ID: 1149599053

View in Genome Browser
Species Human (GRCh38)
Location 17:57881615-57881637
Sequence TGGGCTATTCCCACTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149599045_1149599053 14 Left 1149599045 17:57881578-57881600 CCTTGAGGCCAGCAGTGGTGGGT 0: 1
1: 0
2: 3
3: 64
4: 556
Right 1149599053 17:57881615-57881637 TGGGCTATTCCCACTGATATGGG 0: 1
1: 0
2: 0
3: 6
4: 70
1149599046_1149599053 6 Left 1149599046 17:57881586-57881608 CCAGCAGTGGTGGGTCTCAGTGG 0: 1
1: 0
2: 3
3: 18
4: 175
Right 1149599053 17:57881615-57881637 TGGGCTATTCCCACTGATATGGG 0: 1
1: 0
2: 0
3: 6
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149599053 Original CRISPR TGGGCTATTCCCACTGATAT GGG Intronic
900424655 1:2570741-2570763 TGGCCTAATCCTACTGTTATTGG - Intergenic
904342024 1:29841996-29842018 TTATCAATTCCCACTGATATAGG - Intergenic
912088307 1:106038482-106038504 TGGCCTATTCCCACTTGTATTGG + Intergenic
921901016 1:220450912-220450934 TGAGATACTCCCACTGAAATGGG - Intergenic
923982864 1:239345391-239345413 TGATCTATTCCCACTGTTGTGGG - Intergenic
924397307 1:243635588-243635610 TGGGCAAAATCCACTGATATGGG + Intronic
1064945627 10:20785277-20785299 TGGGCAATTTTCACTAATATTGG + Exonic
1066681478 10:37939797-37939819 TGGGCCATTCCCTCTGGTAGTGG - Intergenic
1069153566 10:64997341-64997363 TGTCCTATTCCCACTTTTATTGG + Intergenic
1070830456 10:79415065-79415087 TGGGGTATTCCTAATGATCTTGG + Intronic
1076922452 10:133461385-133461407 TGGGCTCTTCTCATTGATTTTGG + Intergenic
1086731937 11:90261195-90261217 GGTGATATTCTCACTGATATAGG + Intergenic
1089354177 11:117839124-117839146 GGGGCTATTCCCTCTCATCTTGG + Intronic
1099274963 12:80563387-80563409 TGAGCTAATCCCACTCATAAGGG + Intronic
1101125843 12:101633053-101633075 TGGGCTATTCCAAGTGCTATAGG + Intronic
1102808186 12:115800539-115800561 TGGGCTAGATCCACAGATATGGG + Intergenic
1103898659 12:124291791-124291813 TGGGAAAATCCCCCTGATATGGG + Intronic
1107420812 13:40244766-40244788 TTGGCTCTTTCCTCTGATATTGG - Intergenic
1110800286 13:79686076-79686098 TGTGAAACTCCCACTGATATGGG + Intergenic
1117454547 14:55884253-55884275 TGGGCTGTTCCCCACGATATTGG - Intergenic
1117949514 14:61068083-61068105 TAGGCTGTACCCACTGATTTGGG - Intronic
1123784007 15:23650546-23650568 CTGGCTATTCTCACTGATGTTGG + Intergenic
1128419328 15:67476585-67476607 TGGTCTATTTCCAATGATACCGG + Intronic
1141568570 16:84920321-84920343 AGGATTATTACCACTGATATCGG - Intronic
1143285167 17:5783651-5783673 TGGGCTGTTCACAATGATTTGGG + Intronic
1144515597 17:15915790-15915812 TGGGTGATGCCCACTGATATTGG + Intergenic
1149599053 17:57881615-57881637 TGGGCTATTCCCACTGATATGGG + Intronic
1151141359 17:71995583-71995605 TGGGATGTTTTCACTGATATGGG - Intergenic
1153710765 18:7796573-7796595 TGGGCCATTCCCAGTGGTAGGGG + Intronic
1155069821 18:22305111-22305133 TGGGCTGTTTCCCATGATATTGG + Intergenic
1157535112 18:48452170-48452192 TGGAATATTCCCAGTGATACAGG - Intergenic
1157587160 18:48810199-48810221 GTGGCTATCCCGACTGATATGGG - Intronic
1162876904 19:13627286-13627308 TGGTCTAAACCCACTGACATGGG - Intergenic
934926373 2:98384403-98384425 TCGGCATTTCTCACTGATATAGG - Intronic
940096814 2:149985938-149985960 TGGAGTATTGCCACAGATATTGG - Intergenic
940992672 2:160113939-160113961 TGGGCTGTTCCCACAGAGAGGGG - Intronic
941517778 2:166501008-166501030 TAGGGTAGACCCACTGATATTGG + Intergenic
944386765 2:199173929-199173951 CGGGTTATTCCCCCTGAAATGGG + Intergenic
944869688 2:203897391-203897413 TGGGGTATTCTCCCTGATATTGG + Intergenic
1172287961 20:33754473-33754495 TGGGATCTTCCCACTGGTCTGGG - Intronic
1172903600 20:38352269-38352291 TGGGCTGTTCCTTCTGCTATGGG - Intronic
1178014376 21:28326653-28326675 TTGACTGTTCCCACTGATAATGG - Intergenic
1178771020 21:35504164-35504186 TGGGCTATACTCTCAGATATGGG + Intronic
1182159591 22:28108024-28108046 TGGGCAATTTCCACTGCTCTCGG - Exonic
949416954 3:3825321-3825343 TGGGCTTTTCCCAGAGATGTTGG + Intronic
952848017 3:37704628-37704650 TGGGTTTTTCCCAGTGATATTGG - Intronic
953039886 3:39246497-39246519 TGGGCCATCCCAACTGATAATGG - Intergenic
954941709 3:54378906-54378928 TTGGCCATTCACACTGATAACGG + Intronic
955330269 3:58041536-58041558 TGGGCTAGTCCCACTGGTGGTGG - Intronic
956310507 3:67873709-67873731 TGGGATATTCGCATTGATAAAGG + Intergenic
964260791 3:154834689-154834711 TGGGCTATGGTCACTAATATTGG - Intergenic
965074602 3:163960087-163960109 TGGGCTATGCACACTGGTGTTGG - Intergenic
971934074 4:33124524-33124546 TGGGCCATTCCAAGTGATCTAGG - Intergenic
978907069 4:114018216-114018238 TGGGCTATACACACTGTTACTGG - Intergenic
980746633 4:137025938-137025960 TGGGCTACTTGCACAGATATAGG + Intergenic
985865775 5:2512845-2512867 TGGGCTCATCCCACTGGTGTTGG - Intergenic
992522310 5:77567087-77567109 TGCTCTATTTACACTGATATCGG + Intronic
995327640 5:110909328-110909350 TGGGCTATTACTATTGATTTAGG - Intergenic
998351367 5:141504014-141504036 TGGTCTCTTCCCACTCATTTAGG + Intronic
1002759975 6:193859-193881 TGGGGCATTCCCACTGACAAGGG + Intergenic
1003935342 6:10970224-10970246 TGGGCCATTCCCTCTGAAATGGG - Intronic
1008977811 6:57448446-57448468 TGGGCCATGCTCACTCATATTGG - Intronic
1011013227 6:82725603-82725625 AGGGACATTCACACTGATATAGG - Intergenic
1011417594 6:87138818-87138840 TGGTCTAGTCCTTCTGATATGGG + Intergenic
1015934452 6:138394543-138394565 TGGACTCATCTCACTGATATTGG + Intergenic
1021058847 7:16084494-16084516 TGGGCTATTGAAACTGAAATTGG - Intergenic
1025787846 7:64659732-64659754 TGGGCCATACCCACAGATAAAGG + Intergenic
1037123790 8:15320585-15320607 TGGTCTATTTTCACTGATCTAGG + Intergenic
1041880145 8:62739862-62739884 TGGACTTTTGCCACTGATGTTGG - Intronic
1045375062 8:101564122-101564144 AAGACTATTCCCACTGATTTTGG + Intronic
1047179689 8:122575302-122575324 TGTGCTATGCCCACTTATAGAGG + Intergenic
1048069037 8:131002503-131002525 TGGGCTTTTCCCACAGCTGTTGG + Intronic
1052405668 9:28057200-28057222 TGAGGTATTCCAACTGATTTGGG + Intronic
1061489147 9:130935604-130935626 TGGGCTATACCCACTCACAGCGG + Intronic
1186503210 X:10068605-10068627 TGGGGTATTCCCTCTGCAATAGG + Intronic
1192249702 X:69401515-69401537 GGAGCTCTTCCCACTGATCTTGG - Intergenic
1201638237 Y:16149169-16149191 TGGGCAATTGTCACTCATATTGG + Intergenic