ID: 1149591146

View in Genome Browser
Species Human (GRCh38)
Location 17:57830853-57830875
Sequence CTCCATTTTCAGATGGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149591146_1149591149 -5 Left 1149591146 17:57830853-57830875 CCTTTTCCCATCTGAAAATGGAG No data
Right 1149591149 17:57830871-57830893 TGGAGCCCCTGCCCATGCTATGG No data
1149591146_1149591150 -4 Left 1149591146 17:57830853-57830875 CCTTTTCCCATCTGAAAATGGAG No data
Right 1149591150 17:57830872-57830894 GGAGCCCCTGCCCATGCTATGGG No data
1149591146_1149591156 9 Left 1149591146 17:57830853-57830875 CCTTTTCCCATCTGAAAATGGAG No data
Right 1149591156 17:57830885-57830907 ATGCTATGGGAGTCAGCCTGTGG No data
1149591146_1149591157 16 Left 1149591146 17:57830853-57830875 CCTTTTCCCATCTGAAAATGGAG No data
Right 1149591157 17:57830892-57830914 GGGAGTCAGCCTGTGGCTGCTGG No data
1149591146_1149591159 25 Left 1149591146 17:57830853-57830875 CCTTTTCCCATCTGAAAATGGAG No data
Right 1149591159 17:57830901-57830923 CCTGTGGCTGCTGGCAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149591146 Original CRISPR CTCCATTTTCAGATGGGAAA AGG (reversed) Intergenic
No off target data available for this crispr