ID: 1149578232

View in Genome Browser
Species Human (GRCh38)
Location 17:57728851-57728873
Sequence CCATGGGGCCCTTTAGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149578225_1149578232 12 Left 1149578225 17:57728816-57728838 CCAAGGAAGGGAAGAGCCTGTAG No data
Right 1149578232 17:57728851-57728873 CCATGGGGCCCTTTAGATCCAGG No data
1149578224_1149578232 13 Left 1149578224 17:57728815-57728837 CCCAAGGAAGGGAAGAGCCTGTA No data
Right 1149578232 17:57728851-57728873 CCATGGGGCCCTTTAGATCCAGG No data
1149578227_1149578232 -4 Left 1149578227 17:57728832-57728854 CCTGTAGCTGGCATCTGCTCCAT No data
Right 1149578232 17:57728851-57728873 CCATGGGGCCCTTTAGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149578232 Original CRISPR CCATGGGGCCCTTTAGATCC AGG Intergenic
No off target data available for this crispr