ID: 1149595517

View in Genome Browser
Species Human (GRCh38)
Location 17:57862524-57862546
Sequence GATGGGGAGGGTGGCCACCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 1, 2: 4, 3: 36, 4: 445}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149595517_1149595526 -6 Left 1149595517 17:57862524-57862546 CCAGGGTGGCCACCCTCCCCATC 0: 1
1: 1
2: 4
3: 36
4: 445
Right 1149595526 17:57862541-57862563 CCCATCCCTGCTGGGTGACCGGG 0: 1
1: 0
2: 4
3: 41
4: 372
1149595517_1149595531 4 Left 1149595517 17:57862524-57862546 CCAGGGTGGCCACCCTCCCCATC 0: 1
1: 1
2: 4
3: 36
4: 445
Right 1149595531 17:57862551-57862573 CTGGGTGACCGGGAGCTGCTGGG 0: 1
1: 0
2: 1
3: 19
4: 240
1149595517_1149595524 -7 Left 1149595517 17:57862524-57862546 CCAGGGTGGCCACCCTCCCCATC 0: 1
1: 1
2: 4
3: 36
4: 445
Right 1149595524 17:57862540-57862562 CCCCATCCCTGCTGGGTGACCGG 0: 1
1: 0
2: 2
3: 29
4: 323
1149595517_1149595530 3 Left 1149595517 17:57862524-57862546 CCAGGGTGGCCACCCTCCCCATC 0: 1
1: 1
2: 4
3: 36
4: 445
Right 1149595530 17:57862550-57862572 GCTGGGTGACCGGGAGCTGCTGG 0: 1
1: 0
2: 2
3: 28
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149595517 Original CRISPR GATGGGGAGGGTGGCCACCC TGG (reversed) Exonic