ID: 1149572778

View in Genome Browser
Species Human (GRCh38)
Location 17:57685435-57685457
Sequence CTGGAGAATACAGCTTTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149572778_1149572783 -6 Left 1149572778 17:57685435-57685457 CCCAGGAAAGCTGTATTCTCCAG No data
Right 1149572783 17:57685452-57685474 CTCCAGGACATGGCCTTCTTGGG No data
1149572778_1149572782 -7 Left 1149572778 17:57685435-57685457 CCCAGGAAAGCTGTATTCTCCAG No data
Right 1149572782 17:57685451-57685473 TCTCCAGGACATGGCCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149572778 Original CRISPR CTGGAGAATACAGCTTTCCT GGG (reversed) Intergenic
No off target data available for this crispr