-16042167 CAGGTCCCACATTCAGTATTGGG + Intergenic
1093471696 12:19509027-19509049 CACATGCCACATGCAGATTTTGG - Intronic
1097468262 12:59954570-59954592 CAGTTACACCAAGCAGATTTAGG + Intergenic
1098714409 12:73811554-73811576 TAGGTACCAGATGCAGATCAAGG + Intergenic
1098795444 12:74882436-74882458 CAGGTCCCACTTCCAGCTTTGGG + Intergenic
1101835279 12:108290832-108290854 CAGGTCCAAAATGCAGCTTTGGG - Exonic
1102523492 12:113494166-113494188 CTGGTACCAAATGCAAATATGGG + Intergenic
1104290567 12:127462657-127462679 CAGTTACTGCATCCAGATTTGGG + Intergenic
1108210793 13:48137966-48137988 CAGGTATCACATGCAGTGCTAGG - Intergenic
1108431882 13:50361618-50361640 CACATACCACATGTAGATTTTGG + Intronic
1116108911 14:40550182-40550204 AAGGTGACAAATGCAGATTTTGG + Intergenic
1116672753 14:47864241-47864263 CAAATACCACATGCAGTTTAAGG - Intergenic
1117823578 14:59677013-59677035 CAGGGCGCACATGGAGATTTGGG - Intronic
1125843131 15:42824314-42824336 CAGGTTCAACATGCACGTTTTGG - Intronic
1126297724 15:47159606-47159628 CAGGTAACACATGGGGATTGGGG + Intergenic
1127485187 15:59412121-59412143 CTGGGCCCACATGCAGATCTAGG - Intronic
1128222939 15:65981771-65981793 CAGATACCATGTACAGATTTGGG - Intronic
1130184471 15:81666726-81666748 TAGATACTACATGCAGAATTTGG + Intergenic
1133142486 16:3757572-3757594 CAGGTACCACAGGCAGAGAGGGG + Intronic
1134012087 16:10861531-10861553 AAGGTACAACATTCAGATATAGG - Intergenic
1135201974 16:20445357-20445379 CAGTTTCCACATGCTGAATTGGG + Intergenic
1135217130 16:20582509-20582531 CAGTTTCCACATGCTGAATTGGG - Intergenic
1136144263 16:28306649-28306671 CAGGTGCCACCTCCTGATTTAGG - Intronic
1138253509 16:55529030-55529052 TAGGTCCCTCATGGAGATTTGGG - Intronic
1140880773 16:79196362-79196384 CAGGTACCCCAAGCTGGTTTGGG + Intronic
1145740971 17:27274250-27274272 CACATGCCACATGCAGATTTTGG - Intergenic
1149570766 17:57670768-57670790 CAGGTACCACATGCAGATTTAGG - Intronic
1157086600 18:44586672-44586694 CAGGCAGCACATGCAGAGCTTGG - Intergenic
1163142457 19:15359291-15359313 CATGTAGCACATGCAGAATTGGG + Intronic
1165278448 19:34774756-34774778 CAGAGACTGCATGCAGATTTTGG - Intergenic
1166162337 19:40964126-40964148 CTGATAGCATATGCAGATTTTGG - Intergenic
926065144 2:9832761-9832783 CAGGCACCACATACATCTTTAGG + Intergenic
926291042 2:11530731-11530753 CATGCACCACATGCAGGTTCTGG - Intergenic
929764649 2:44833976-44833998 CAGGTTCCACATGGAAATCTGGG + Intergenic
929977793 2:46652212-46652234 CAGATCTCACATGCAGTTTTAGG - Intergenic
930956098 2:57204655-57204677 TAGGTAGCACATTCAGGTTTAGG + Intergenic
931187234 2:59965003-59965025 GAGGTACCACTTACAGATATGGG + Intergenic
931957562 2:67444535-67444557 CAGGAAACAAATACAGATTTTGG - Intergenic
932792486 2:74667887-74667909 CAGGAGGCAGATGCAGATTTGGG - Intronic
936265240 2:110999992-111000014 CAGATACCTAATCCAGATTTGGG + Intronic
937894076 2:126963976-126963998 CAGGAATCACATGCAAATTATGG + Intergenic
939400210 2:141683125-141683147 CAGGAACCTAATACAGATTTTGG + Intronic
943883445 2:193179431-193179453 CAGAAACCATATACAGATTTGGG - Intergenic
944605716 2:201349938-201349960 CAGATCCTACATGTAGATTTTGG - Intronic
945133514 2:206600213-206600235 AAGATACAACATGCAGTTTTTGG - Intronic
945663928 2:212718985-212719007 CAGGTGCCACAAGCTGAATTTGG + Intergenic
946436756 2:219661995-219662017 CAAGTACCTCATGCAAATTCTGG + Intergenic
1169624487 20:7548966-7548988 CAGGTCACATTTGCAGATTTTGG + Intergenic
1173388204 20:42608142-42608164 GAGGTGCCAGATGCAGAGTTTGG - Intronic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1181358632 22:22318249-22318271 CAGGTGCCACATGCAACATTGGG + Intergenic
1181597382 22:23925170-23925192 CATGTAAGACATGCAGTTTTGGG - Intergenic
950120250 3:10477033-10477055 TAGGCTCCAAATGCAGATTTTGG + Intronic
950490284 3:13300519-13300541 CAGGTCCAACATGTAAATTTTGG + Intergenic
951600762 3:24372288-24372310 ATGTTACCACATGCAGAGTTAGG + Intronic
954117824 3:48476938-48476960 CAGGTCCCACATGCACACCTTGG + Intronic
955994796 3:64668792-64668814 CAGGCACCACATTCAGCTTCAGG - Intronic
956973840 3:74557501-74557523 CAGGTAGGACATACAGGTTTAGG + Intergenic
959787912 3:110322601-110322623 CAGCTACCACATGCATATACAGG + Intergenic
960709466 3:120512968-120512990 CACACACCACATGCAGATTTTGG - Intergenic
962941688 3:140130399-140130421 CAGGTACTAAATGCACATTCCGG + Intronic
964824755 3:160812801-160812823 CAGGTAGCACATGCTAAATTAGG + Intronic
965718415 3:171632521-171632543 CAGAAACCACATACATATTTAGG + Intronic
972348921 4:38217750-38217772 CAGGGATCACATGCAGACTCTGG - Intergenic
976234247 4:82878909-82878931 TAGGTACCACAAGTTGATTTGGG - Exonic
978189868 4:105898249-105898271 CAGGAAGGAGATGCAGATTTGGG - Intronic
978429847 4:108622163-108622185 CACACACCACATGCAGATTTTGG - Exonic
979622943 4:122815972-122815994 CACACACCACATACAGATTTTGG + Intergenic
979930278 4:126621363-126621385 CATGTGTCACTTGCAGATTTTGG - Intergenic
982173744 4:152685760-152685782 CAGGTAACAAATTCAGATATGGG + Intergenic
984239575 4:177201391-177201413 CAAGCACCACATGCATAGTTTGG - Intergenic
984582001 4:181520761-181520783 CAGGCACCAAATGCAGGCTTTGG + Intergenic
985606650 5:861612-861634 CAGGGACCACTTGCAGATTGTGG - Intronic
985997573 5:3605442-3605464 CTGGTGCCACATGCTGACTTCGG - Intergenic
986909742 5:12540605-12540627 CAGGTACAACATACAGTGTTTGG + Intergenic
987696381 5:21338885-21338907 CAAGTACAACATGCAGACTAAGG + Intergenic
988755820 5:34247661-34247683 CAAGTACAACATGCAGACTAAGG - Intergenic
988986937 5:36629585-36629607 CAGGTACCATAAGCAGTTGTTGG + Exonic
991534877 5:67658419-67658441 CAGGTATCACATCCAGAGTTAGG - Intergenic
991744078 5:69713517-69713539 CAAGTACAACATGCAGACTAAGG - Intergenic
991753629 5:69841719-69841741 CAAGTACAACATGCAGACTAAGG + Intergenic
991795650 5:70293241-70293263 CAAGTACAACATGCAGACTAAGG - Intergenic
991803246 5:70398446-70398468 CAAGTACAACATGCAGACTAAGG + Intergenic
991823451 5:70588785-70588807 CAAGTACAACATGCAGACTAAGG - Intergenic
991832947 5:70716844-70716866 CAAGTACAACATGCAGACTAAGG + Intergenic
991888019 5:71292760-71292782 CAAGTACAACATGCAGACTAAGG - Intergenic
993030576 5:82700848-82700870 CAGGTTCCACAGGCAGTTGTTGG - Intergenic
993494136 5:88588051-88588073 CAGGTACCCCAATCAGTTTTAGG - Intergenic
996004436 5:118404161-118404183 CAGGTACCCCAATCAGTTTTCGG + Intergenic
997556617 5:134804984-134805006 CACATGCCACCTGCAGATTTTGG + Intronic
1002631787 5:180586894-180586916 CAGGTAGCAACTGCAGATGTGGG - Intergenic
1003160048 6:3626674-3626696 CAGGGGCCACATGCAGATGTGGG + Intergenic
1003400751 6:5788554-5788576 CACACGCCACATGCAGATTTTGG + Intergenic
1004256486 6:14069183-14069205 CTGGTAACACTGGCAGATTTGGG + Intergenic
1005554466 6:26959473-26959495 CAAGTACAACATGCAGACTAAGG - Intergenic
1006369439 6:33634790-33634812 CAGGAAAGACATGCAAATTTGGG - Intronic
1007639698 6:43328257-43328279 CACACACCACATGCAGAATTTGG - Intronic
1007976556 6:46107440-46107462 TATGTACCAGATGCAGATCTTGG - Intergenic
1008620455 6:53266275-53266297 CAAGTACTAAATGCAGTTTTAGG + Intergenic
1012025250 6:93981469-93981491 CAAGTACCACTTTCACATTTTGG - Intergenic
1019069711 6:169333591-169333613 CAGGGACCAACTGCAGATTCTGG - Intergenic
1026246984 7:68629480-68629502 AAGCAACCACATGCAGGTTTTGG - Intergenic
1027959410 7:84925445-84925467 CAGCTATTACATGCAGATTTGGG - Intergenic
1028718123 7:93998136-93998158 CAGGAAGCACATACAGATTCTGG + Intronic
1032450490 7:132026229-132026251 CAGTTTCCATATGCAGACTTCGG - Intergenic
1032498514 7:132381141-132381163 CAGGTAGCACTTGCAAATTGAGG + Intronic
1032594272 7:133223813-133223835 CAGGTCCCACATGGGGATTATGG + Intergenic
1032618794 7:133505270-133505292 CAGGAACCACAGTCCGATTTTGG + Intronic
1033791705 7:144798292-144798314 CAGGTACCCCAAGCAGTTGTAGG - Intronic
1034227531 7:149495524-149495546 TAGGTCCCACATTCAGATGTGGG - Intronic
1034242704 7:149622564-149622586 TAGGTCCCACATTCAGATGTGGG - Intergenic
1034845859 7:154443817-154443839 CCGTTACCACATGCATACTTTGG - Intronic
1035012645 7:155733210-155733232 CAGGTTCCACATTCTGACTTGGG + Intronic
1036998561 8:13689328-13689350 CAGGCCCCACATCCAGCTTTGGG - Intergenic
1041125115 8:54629226-54629248 GAGGTACCATATTCACATTTTGG + Exonic
1043908968 8:85838193-85838215 CATGTACAACATGCCCATTTGGG - Intergenic
1044595844 8:93957546-93957568 TACACACCACATGCAGATTTTGG + Intergenic
1046564480 8:115881553-115881575 AAGGTACCACATTCAGTATTCGG + Intergenic
1047180269 8:122581018-122581040 AAGGAACCACATGCTGGTTTTGG + Intergenic
1048086353 8:131185114-131185136 CAGGCCCCACATCCAGCTTTGGG - Intergenic
1049473922 8:142788204-142788226 CAGGCACCAGATGCAAATGTGGG - Intergenic
1051412136 9:16800755-16800777 CAGGTACCAGATGTTGATGTTGG - Intronic
1052820633 9:33135580-33135602 CAGGCACCACATCCAGCATTAGG + Intronic
1053414577 9:37938990-37939012 CAAGGACCACATCCAGATTTCGG - Intronic
1053504179 9:38627163-38627185 CAGGTTCCATATGCAGGGTTCGG + Intergenic
1055095867 9:72413749-72413771 TAGTTGCCACATGCAAATTTTGG + Intergenic
1058083959 9:100729183-100729205 CATGTACAACATGGAGATTATGG - Intergenic
1059735807 9:117098684-117098706 CAGGGACCTCATGGAGATTTTGG + Intronic
1060663999 9:125422145-125422167 CAGGTACCACATTCACATCTGGG - Intergenic
1188591343 X:31839812-31839834 GAGGTCCCACATTCAGATGTTGG - Intronic
1189206974 X:39249617-39249639 CAGGGATCAGATGGAGATTTGGG + Intergenic
1189250540 X:39598033-39598055 CAGGTGCCACATGTTGATGTAGG - Intergenic
1190717204 X:53114756-53114778 CAGGCTTGACATGCAGATTTAGG - Intergenic
1190756322 X:53405002-53405024 CAGGCCCCACCTGCAGATTCAGG + Exonic
1193951531 X:87806621-87806643 CACATGCCACAGGCAGATTTTGG + Intergenic
1197974153 X:132147671-132147693 AAAGTACCACATGCAAATTTGGG + Intergenic