ID: 1149576293

View in Genome Browser
Species Human (GRCh38)
Location 17:57715838-57715860
Sequence GGTGATGGGCAGCCTCGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149576283_1149576293 6 Left 1149576283 17:57715809-57715831 CCTTGGCATACAGAGGAGCCATC No data
Right 1149576293 17:57715838-57715860 GGTGATGGGCAGCCTCGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149576293 Original CRISPR GGTGATGGGCAGCCTCGGGT GGG Intergenic
No off target data available for this crispr