ID: 1149590021

View in Genome Browser
Species Human (GRCh38)
Location 17:57822109-57822131
Sequence ATGTGGACCAACTCTCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149590021_1149590024 2 Left 1149590021 17:57822109-57822131 CCAGTGGGAGAGTTGGTCCACAT No data
Right 1149590024 17:57822134-57822156 TTTAGCCTACCATTGCTAGGAGG No data
1149590021_1149590023 -1 Left 1149590021 17:57822109-57822131 CCAGTGGGAGAGTTGGTCCACAT No data
Right 1149590023 17:57822131-57822153 TAGTTTAGCCTACCATTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149590021 Original CRISPR ATGTGGACCAACTCTCCCAC TGG (reversed) Intergenic
No off target data available for this crispr