ID: 1149595519 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:57862533-57862555 |
| Sequence | CCCAGCAGGGATGGGGAGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 1162 | |||
| Summary | {0: 1, 1: 1, 2: 16, 3: 134, 4: 1010} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1149595519_1149595531 | -5 | Left | 1149595519 | 17:57862533-57862555 | CCACCCTCCCCATCCCTGCTGGG | 0: 1 1: 1 2: 16 3: 134 4: 1010 |
||
| Right | 1149595531 | 17:57862551-57862573 | CTGGGTGACCGGGAGCTGCTGGG | 0: 1 1: 0 2: 1 3: 19 4: 240 |
||||
| 1149595519_1149595530 | -6 | Left | 1149595519 | 17:57862533-57862555 | CCACCCTCCCCATCCCTGCTGGG | 0: 1 1: 1 2: 16 3: 134 4: 1010 |
||
| Right | 1149595530 | 17:57862550-57862572 | GCTGGGTGACCGGGAGCTGCTGG | 0: 1 1: 0 2: 2 3: 28 4: 354 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1149595519 | Original CRISPR | CCCAGCAGGGATGGGGAGGG TGG (reversed) | Exonic | ||