ID: 1149577867

View in Genome Browser
Species Human (GRCh38)
Location 17:57726905-57726927
Sequence GGTCTCCTGAGCCTGGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149577854_1149577867 25 Left 1149577854 17:57726857-57726879 CCACAGATGCTGGGGGGAGCTGG No data
Right 1149577867 17:57726905-57726927 GGTCTCCTGAGCCTGGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149577867 Original CRISPR GGTCTCCTGAGCCTGGGGTT TGG Intergenic
No off target data available for this crispr