ID: 1149575729

View in Genome Browser
Species Human (GRCh38)
Location 17:57711312-57711334
Sequence CACCTTTGGGGACCCTCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149575719_1149575729 29 Left 1149575719 17:57711260-57711282 CCTCAATATATTTGCTTATAGAA No data
Right 1149575729 17:57711312-57711334 CACCTTTGGGGACCCTCACATGG No data
1149575721_1149575729 1 Left 1149575721 17:57711288-57711310 CCAAATGTGTAACCCATCTCCCA No data
Right 1149575729 17:57711312-57711334 CACCTTTGGGGACCCTCACATGG No data
1149575720_1149575729 2 Left 1149575720 17:57711287-57711309 CCCAAATGTGTAACCCATCTCCC No data
Right 1149575729 17:57711312-57711334 CACCTTTGGGGACCCTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149575729 Original CRISPR CACCTTTGGGGACCCTCACA TGG Intergenic
No off target data available for this crispr