ID: 1149585474

View in Genome Browser
Species Human (GRCh38)
Location 17:57783326-57783348
Sequence ACTCTGATGCAGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149585472_1149585474 16 Left 1149585472 17:57783287-57783309 CCATAGAGATAGCTTTGCTAGCA No data
Right 1149585474 17:57783326-57783348 ACTCTGATGCAGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149585474 Original CRISPR ACTCTGATGCAGAATGAGGA AGG Intergenic
No off target data available for this crispr