ID: 1149595526

View in Genome Browser
Species Human (GRCh38)
Location 17:57862541-57862563
Sequence CCCATCCCTGCTGGGTGACC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 372}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149595506_1149595526 20 Left 1149595506 17:57862498-57862520 CCCTGCCTCCCCAGAGTCCTCCA 0: 1
1: 0
2: 15
3: 51
4: 560
Right 1149595526 17:57862541-57862563 CCCATCCCTGCTGGGTGACCGGG 0: 1
1: 0
2: 4
3: 41
4: 372
1149595511_1149595526 11 Left 1149595511 17:57862507-57862529 CCCAGAGTCCTCCAGCTCCAGGG 0: 1
1: 0
2: 3
3: 46
4: 349
Right 1149595526 17:57862541-57862563 CCCATCCCTGCTGGGTGACCGGG 0: 1
1: 0
2: 4
3: 41
4: 372
1149595515_1149595526 3 Left 1149595515 17:57862515-57862537 CCTCCAGCTCCAGGGTGGCCACC 0: 1
1: 1
2: 1
3: 46
4: 431
Right 1149595526 17:57862541-57862563 CCCATCCCTGCTGGGTGACCGGG 0: 1
1: 0
2: 4
3: 41
4: 372
1149595516_1149595526 0 Left 1149595516 17:57862518-57862540 CCAGCTCCAGGGTGGCCACCCTC 0: 1
1: 0
2: 5
3: 22
4: 374
Right 1149595526 17:57862541-57862563 CCCATCCCTGCTGGGTGACCGGG 0: 1
1: 0
2: 4
3: 41
4: 372
1149595507_1149595526 19 Left 1149595507 17:57862499-57862521 CCTGCCTCCCCAGAGTCCTCCAG 0: 1
1: 0
2: 3
3: 64
4: 512
Right 1149595526 17:57862541-57862563 CCCATCCCTGCTGGGTGACCGGG 0: 1
1: 0
2: 4
3: 41
4: 372
1149595517_1149595526 -6 Left 1149595517 17:57862524-57862546 CCAGGGTGGCCACCCTCCCCATC 0: 1
1: 1
2: 4
3: 36
4: 445
Right 1149595526 17:57862541-57862563 CCCATCCCTGCTGGGTGACCGGG 0: 1
1: 0
2: 4
3: 41
4: 372
1149595513_1149595526 10 Left 1149595513 17:57862508-57862530 CCAGAGTCCTCCAGCTCCAGGGT 0: 1
1: 0
2: 1
3: 44
4: 382
Right 1149595526 17:57862541-57862563 CCCATCCCTGCTGGGTGACCGGG 0: 1
1: 0
2: 4
3: 41
4: 372
1149595508_1149595526 15 Left 1149595508 17:57862503-57862525 CCTCCCCAGAGTCCTCCAGCTCC 0: 1
1: 0
2: 3
3: 57
4: 548
Right 1149595526 17:57862541-57862563 CCCATCCCTGCTGGGTGACCGGG 0: 1
1: 0
2: 4
3: 41
4: 372
1149595509_1149595526 12 Left 1149595509 17:57862506-57862528 CCCCAGAGTCCTCCAGCTCCAGG 0: 1
1: 0
2: 6
3: 47
4: 422
Right 1149595526 17:57862541-57862563 CCCATCCCTGCTGGGTGACCGGG 0: 1
1: 0
2: 4
3: 41
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149595526 Original CRISPR CCCATCCCTGCTGGGTGACC GGG Exonic
900089672 1:914423-914445 CCCATCCCGCCAGGGTCACCAGG + Intergenic
900236494 1:1594131-1594153 TCCATCCCTCCTGGGGCACCTGG + Intergenic
900313326 1:2045067-2045089 CACTTCCCTGCTGGCTGTCCTGG - Intergenic
900338352 1:2175736-2175758 CCCATCCCTCCTCGGGGCCCTGG - Intronic
900482487 1:2905809-2905831 CCCATCCCTGCTGTGGGTTCAGG - Intergenic
900612911 1:3551937-3551959 CCAAGCCTTGCTGGGTGCCCAGG + Intronic
900902867 1:5528536-5528558 CACACCCCTGCTGGGAGGCCGGG + Intergenic
901390978 1:8945913-8945935 CCTGTTCCTGCTGGGTGGCCAGG + Exonic
901839429 1:11944738-11944760 CCAATCCCTGCTGGGCCGCCTGG + Intronic
902148144 1:14420697-14420719 GCCGTCTCTGCTGGGGGACCTGG + Intergenic
902658577 1:17886237-17886259 CCCAGCCCTGCTGTGTGTGCAGG - Intergenic
902768892 1:18634325-18634347 CCCCTCCCAGCTGATTGACCCGG - Exonic
902872983 1:19325399-19325421 CATATCCCAGCTGGGTGACCCGG - Intronic
903539646 1:24089792-24089814 CCCAGCATTGCTGAGTGACCTGG - Intronic
904032602 1:27542649-27542671 CCCTTACCAGCTAGGTGACCTGG - Intronic
904205331 1:28851043-28851065 CCCATCTCTCCTAGGTGAACTGG - Intronic
904491022 1:30859147-30859169 CCCACCCCTGCTGGGTGTTATGG + Intergenic
904501000 1:30912879-30912901 CACTTCCTGGCTGGGTGACCTGG - Intergenic
905461694 1:38126530-38126552 CCCACCCCTGCTGGGTCCCCGGG + Intergenic
905629468 1:39510758-39510780 CCCAGCCCTGCAGGGAAACCTGG - Intronic
905668292 1:39775435-39775457 CCCAGCCCTGCAGGGAAACCTGG + Intronic
910625531 1:89302901-89302923 CCCCTCCCTGGTGGGCTACCAGG - Intergenic
911121420 1:94300882-94300904 CCCAACCCTGCTCAGTAACCTGG - Intergenic
912715212 1:111978668-111978690 CACCTCCCTCCTGGGGGACCAGG + Intronic
913123951 1:115768140-115768162 CACATCCCAGCTGTGTGACAAGG + Intronic
913996343 1:143654176-143654198 CCCATCCCCGCTGGGACACTAGG - Intergenic
915536695 1:156540701-156540723 CCCATACCTGCAGAGTGATCCGG + Exonic
916075521 1:161198098-161198120 CCTAACTCTGCTGGGGGACCTGG - Exonic
916912225 1:169363201-169363223 TACATTCCTGCTGGGTGACAGGG + Intronic
918306391 1:183250577-183250599 CCTACACCTGCTGGCTGACCTGG + Exonic
920032665 1:203046564-203046586 CACATCCCTGCAGGGTGATGAGG - Intronic
920415174 1:205794812-205794834 CCCATCCCTGCAGGGCATCCTGG + Intronic
920676678 1:208043019-208043041 TGCATCCCTGCTGGGTGGCTGGG + Intronic
923367497 1:233277237-233277259 TCAATCCCTGCTGGGAGGCCTGG + Intronic
923414227 1:233739094-233739116 CACATTCCTGCGTGGTGACCTGG + Intergenic
923558651 1:235021741-235021763 CCCATCCTTGCTGGGTGTCCAGG - Intergenic
1063679300 10:8171924-8171946 CCCATGCCTGCTAGCTCACCAGG - Intergenic
1064179026 10:13099446-13099468 CCCATCCCTGCAGCGCTACCCGG + Intronic
1065265044 10:23966050-23966072 CACATCCCTGCTGGCAGACCTGG + Intronic
1066288521 10:33992107-33992129 CCCAGCCCAGCTGGTTGCCCTGG - Intergenic
1066433334 10:35373364-35373386 CCCAACACTGCTGGGTGGCAAGG - Intronic
1067281982 10:44879978-44880000 CTCATGCCTGCTGGGTTTCCTGG + Intergenic
1068455544 10:57250004-57250026 GCCAGCACTGCTGGGGGACCTGG - Intergenic
1068554952 10:58448451-58448473 GCCAGCACTGCTGGGGGACCCGG + Intergenic
1069635467 10:69922331-69922353 CCCATCACTGCAGGGTGCTCAGG - Intronic
1069869913 10:71526840-71526862 CCCATCTCTGCTCTGTGACGTGG - Intronic
1071963774 10:90832372-90832394 GCCAGCACTGCTGGGGGACCCGG + Intronic
1072668064 10:97408881-97408903 CACATCCCAGCTGCGTGAGCCGG + Intronic
1072806930 10:98429700-98429722 CCCATCCCTCCTGGGAGAGCAGG - Intronic
1072973618 10:100038683-100038705 CCCACCCCTGCTGCCTGCCCGGG + Intergenic
1074807811 10:117071625-117071647 CCCAGCCCTGATGGCTGGCCAGG - Intronic
1075504997 10:123013699-123013721 GCCAGCACTGCTGGGGGACCCGG + Intronic
1076109826 10:127851787-127851809 CCCATCCCCTCTAGGTGAGCGGG + Intergenic
1076191089 10:128483912-128483934 CCCTTCCCAGCTGAGTGGCCTGG + Intergenic
1076682735 10:132182399-132182421 TCCATTCCTGCTGGGAGACCCGG + Exonic
1077119281 11:899431-899453 CCCATCCCTCCTGGGCCTCCAGG - Intronic
1077195803 11:1279370-1279392 CACATCCGTGCTTGGTAACCAGG - Intronic
1077281477 11:1748077-1748099 CCCAGCCCCGCTGGGAGACCCGG - Exonic
1077413807 11:2415243-2415265 CCCGGGCCTGCTGGGTGCCCAGG + Exonic
1077492130 11:2866436-2866458 CCCAGCTCTGCAGGATGACCTGG - Intergenic
1077549908 11:3195599-3195621 CCCAGCCCTGCACGGTGACAGGG - Intergenic
1077551125 11:3200782-3200804 CCCTTCCCTGCAGGGGGCCCGGG - Intergenic
1078469974 11:11578937-11578959 CCCATCCCTTTTGGGTTTCCAGG - Intronic
1078779266 11:14421639-14421661 CCCATCCCCGCTGGGCAACCAGG - Intergenic
1080107495 11:28525995-28526017 GCCAGCACTGCTGGGGGACCTGG + Intergenic
1080573797 11:33580083-33580105 CCCATCACCTCTGGGTGACAAGG + Intronic
1083303351 11:61750148-61750170 CCCATCCCCACGGGGTGGCCTGG + Intergenic
1083682425 11:64357731-64357753 CCAATCCCTGCTGGCTACCCAGG - Intergenic
1083896223 11:65621052-65621074 CCCGTCCCTCCTGGGGCACCTGG - Intronic
1084330069 11:68425016-68425038 CACAGCCCAGCTGGGTGCCCTGG + Intronic
1084430238 11:69106851-69106873 CCCTCACCTGCTGAGTGACCAGG + Intergenic
1085179516 11:74521738-74521760 CACATCCTAGCTGGGTGACCTGG + Intronic
1086087573 11:82970838-82970860 GCCAGCACTGCTGGGGGACCCGG - Intergenic
1087407308 11:97745813-97745835 GCCAGCACTGCTGGGGGACCCGG + Intergenic
1089560046 11:119339249-119339271 GCCAGCCCTCCTGGATGACCTGG + Exonic
1089742906 11:120597257-120597279 TCCTTACCTGCTGGGTGACGGGG + Intronic
1090802386 11:130181020-130181042 CTCATCCCTGCTGGGTGGGATGG + Intronic
1091658094 12:2360378-2360400 AGCATCCCTGCTGGGTCACTTGG + Intronic
1091899900 12:4136224-4136246 CCCATCCCTTCTTGGTGATGGGG + Intergenic
1091992571 12:4967865-4967887 CCAATACATGCTAGGTGACCAGG + Intergenic
1092263530 12:6964683-6964705 CCCATCCCTGCGGGGAGACAAGG - Intergenic
1093921674 12:24866242-24866264 GCCAGCACTGCTGGGGGACCCGG - Intronic
1096611784 12:52806833-52806855 CCCATTCCAGGTGGGTCACCAGG + Exonic
1097184135 12:57187573-57187595 CCCTTCCCTGCTGTGTGATCTGG + Intronic
1100451345 12:94709900-94709922 CCCATCATAGCTGGGTGGCCTGG - Intergenic
1101214595 12:102567713-102567735 CCCTTACCAGCTGTGTGACCTGG - Intergenic
1101409637 12:104457685-104457707 CCCATCCCGACGCGGTGACCCGG - Intronic
1101428825 12:104609610-104609632 CCCAGCCCAGCTGTATGACCTGG + Intronic
1101587236 12:106095472-106095494 CACTTCCCAGTTGGGTGACCTGG + Intronic
1101603849 12:106233176-106233198 GCCAGCACTGCTGGGGGACCCGG - Intergenic
1101655432 12:106716186-106716208 CCCATCCCAGCTGACTGCCCAGG + Intronic
1102010115 12:109612999-109613021 CCCAGCCCTGCTGGGGGCCAGGG - Intergenic
1102099993 12:110270762-110270784 CCCTTCCCTGCCGGGTGCCAGGG - Intergenic
1104311710 12:127659031-127659053 CTCCTGCCAGCTGGGTGACCTGG - Intergenic
1105577661 13:21669163-21669185 CCCATCACTGCTGGCTGCCTCGG + Intergenic
1105923747 13:24987793-24987815 CCCCTCCCAGCTGGGTGTCAGGG + Intergenic
1106314246 13:28579279-28579301 TCCATCCCTGGTGGGGGCCCAGG - Intergenic
1106558143 13:30827655-30827677 CCCATCCTTGCTGGGTGGACTGG - Intergenic
1108213312 13:48159674-48159696 CCCATTTCTGCAGGGTGACAGGG - Intergenic
1109633773 13:65086107-65086129 CCCTTCCCTACTGGGGGCCCAGG - Intergenic
1111006652 13:82258125-82258147 GCCAGCACTGCTGGGGGACCCGG - Intergenic
1112226508 13:97545442-97545464 GCCAGCACTGCTGGGGGACCTGG - Intergenic
1114155554 14:20099363-20099385 GCCAGCACTGCTGGGGGACCTGG - Intergenic
1114430668 14:22657674-22657696 CCCCCTCCAGCTGGGTGACCAGG + Intergenic
1114493889 14:23119505-23119527 CCACTCCCTGCTGGGAGGCCAGG + Exonic
1115640495 14:35332729-35332751 CCCATCATTGCAGGGAGACCTGG + Intergenic
1116076064 14:40112625-40112647 CCTACCCCTGCTGGCTGCCCTGG - Intergenic
1118260791 14:64244868-64244890 CCCATCCCTGCTTTGCAACCTGG + Intronic
1120209863 14:81623962-81623984 GCCAGCACTGCTGGGGGACCGGG + Intergenic
1120215734 14:81679388-81679410 GCCAGCACTGCTGGGGGACCCGG + Intergenic
1120704762 14:87734947-87734969 GCCAGCACTGCTGGGGGACCCGG + Intergenic
1121504616 14:94467314-94467336 CCCATTCCTGGTGGGCGAGCAGG - Exonic
1121537802 14:94703132-94703154 CACTTCCTTGCTGGGTGATCTGG - Intergenic
1121971825 14:98365178-98365200 TCCATCCTTGCAGGGTTACCAGG - Intergenic
1122130108 14:99600023-99600045 TGCAGCCCTGCTGGGTGCCCTGG - Intronic
1123759624 15:23422427-23422449 CCCCTCGATGCTGTGTGACCCGG - Intergenic
1124061581 15:26298257-26298279 GCCAGCACTGCTGGGGGACCCGG + Intergenic
1124818465 15:33019673-33019695 GCCAGCACTGCTGGGAGACCCGG + Intronic
1128557596 15:68642256-68642278 CCCAACCCTGCTGTGTGACTTGG - Intronic
1129033734 15:72637372-72637394 CCCAGCCCTGCTGTGGGACTTGG + Intergenic
1129216147 15:74099844-74099866 CCCAGCCCTGCTGTGGGACTTGG - Intergenic
1129452957 15:75661008-75661030 CCCTGCCCTGCTGGGTGATAAGG - Exonic
1129751147 15:78065394-78065416 CTCAGCCCAGCTGGGTGGCCTGG - Intronic
1129753263 15:78080617-78080639 CTCATCTGTGCTGGGTGACCAGG - Intronic
1129890154 15:79066561-79066583 TCCTTCCCTACTGGGTCACCAGG + Intronic
1131063194 15:89416957-89416979 CCCATCCCTGCGGCTAGACCGGG + Intergenic
1132547353 16:539509-539531 GCCACCCCTGCTGGGAGGCCTGG - Intronic
1132606024 16:794090-794112 CACACTCCTGCTGGGTGACGGGG + Exonic
1132724748 16:1333847-1333869 CCCGTGCCTCCTGGGGGACCCGG - Intronic
1133037228 16:3040532-3040554 CCCCTGCATGCTGGGTGGCCAGG - Intergenic
1133342378 16:5045087-5045109 CCCACCCCTGCGGGGGGATCTGG + Intronic
1134089829 16:11385479-11385501 CCAATGCCTGCTGGGTGCCCCGG + Intronic
1134456722 16:14400469-14400491 CCCCTCGATGCTGTGTGACCCGG + Intergenic
1135547659 16:23376904-23376926 CCCATCCCTGCCTGGTGGACAGG - Intronic
1136477828 16:30524494-30524516 CCCACCCCTGCTGGGGCCCCAGG + Exonic
1136560246 16:31034634-31034656 CCCAGGCCTGCTGTGTGACCTGG - Intronic
1137005258 16:35269931-35269953 CTCTTTCCAGCTGGGTGACCTGG - Intergenic
1137727971 16:50669869-50669891 CCCAGGCCTACTGTGTGACCAGG - Intronic
1139339524 16:66259013-66259035 CACTTCCCAGCTGTGTGACCTGG - Intergenic
1139420913 16:66849047-66849069 CCCTTCCATGATGGGTGACCAGG - Intronic
1139469251 16:67169653-67169675 CCCACTCCTGCTGGATGTCCAGG + Exonic
1139480517 16:67227984-67228006 CTCAGCCCTGCTTGGTGACGAGG + Intronic
1141006623 16:80358764-80358786 CCCATATCTGCTGAGTGCCCTGG - Intergenic
1141546746 16:84775579-84775601 CCCAACCTGGCTGGGTGACCAGG - Intronic
1141647387 16:85375024-85375046 CCACTCGCTGCTGTGTGACCTGG + Intergenic
1141790610 16:86231834-86231856 ATCATGCCTGCTGGATGACCCGG - Intergenic
1142273100 16:89101236-89101258 TCCATCCCTGCTCTGGGACCGGG - Exonic
1142567938 17:852705-852727 CCCAACCGTGCAGGGGGACCTGG - Intronic
1144050020 17:11490453-11490475 TTCCTCCCTGCTCGGTGACCTGG - Intronic
1144185957 17:12795112-12795134 CCCAGCCCTGCTGGGCTAACAGG - Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1145278381 17:21450523-21450545 CCCATCACAGCTGGGGCACCAGG - Intergenic
1145401074 17:22533513-22533535 CCCATCACGGCTGGGGCACCAGG + Intergenic
1146173066 17:30647674-30647696 CCCTTCCTTGCTGGGTGCCGTGG - Intergenic
1146346525 17:32063707-32063729 CCCTTCCTTGCTGGGTGCCGTGG - Intergenic
1146626430 17:34438745-34438767 CCATTCCTTGCTGTGTGACCTGG + Intergenic
1146705517 17:34998248-34998270 CCAATCCCTCCTGGATCACCCGG - Exonic
1147139822 17:38454547-38454569 CCCACCCCTGGTAGGGGACCTGG + Intronic
1147744923 17:42689095-42689117 GCCATTCCTACTGGGAGACCAGG - Intronic
1147927197 17:43953291-43953313 CTCACCGCTGCCGGGTGACCAGG + Exonic
1147941898 17:44054682-44054704 CCCATCACTGCTGAGTGGCAGGG - Intronic
1149595526 17:57862541-57862563 CCCATCCCTGCTGGGTGACCGGG + Exonic
1149683368 17:58520789-58520811 CCCATCCCTGCTGTCCCACCAGG - Exonic
1149916390 17:60613780-60613802 GCCAGCACTGCTGGGGGACCCGG - Intronic
1150788275 17:68180014-68180036 GCCAGCACTGCTGGGGGACCCGG - Intergenic
1151559491 17:74862782-74862804 CCCTTCCCTGCTGGGGGCCGGGG + Exonic
1151723674 17:75872841-75872863 CCCTTCACTGCCGGGTGAGCTGG + Intergenic
1152146430 17:78571535-78571557 CTCGTCCCAGCTGGGCGACCGGG - Intronic
1152281102 17:79385265-79385287 CCCCGCCCTGCTGGGTGCTCTGG - Intronic
1152928833 17:83099918-83099940 CCCCTCCCTGCTGGGTGAGCCGG - Intergenic
1153396899 18:4632790-4632812 CCCTTCCCTGCACTGTGACCTGG - Intergenic
1154294109 18:13134877-13134899 GCCAGCACTGCTGGGGGACCCGG + Intergenic
1154301102 18:13193363-13193385 CCCTTCCTTCCTGGGAGACCTGG - Intergenic
1156657832 18:39309259-39309281 TCCAGCACTGCTGGGGGACCTGG - Intergenic
1158673802 18:59500624-59500646 CCCCTCCCTGCTGGATTTCCAGG - Intronic
1158759485 18:60367790-60367812 CCCAACCCTGCTGGTGGCCCAGG - Intergenic
1160134712 18:76262415-76262437 GCCTTCCCTGCTGGCTGTCCTGG - Intergenic
1160145046 18:76356888-76356910 GCCCTCACTGCTGGGTGATCAGG + Intergenic
1160190042 18:76708317-76708339 CCCATCCCTGCTGTCTGAGCTGG - Intergenic
1160312338 18:77807455-77807477 CACATCCCTGCCGGGTGAAGGGG - Intergenic
1160875084 19:1293163-1293185 GCCTCCCCTGCAGGGTGACCTGG + Intronic
1160978944 19:1807600-1807622 CTCACACCTGCAGGGTGACCTGG - Intronic
1160992275 19:1864620-1864642 CCCCGCCCTGCTGGGACACCGGG + Intergenic
1161124095 19:2546324-2546346 CCAGGCCCTGCTGGGCGACCTGG - Intronic
1161299423 19:3535725-3535747 CCCATGCCTGCTGGGTGGCTGGG + Intronic
1161720117 19:5897789-5897811 ACCGTCCCTGCTGGGTGCCTAGG + Intronic
1162141261 19:8586704-8586726 CCCAGCCCTGAAGGGAGACCAGG - Exonic
1162344940 19:10113501-10113523 CCCCTCCCTGGAGGGGGACCGGG - Intronic
1162989356 19:14292383-14292405 CCCTTCCATGCTGGGTGCCGTGG + Intergenic
1165077754 19:33290277-33290299 CACACACCTGCTGTGTGACCCGG - Intergenic
1165272836 19:34725140-34725162 CTCTTTCCAGCTGGGTGACCTGG + Intergenic
1165342986 19:35225452-35225474 CCCTTACTGGCTGGGTGACCTGG + Intronic
1165486527 19:36099893-36099915 CCCATTCCTGTTGTGTGACCTGG + Intronic
1165927192 19:39334301-39334323 CCCATCTCGGCTGGGTGCCGTGG - Intronic
1166567177 19:43772328-43772350 CTCCTCTCTGCTGTGTGACCTGG + Intronic
1167233151 19:48297781-48297803 CCCTTCCCTTCTGGGGCACCCGG + Intronic
1167528519 19:50000549-50000571 TGCTTCCCTGCTGTGTGACCTGG - Intronic
1167569794 19:50280024-50280046 CCCTTCCCTGCAGGCTGAACTGG + Exonic
1168330639 19:55565864-55565886 ACCACCCCTGCCAGGTGACCAGG + Intergenic
1168658809 19:58150394-58150416 GCCACGCCTGCTGGGTGTCCTGG - Intronic
1202707217 1_KI270713v1_random:32554-32576 CCCATCCCCGCTGGGACACTAGG - Intergenic
925140380 2:1546182-1546204 CCCCCACCTGCTGGGTGACTTGG + Intergenic
926747055 2:16167520-16167542 CCAAGCACTGCTGGGTGACGAGG + Intergenic
927138900 2:20116341-20116363 CCCTTGCCTGCTGTGTGACCTGG + Intergenic
928490452 2:31778010-31778032 CTGAACCCTGCTGGGTGATCTGG + Intergenic
928617937 2:33057622-33057644 GCCAGCACTGCTGGGGGACCTGG + Intronic
931348708 2:61470456-61470478 CCCAGCCCGGCCGGGTTACCTGG - Intronic
932222401 2:70009963-70009985 CCCATACCTGCTGGGAGTCACGG - Intergenic
934992012 2:98928519-98928541 GCCCTCCCTGCTGGCTGGCCTGG + Intronic
935635261 2:105244929-105244951 CCCCACCTTGCTGGGGGACCTGG - Intergenic
937309820 2:120895123-120895145 GCCATCCCTGCAGGCTGGCCTGG + Intronic
938146795 2:128841282-128841304 TACATCCCTGGTGAGTGACCCGG - Intergenic
938422682 2:131156883-131156905 GCCGTCCCTGCTGTGTGGCCTGG - Intronic
940276659 2:151947204-151947226 CCCATCCCTGTTGTTTCACCTGG - Intronic
941309254 2:163909688-163909710 GCCAGCACTGCTGGGGGACCCGG - Intergenic
945739101 2:213639569-213639591 CCCATCCCTGCTAGCTTACAGGG + Intronic
946392705 2:219426157-219426179 CCCATCCCTGCCTGGTCACAGGG + Exonic
948157030 2:235791832-235791854 CTCTTCCCGGCTGGGTGAGCTGG - Intronic
948705796 2:239791874-239791896 GCCACCCCTGCTGGGGGAACGGG - Intronic
948711548 2:239828612-239828634 TCCATCCCTGCTGGAAGCCCAGG - Intergenic
948767493 2:240230806-240230828 CCCAGCTCTGCTGGGGGTCCAGG + Intergenic
1171199831 20:23231983-23232005 CCCAATCCTGCTGGATGACCTGG + Intergenic
1171488532 20:25500733-25500755 CACACCCCTGCTGGGTCCCCTGG + Intronic
1172355561 20:34277259-34277281 CCCAGACCTGCAGAGTGACCCGG + Intergenic
1172778059 20:37419753-37419775 CCCTACCCTGCTGGGGGCCCTGG + Intergenic
1173188962 20:40861857-40861879 CTCATGCCTGCTGGCTGAGCAGG - Intergenic
1173454398 20:43191001-43191023 CCCATCCTTGTTGGGGTACCAGG + Intergenic
1173579957 20:44140255-44140277 TCCATCCCAGCTGGGTGGTCAGG + Intronic
1173860965 20:46283333-46283355 CCGATTCCAGCTGCGTGACCTGG + Intronic
1174450413 20:50616702-50616724 CTCTTCTCTGCTGTGTGACCGGG - Intronic
1174535437 20:51247787-51247809 GCCATTTCTGCTGGGTGACTTGG + Intergenic
1175399853 20:58693819-58693841 CCCTGCCCTGCAGGGTGAGCCGG + Exonic
1175470441 20:59223297-59223319 CCAATCGCTGCACGGTGACCAGG + Intronic
1175990591 20:62786573-62786595 CCCCACCCTGCTGGGAGCCCAGG + Intergenic
1176168211 20:63685556-63685578 CCCAGCCCTGCTGGGGAACCAGG - Exonic
1176369131 21:6052048-6052070 CTCATGTCTGCTGGGTGACTTGG + Intergenic
1176970343 21:15257945-15257967 CCATTCCTTGCTAGGTGACCTGG - Intergenic
1178811102 21:35882210-35882232 CCCTTACCAGCTGGGTGACCTGG + Intronic
1179754388 21:43486493-43486515 CTCATGTCTGCTGGGTGACTTGG - Intergenic
1179940427 21:44636223-44636245 CCCAACCCTGCCGGGTTTCCAGG + Intronic
1181009451 22:20032017-20032039 CCCATCCCTGCCATGTGACCTGG + Intronic
1182759560 22:32711180-32711202 CCCATAACAGCTGGGTGGCCAGG + Intronic
1182863581 22:33582647-33582669 GGCGTACCTGCTGGGTGACCAGG - Intronic
1183020053 22:35019553-35019575 CCTGGCCCTGCTGTGTGACCTGG - Intergenic
1183180712 22:36257947-36257969 CACATCCCCTCTGTGTGACCTGG + Intronic
1183244520 22:36683697-36683719 TCCTTCCCTGCTGGTTGACAGGG + Intronic
1183279822 22:36926046-36926068 CCCATCCCCGCTGCGTGCCCAGG + Exonic
1183282792 22:36941592-36941614 CCCTTACCTGCTGGCAGACCTGG - Intergenic
1183374521 22:37455312-37455334 CACATCCCTGCTCCGTGAACTGG + Intergenic
1183623089 22:38986178-38986200 CCCACCCCTGCAGGCTGCCCTGG - Intronic
1183629646 22:39025436-39025458 CCCACCCCTGCAGGCTGCCCTGG - Intronic
1183630916 22:39032063-39032085 CCCATCCCTGCAGGCTTCCCGGG - Intronic
1183834137 22:40438138-40438160 CCAATTACTGCTGGGTGACATGG + Intronic
1184709158 22:46238075-46238097 ACCATCGCTGCTGAGTGTCCCGG - Exonic
1184919955 22:47599123-47599145 CCCATCCCTGCAGAGTGTCCTGG - Intergenic
1185014245 22:48334076-48334098 CCCATCTTTGCTGGGCGCCCAGG + Intergenic
1185277870 22:49957564-49957586 CCCATCCCGACTGCTTGACCTGG - Intergenic
949805567 3:7952056-7952078 CCCAACTCTGCTGGGTGAGCTGG + Intergenic
949810503 3:8001718-8001740 GCCATCCCTGCTGTGTGGCTTGG + Intergenic
949891409 3:8736378-8736400 CTCATCCTTGCTGGGTGCCAGGG - Intronic
950090380 3:10290530-10290552 CCCCTCCCTGCTGAGTGCCCTGG - Intronic
950250367 3:11460353-11460375 GCCACCCCTGCTGAGTGAGCTGG - Intronic
951024853 3:17817880-17817902 GCCAGCACTGCTGGGGGACCTGG + Intronic
952899778 3:38102330-38102352 CCTTCCCCTGCTGGGTGACAGGG + Intronic
953928950 3:46996507-46996529 CACATCCCTGGAGGGTGAGCTGG + Exonic
954130317 3:48557236-48557258 CCCCTCCCTCCTGGGGGCCCTGG - Intronic
954331970 3:49895978-49896000 CCCATCCCTGCAGCTTGGCCAGG - Exonic
955122912 3:56079532-56079554 CCCAATCCTGCAGGGTGTCCTGG + Intronic
955463253 3:59208755-59208777 CCCCTCCTTGCTGGGTGATCAGG + Intergenic
955520749 3:59773246-59773268 CACAGCCCCGGTGGGTGACCCGG + Intronic
955707987 3:61748313-61748335 TGCATACCTACTGGGTGACCTGG + Intronic
956422870 3:69102613-69102635 CACATTCCTGCTGTATGACCTGG - Intronic
961554007 3:127685276-127685298 CCCAGCGCTGCACGGTGACCAGG - Intergenic
964393777 3:156224116-156224138 GCCAGCACTGCTGGGGGACCCGG + Intronic
967386881 3:188920668-188920690 CCCAGCTTTGCTAGGTGACCTGG - Intergenic
967832804 3:193935387-193935409 CCCCTCCTTGCACGGTGACCTGG - Intergenic
967996191 3:195168549-195168571 CCCATGCTTGCTGGGTGACTGGG - Intronic
968454158 4:688789-688811 CCCAGCCCTGCTCTGTGCCCTGG + Intronic
968579306 4:1382559-1382581 TCCATCTCTGCTGGGTGCCGGGG + Intronic
968826433 4:2901178-2901200 CACAGCCATGCTGGATGACCTGG - Intronic
968968060 4:3779387-3779409 CCCTCCCCTGCTGGGGTACCTGG - Intergenic
969258456 4:6019047-6019069 CCCATCCCACCTGTGGGACCCGG - Intergenic
969578178 4:8048520-8048542 CTCCTCCCAGCTGTGTGACCTGG - Intronic
969625880 4:8305439-8305461 CACATGCCAGCTGTGTGACCTGG - Intronic
969671941 4:8594472-8594494 CTCAACTCTGCTGTGTGACCTGG + Intronic
971372116 4:26028042-26028064 CCTATCCCTGCTGGGCAGCCAGG - Intergenic
971611512 4:28731737-28731759 CCAATGCCAGCTTGGTGACCTGG - Intergenic
971635114 4:29047686-29047708 GCCAGCACTGCTGGGGGACCCGG - Intergenic
972505776 4:39718695-39718717 GCCAGCACTGCTGGGGGACCCGG + Intronic
973135259 4:46699024-46699046 GCCAGCCATGCTGGGGGACCTGG - Intergenic
974013098 4:56625079-56625101 CCCATCTCTTGTGGGTGACCTGG + Intergenic
974089880 4:57300363-57300385 GCCAGCACTGCTGGGGGACCCGG + Intergenic
974470841 4:62315960-62315982 CCAGTGCCTGCTGGGTGGCCTGG + Intergenic
975754821 4:77562034-77562056 GCCAGCACTGCTGGGGGACCCGG - Intronic
976102497 4:81580617-81580639 GCCAGCACTGCTGGGGGACCCGG - Intronic
977470696 4:97438279-97438301 GCCAGCACTGCTGGGGGACCTGG + Intronic
978207192 4:106092595-106092617 GCCAGCACTGCTGGGGGACCTGG + Intronic
978551444 4:109931687-109931709 CCCAGCCCTGCTGGATTAACTGG + Intronic
979609021 4:122670382-122670404 GCCAGCACTGCTGGGGGACCTGG - Intergenic
981843416 4:149138207-149138229 CCCATCCCTGCCCTGTGGCCAGG - Intergenic
982985769 4:162203754-162203776 GCCAGCACTGCTGGGGGACCCGG - Intergenic
983843172 4:172482066-172482088 CCCAGCAGTGCTGGGGGACCCGG + Intronic
985819116 5:2147934-2147956 CCACTTCCTGCTGGGTGCCCAGG + Intergenic
986060863 5:4188782-4188804 CTCATCCCCGCTGACTGACCTGG - Intergenic
986190045 5:5487970-5487992 GCCATCCCTGCTGTTTGCCCAGG + Intronic
988506142 5:31825079-31825101 TCTATCCCTGGTGGGTGGCCAGG - Intronic
988983046 5:36590639-36590661 CACATCCCTGCTGAGAGCCCAGG - Intergenic
990323172 5:54649215-54649237 GCCAGCACTGCTGGGGGACCCGG + Intergenic
990665711 5:58069328-58069350 GCCAGCACTGCTGGGGGACCTGG + Intergenic
991214952 5:64150246-64150268 GCCAGCACTGCTGGGGGACCTGG - Intergenic
994669760 5:102752232-102752254 GCCAGCACTGCTGGGGGACCAGG - Intergenic
995700367 5:114929003-114929025 GCCAGCACTGCTGGGGGACCCGG - Intergenic
995988432 5:118208155-118208177 GCCAGCACTGCTGGGGGACCTGG + Intergenic
997586880 5:135048612-135048634 CACATCCCAGCTGGGGGTCCAGG - Intronic
998025838 5:138815480-138815502 CTCTTTCCTGCTGGGTGCCCTGG + Intronic
998133833 5:139664367-139664389 CTCCTCCCTGCAGGGTGCCCAGG - Intronic
999743984 5:154577663-154577685 CCCACCCATGCTGGGACACCGGG + Intergenic
999755289 5:154659665-154659687 CCCATAGATGCTGTGTGACCTGG - Intergenic
1000902478 5:166927141-166927163 GCCAGCACTGCTGGGGGACCCGG + Intergenic
1001585379 5:172830664-172830686 TCACTCTCTGCTGGGTGACCTGG - Intergenic
1001594702 5:172890783-172890805 CCCAGCCCTGCTGCCTGAGCAGG + Intronic
1001734706 5:173988912-173988934 CCCATCCCTGCGAGGTGGTCCGG + Intronic
1001841552 5:174880835-174880857 GCCAGCACTGCTGGGGGACCCGG - Intergenic
1002081769 5:176741665-176741687 CTCATCCATGCTGGGAGGCCTGG - Intergenic
1002185089 5:177450660-177450682 CCCATCCCTGAGGGGTGAGGTGG + Intronic
1002706069 5:181161362-181161384 CCCATGTCTGCTGTGTGAGCAGG - Intergenic
1002871326 6:1169711-1169733 CCCTTCCCAGCTGTGTGACCCGG - Intergenic
1003247034 6:4391135-4391157 CCAGTCCCTGCTGGGTGTCTGGG - Intergenic
1003498001 6:6681287-6681309 CCCATCGCAGCTGTGTGACATGG - Intergenic
1004452380 6:15758951-15758973 GCCAGCACTGCTGGGGGACCCGG + Intergenic
1004694398 6:18020187-18020209 GCCAGCACTGCTGGGGGACCCGG - Intergenic
1005110802 6:22279942-22279964 CCCATCCATACTGGGATACCAGG - Intergenic
1005414813 6:25588584-25588606 TCCATCCCTGTTGGGTGTCGTGG - Intronic
1005768214 6:29036239-29036261 CCCACCCCACCTCGGTGACCTGG - Intergenic
1006398509 6:33802282-33802304 CCCCTCCCTGCTTGGAGGCCTGG - Intronic
1006908453 6:37548545-37548567 CCAATCCCAGCTGCGTGAACTGG - Intergenic
1007254039 6:40516186-40516208 CCCCTTCAGGCTGGGTGACCTGG + Intronic
1007927527 6:45662524-45662546 CCCATCCCTCCTTGGAGACTTGG - Intronic
1013188716 6:107783920-107783942 CCAAGCTCTGCTGGGCGACCTGG + Intronic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1013957249 6:115855362-115855384 GCCAGCACTGCTGGGGGACCTGG - Intergenic
1015455797 6:133424840-133424862 CCCATCCCTTCTGAGTGGGCGGG - Intronic
1016104723 6:140148315-140148337 GCCAGCACTGCTGGGGGACCCGG + Intergenic
1016446098 6:144133430-144133452 CCAATGCTAGCTGGGTGACCTGG - Intergenic
1017910514 6:158788331-158788353 CCCATCCCTTTTGGGTGAGTGGG - Intronic
1018551334 6:165001820-165001842 GCCAGCACTGCTGGGGGACCTGG + Intergenic
1018613169 6:165662567-165662589 CCCAGCCCCGCTGGGGGCCCCGG - Intronic
1018923989 6:168194131-168194153 CCCCTCCCTGCAGGGCCACCTGG - Intergenic
1019614662 7:1953813-1953835 CCCATCACTGCTGGGTGACACGG + Intronic
1020662194 7:10995745-10995767 GCCAGCACTGCTGGGGGACCCGG + Intronic
1021651912 7:22840785-22840807 ACCAAGCCCGCTGGGTGACCTGG - Intergenic
1021761268 7:23904904-23904926 GCCAGCACTGCTGGGGGACCTGG + Intergenic
1023530089 7:41144087-41144109 GCCAGCCCAGCTGGGTCACCGGG + Intergenic
1023835840 7:44066671-44066693 TCCATCCCTGCTGGCCTACCTGG + Intronic
1023920523 7:44626007-44626029 CCCATGACTGCTGGGCCACCAGG + Intronic
1026865662 7:73822619-73822641 CCCATCCATGCTGGGAGACGTGG + Intronic
1030292700 7:107888154-107888176 GCCAGCACTGCTGGGGGACCTGG - Intergenic
1031045194 7:116879683-116879705 CACCTCCCTGCTGTGTGACCGGG + Intronic
1032339655 7:131058930-131058952 GCCAGCACTGCTGGGGGACCCGG - Intergenic
1032467464 7:132155261-132155283 CACCTCCCTGCTGTGTAACCTGG + Intronic
1032499760 7:132391617-132391639 TCCACCCCTGCTGGGTAGCCTGG - Intronic
1033839917 7:145360830-145360852 GCCAGCACTGCTGGGAGACCCGG + Intergenic
1033921900 7:146404321-146404343 CCCAACCATGCAGGGTAACCTGG - Intronic
1034163381 7:149008109-149008131 CTCATGCCTGCGGGGTGTCCAGG + Intronic
1034222386 7:149456561-149456583 CCCACCCCTGCTGGGAGATGTGG - Intronic
1034522820 7:151633051-151633073 CCCATCCCTGCAGAGTGCACGGG + Intronic
1034871270 7:154686184-154686206 ACCATCCCTGATATGTGACCCGG - Intronic
1035321244 7:158030627-158030649 CCCACCTCTGCTGGGTCACCAGG - Intronic
1036152567 8:6312469-6312491 CCCAACCCTGTTGGGAGGCCTGG + Intergenic
1036601786 8:10267683-10267705 CCCACACCTGCTGGGGGATCAGG + Intronic
1036702803 8:11024331-11024353 CCCTCCCCAGTTGGGTGACCTGG + Intronic
1037239501 8:16760707-16760729 GCCAGCACTGCTGGGGGACCCGG + Intergenic
1037319596 8:17630647-17630669 CCCCTCCCTGCTGGGGCACCAGG + Intronic
1041352713 8:56964894-56964916 CTCATCCCTGCTGGGTATTCTGG + Intronic
1041929838 8:63274402-63274424 CCCCTCCAGCCTGGGTGACCGGG - Intergenic
1044515187 8:93129364-93129386 CCCATCCCTGATTGAAGACCAGG + Intergenic
1046946450 8:119978649-119978671 CCCCTCCCAGCTGGGTGGCTAGG + Intronic
1047143296 8:122167118-122167140 CCCAACCCTGCTGGGTTGCATGG + Intergenic
1047748975 8:127865940-127865962 GCCATCCCTGCCAGGTCACCAGG - Intergenic
1048318386 8:133378751-133378773 CCCTTCCGAGCTGTGTGACCTGG + Intergenic
1048344401 8:133566005-133566027 CCCATCCCTGCTGGCCAGCCAGG + Intronic
1048352749 8:133629298-133629320 CCCTTCCCAGCTGTGTAACCTGG + Intergenic
1048488323 8:134868920-134868942 CCCCTTCTTGCTGTGTGACCTGG - Intergenic
1049165601 8:141123713-141123735 CCCTTCCCTGCGGGCTGCCCAGG - Intronic
1049365410 8:142234607-142234629 CCCAGCCCTGCTGTGTGACCAGG + Intronic
1049467346 8:142757630-142757652 GCCTGCCCTGCTGGATGACCGGG - Intergenic
1049601699 8:143510731-143510753 CCCATCCCTCCTGGCTGGCTGGG + Intronic
1049611076 8:143555621-143555643 CCCGTCCCTGCTGGGTAACAGGG - Intronic
1051459427 9:17295027-17295049 GCCAACACTGCTGGGGGACCTGG + Intronic
1053410210 9:37911463-37911485 CCCTTTCCAGCTGTGTGACCTGG - Intronic
1056799445 9:89681257-89681279 GCCAGCACTGCTGGGGGACCCGG - Intergenic
1057026603 9:91738826-91738848 CCCATCCATGCAGGCTGACCGGG - Intronic
1057263296 9:93598151-93598173 CCCATCCCTGGGGTGTCACCAGG - Intronic
1057276815 9:93680593-93680615 CCAGTCCCTGCTGGGTGCTCCGG + Intergenic
1057600007 9:96449977-96449999 CCCCTCCCTGCTGAGCGAACGGG + Intergenic
1057755573 9:97832236-97832258 CACTTCCCAGCTGGGTGACTTGG - Intergenic
1058365188 9:104200761-104200783 GCCAGCACTGCTGGGGGACCTGG - Intergenic
1059416145 9:114163692-114163714 CCAATCCCTGCCGAGTGGCCAGG - Intronic
1059426274 9:114222773-114222795 CACATCCTGGCTGTGTGACCTGG + Intronic
1059431040 9:114250488-114250510 CCCATGCTGGCTGGGTGACCAGG + Intronic
1060771835 9:126337603-126337625 CCCATTCCTGGAAGGTGACCCGG + Intronic
1061153461 9:128842831-128842853 CCCAGCCCTCCATGGTGACCTGG + Intronic
1061153839 9:128845334-128845356 CCCAGCCCAGCTGGCTCACCAGG + Exonic
1061296713 9:129680737-129680759 CCCAGCCCTGCCTGGCGACCTGG + Intronic
1061849036 9:133403815-133403837 GCTGTCCCTGCTGGGTGAGCTGG + Exonic
1062582483 9:137234674-137234696 CACAGCCCTGCTGGCTGCCCTGG + Exonic
1062725187 9:138069014-138069036 CCCCAACCTGCTGGGTGTCCAGG - Intronic
1186587066 X:10886333-10886355 AGCAACCCTGCTGGGTTACCAGG - Intergenic
1188665510 X:32815136-32815158 CCCATCCCGACTGGGTTTCCAGG - Intronic
1189438067 X:41010289-41010311 CCCCTCCCTGCTGTGTTTCCGGG + Intergenic
1190116320 X:47628048-47628070 CCCACCAGTGCTGGGTGACAGGG + Intronic
1192183408 X:68930165-68930187 CTCTTCCTTGCTGGGTGATCTGG + Intergenic
1192213032 X:69139773-69139795 CCCCTCCCCGCTGGCTGCCCTGG + Intergenic
1200744641 Y:6893180-6893202 CTCATTCCAGCTGGGTGACCTGG + Intergenic
1202272658 Y:23085955-23085977 GCCAGCCGTGCTGGGGGACCCGG + Intergenic
1202293368 Y:23334727-23334749 GCCAGCCGTGCTGGGGGACCCGG - Intergenic
1202425655 Y:24719699-24719721 GCCAGCCGTGCTGGGGGACCCGG + Intergenic
1202445134 Y:24950386-24950408 GCCAGCCGTGCTGGGGGACCCGG - Intergenic