ID: 1149585474 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:57783326-57783348 |
| Sequence | ACTCTGATGCAGAATGAGGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1149585472_1149585474 | 16 | Left | 1149585472 | 17:57783287-57783309 | CCATAGAGATAGCTTTGCTAGCA | No data | ||
| Right | 1149585474 | 17:57783326-57783348 | ACTCTGATGCAGAATGAGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1149585474 | Original CRISPR | ACTCTGATGCAGAATGAGGA AGG | Intergenic | ||
| No off target data available for this crispr | |||||