ID: 1149595531

View in Genome Browser
Species Human (GRCh38)
Location 17:57862551-57862573
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 240}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149595516_1149595531 10 Left 1149595516 17:57862518-57862540 CCAGCTCCAGGGTGGCCACCCTC 0: 1
1: 0
2: 5
3: 22
4: 374
Right 1149595531 17:57862551-57862573 CTGGGTGACCGGGAGCTGCTGGG 0: 1
1: 0
2: 1
3: 19
4: 240
1149595519_1149595531 -5 Left 1149595519 17:57862533-57862555 CCACCCTCCCCATCCCTGCTGGG 0: 1
1: 1
2: 16
3: 134
4: 1010
Right 1149595531 17:57862551-57862573 CTGGGTGACCGGGAGCTGCTGGG 0: 1
1: 0
2: 1
3: 19
4: 240
1149595521_1149595531 -8 Left 1149595521 17:57862536-57862558 CCCTCCCCATCCCTGCTGGGTGA 0: 1
1: 0
2: 3
3: 47
4: 458
Right 1149595531 17:57862551-57862573 CTGGGTGACCGGGAGCTGCTGGG 0: 1
1: 0
2: 1
3: 19
4: 240
1149595517_1149595531 4 Left 1149595517 17:57862524-57862546 CCAGGGTGGCCACCCTCCCCATC 0: 1
1: 1
2: 4
3: 36
4: 445
Right 1149595531 17:57862551-57862573 CTGGGTGACCGGGAGCTGCTGGG 0: 1
1: 0
2: 1
3: 19
4: 240
1149595515_1149595531 13 Left 1149595515 17:57862515-57862537 CCTCCAGCTCCAGGGTGGCCACC 0: 1
1: 1
2: 1
3: 46
4: 431
Right 1149595531 17:57862551-57862573 CTGGGTGACCGGGAGCTGCTGGG 0: 1
1: 0
2: 1
3: 19
4: 240
1149595513_1149595531 20 Left 1149595513 17:57862508-57862530 CCAGAGTCCTCCAGCTCCAGGGT 0: 1
1: 0
2: 1
3: 44
4: 382
Right 1149595531 17:57862551-57862573 CTGGGTGACCGGGAGCTGCTGGG 0: 1
1: 0
2: 1
3: 19
4: 240
1149595507_1149595531 29 Left 1149595507 17:57862499-57862521 CCTGCCTCCCCAGAGTCCTCCAG 0: 1
1: 0
2: 3
3: 64
4: 512
Right 1149595531 17:57862551-57862573 CTGGGTGACCGGGAGCTGCTGGG 0: 1
1: 0
2: 1
3: 19
4: 240
1149595506_1149595531 30 Left 1149595506 17:57862498-57862520 CCCTGCCTCCCCAGAGTCCTCCA 0: 1
1: 0
2: 15
3: 51
4: 560
Right 1149595531 17:57862551-57862573 CTGGGTGACCGGGAGCTGCTGGG 0: 1
1: 0
2: 1
3: 19
4: 240
1149595508_1149595531 25 Left 1149595508 17:57862503-57862525 CCTCCCCAGAGTCCTCCAGCTCC 0: 1
1: 0
2: 3
3: 57
4: 548
Right 1149595531 17:57862551-57862573 CTGGGTGACCGGGAGCTGCTGGG 0: 1
1: 0
2: 1
3: 19
4: 240
1149595511_1149595531 21 Left 1149595511 17:57862507-57862529 CCCAGAGTCCTCCAGCTCCAGGG 0: 1
1: 0
2: 3
3: 46
4: 349
Right 1149595531 17:57862551-57862573 CTGGGTGACCGGGAGCTGCTGGG 0: 1
1: 0
2: 1
3: 19
4: 240
1149595509_1149595531 22 Left 1149595509 17:57862506-57862528 CCCCAGAGTCCTCCAGCTCCAGG 0: 1
1: 0
2: 6
3: 47
4: 422
Right 1149595531 17:57862551-57862573 CTGGGTGACCGGGAGCTGCTGGG 0: 1
1: 0
2: 1
3: 19
4: 240
1149595522_1149595531 -9 Left 1149595522 17:57862537-57862559 CCTCCCCATCCCTGCTGGGTGAC 0: 1
1: 1
2: 1
3: 50
4: 472
Right 1149595531 17:57862551-57862573 CTGGGTGACCGGGAGCTGCTGGG 0: 1
1: 0
2: 1
3: 19
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type