ID: 1149595511

View in Genome Browser
Species Human (GRCh38)
Location 17:57862507-57862529
Sequence CCCTGGAGCTGGAGGACTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 349}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149595511_1149595520 3 Left 1149595511 17:57862507-57862529 CCCAGAGTCCTCCAGCTCCAGGG 0: 1
1: 0
2: 3
3: 46
4: 349
Right 1149595520 17:57862533-57862555 CCACCCTCCCCATCCCTGCTGGG 0: 1
1: 0
2: 10
3: 83
4: 590
1149595511_1149595530 20 Left 1149595511 17:57862507-57862529 CCCAGAGTCCTCCAGCTCCAGGG 0: 1
1: 0
2: 3
3: 46
4: 349
Right 1149595530 17:57862550-57862572 GCTGGGTGACCGGGAGCTGCTGG 0: 1
1: 0
2: 2
3: 28
4: 354
1149595511_1149595524 10 Left 1149595511 17:57862507-57862529 CCCAGAGTCCTCCAGCTCCAGGG 0: 1
1: 0
2: 3
3: 46
4: 349
Right 1149595524 17:57862540-57862562 CCCCATCCCTGCTGGGTGACCGG 0: 1
1: 0
2: 2
3: 29
4: 323
1149595511_1149595526 11 Left 1149595511 17:57862507-57862529 CCCAGAGTCCTCCAGCTCCAGGG 0: 1
1: 0
2: 3
3: 46
4: 349
Right 1149595526 17:57862541-57862563 CCCATCCCTGCTGGGTGACCGGG 0: 1
1: 0
2: 4
3: 41
4: 372
1149595511_1149595518 2 Left 1149595511 17:57862507-57862529 CCCAGAGTCCTCCAGCTCCAGGG 0: 1
1: 0
2: 3
3: 46
4: 349
Right 1149595518 17:57862532-57862554 GCCACCCTCCCCATCCCTGCTGG 0: 1
1: 0
2: 6
3: 67
4: 577
1149595511_1149595531 21 Left 1149595511 17:57862507-57862529 CCCAGAGTCCTCCAGCTCCAGGG 0: 1
1: 0
2: 3
3: 46
4: 349
Right 1149595531 17:57862551-57862573 CTGGGTGACCGGGAGCTGCTGGG 0: 1
1: 0
2: 1
3: 19
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149595511 Original CRISPR CCCTGGAGCTGGAGGACTCT GGG (reversed) Exonic