ID: 1149595520

View in Genome Browser
Species Human (GRCh38)
Location 17:57862533-57862555
Sequence CCACCCTCCCCATCCCTGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 684
Summary {0: 1, 1: 0, 2: 10, 3: 83, 4: 590}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149595516_1149595520 -8 Left 1149595516 17:57862518-57862540 CCAGCTCCAGGGTGGCCACCCTC 0: 1
1: 0
2: 5
3: 22
4: 374
Right 1149595520 17:57862533-57862555 CCACCCTCCCCATCCCTGCTGGG 0: 1
1: 0
2: 10
3: 83
4: 590
1149595507_1149595520 11 Left 1149595507 17:57862499-57862521 CCTGCCTCCCCAGAGTCCTCCAG 0: 1
1: 0
2: 3
3: 64
4: 512
Right 1149595520 17:57862533-57862555 CCACCCTCCCCATCCCTGCTGGG 0: 1
1: 0
2: 10
3: 83
4: 590
1149595509_1149595520 4 Left 1149595509 17:57862506-57862528 CCCCAGAGTCCTCCAGCTCCAGG 0: 1
1: 0
2: 6
3: 47
4: 422
Right 1149595520 17:57862533-57862555 CCACCCTCCCCATCCCTGCTGGG 0: 1
1: 0
2: 10
3: 83
4: 590
1149595515_1149595520 -5 Left 1149595515 17:57862515-57862537 CCTCCAGCTCCAGGGTGGCCACC 0: 1
1: 1
2: 1
3: 46
4: 431
Right 1149595520 17:57862533-57862555 CCACCCTCCCCATCCCTGCTGGG 0: 1
1: 0
2: 10
3: 83
4: 590
1149595511_1149595520 3 Left 1149595511 17:57862507-57862529 CCCAGAGTCCTCCAGCTCCAGGG 0: 1
1: 0
2: 3
3: 46
4: 349
Right 1149595520 17:57862533-57862555 CCACCCTCCCCATCCCTGCTGGG 0: 1
1: 0
2: 10
3: 83
4: 590
1149595513_1149595520 2 Left 1149595513 17:57862508-57862530 CCAGAGTCCTCCAGCTCCAGGGT 0: 1
1: 0
2: 1
3: 44
4: 382
Right 1149595520 17:57862533-57862555 CCACCCTCCCCATCCCTGCTGGG 0: 1
1: 0
2: 10
3: 83
4: 590
1149595508_1149595520 7 Left 1149595508 17:57862503-57862525 CCTCCCCAGAGTCCTCCAGCTCC 0: 1
1: 0
2: 3
3: 57
4: 548
Right 1149595520 17:57862533-57862555 CCACCCTCCCCATCCCTGCTGGG 0: 1
1: 0
2: 10
3: 83
4: 590
1149595506_1149595520 12 Left 1149595506 17:57862498-57862520 CCCTGCCTCCCCAGAGTCCTCCA 0: 1
1: 0
2: 15
3: 51
4: 560
Right 1149595520 17:57862533-57862555 CCACCCTCCCCATCCCTGCTGGG 0: 1
1: 0
2: 10
3: 83
4: 590
1149595505_1149595520 24 Left 1149595505 17:57862486-57862508 CCAAATTAAAGACCCTGCCTCCC 0: 1
1: 0
2: 0
3: 28
4: 246
Right 1149595520 17:57862533-57862555 CCACCCTCCCCATCCCTGCTGGG 0: 1
1: 0
2: 10
3: 83
4: 590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149595520 Original CRISPR CCACCCTCCCCATCCCTGCT GGG Exonic