ID: 1149599649

View in Genome Browser
Species Human (GRCh38)
Location 17:57885264-57885286
Sequence CAGCAGCGGCGGCGTCTATG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 76}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149599649_1149599652 -8 Left 1149599649 17:57885264-57885286 CCTCATAGACGCCGCCGCTGCTG 0: 1
1: 0
2: 0
3: 9
4: 76
Right 1149599652 17:57885279-57885301 CGCTGCTGCCACCGCCCTCCAGG 0: 1
1: 0
2: 3
3: 53
4: 695
1149599649_1149599659 17 Left 1149599649 17:57885264-57885286 CCTCATAGACGCCGCCGCTGCTG 0: 1
1: 0
2: 0
3: 9
4: 76
Right 1149599659 17:57885304-57885326 CATCTGCAGCAGCTGGTCGATGG 0: 1
1: 1
2: 1
3: 16
4: 179
1149599649_1149599660 20 Left 1149599649 17:57885264-57885286 CCTCATAGACGCCGCCGCTGCTG 0: 1
1: 0
2: 0
3: 9
4: 76
Right 1149599660 17:57885307-57885329 CTGCAGCAGCTGGTCGATGGTGG 0: 1
1: 0
2: 13
3: 15
4: 199
1149599649_1149599658 10 Left 1149599649 17:57885264-57885286 CCTCATAGACGCCGCCGCTGCTG 0: 1
1: 0
2: 0
3: 9
4: 76
Right 1149599658 17:57885297-57885319 CCAGGTTCATCTGCAGCAGCTGG 0: 2
1: 0
2: 4
3: 25
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149599649 Original CRISPR CAGCAGCGGCGGCGTCTATG AGG (reversed) Exonic
901797870 1:11691233-11691255 CAGCTGCGGCCGCGTCTGTCAGG - Intronic
904652235 1:32014174-32014196 CAGCAGCGGTGGCGGCTGCGTGG - Exonic
906960926 1:50419117-50419139 CGGCGGCGGCGGCGTCGACGCGG + Exonic
907689179 1:56645328-56645350 CGGCGGCGGCGGCGGCTACGCGG + Exonic
913100896 1:115564388-115564410 CAGCGGCGGCGGCGGCGATCAGG - Intergenic
919847015 1:201648713-201648735 GAGCAGCGGCGGCGGCGACGAGG + Exonic
922872322 1:228912842-228912864 CAGCAGCAGCAGCAGCTATGTGG - Intergenic
923093039 1:230753895-230753917 CAGCAGGGGAGGCGTCTCTGGGG - Intronic
1066429338 10:35336877-35336899 CAGCAGCGGCGGCGGCGGCGGGG - Exonic
1072915117 10:99533034-99533056 CAGCAGCGGCGGAGTCCAGGAGG + Exonic
1076731980 10:132443858-132443880 CAGCAGCTGGGGTGTCTGTGGGG + Intergenic
1078422748 11:11225610-11225632 CAGCAGATTCAGCGTCTATGAGG + Intergenic
1085205830 11:74731362-74731384 CAGCAGCGGCGGCGGCGCGGCGG + Intronic
1085401551 11:76238810-76238832 CAGCAGCAGCAGCTTCTGTGGGG - Intergenic
1091398210 12:167184-167206 CAGCAGAGGCGGCCTCTCTGGGG - Intronic
1103539216 12:121654322-121654344 CAGCAACGGCGACATCTACGAGG - Exonic
1104429530 12:128705386-128705408 CAGCCCCGGCGGGGACTATGAGG + Exonic
1105836634 13:24217816-24217838 CAGCAGCTGTGGTGTCTCTGTGG - Intronic
1118682736 14:68260107-68260129 GAGCAGAGGAGGCCTCTATGAGG + Intronic
1122779871 14:104139062-104139084 CAGCAGCGGCGGCGGCTCGCGGG - Exonic
1125170752 15:36763837-36763859 CAGCAGCTGTGGCTTCTAGGAGG + Intronic
1128482767 15:68054386-68054408 CAGCAGCGGCGCCGTCTCCGCGG - Intronic
1133479446 16:6155747-6155769 TAACAGCGGCGGCTTCCATGTGG + Intronic
1133481556 16:6175721-6175743 CAGCAGCAGCGGCACCAATGGGG - Intronic
1133801927 16:9091702-9091724 CAGCGGCGGCGGCGGCAGTGGGG + Exonic
1139402925 16:66696598-66696620 CGGCGGCGGCGGCGGCGATGCGG - Exonic
1141513388 16:84526893-84526915 CAGCAGAGGCGGGGTCCACGTGG - Intronic
1142403502 16:89873450-89873472 CTTCAGCGGCGGCGTCTGGGCGG - Intergenic
1142417206 16:89949181-89949203 GAGCAGCGGCGGCGTCCCCGGGG - Intronic
1142978729 17:3659585-3659607 CAGCAGAGGCGGGGCCGATGCGG - Intronic
1143315121 17:6026619-6026641 TAGGAGCGCCGGGGTCTATGTGG + Intronic
1145981709 17:29016477-29016499 CAGCAGGGCTGGCCTCTATGAGG - Intronic
1146716249 17:35089202-35089224 CCGCCGCGGCGGCGTCTCTGGGG + Exonic
1147486364 17:40818905-40818927 CGGCGGCGGCGGCGGCTACGGGG - Exonic
1148467236 17:47872503-47872525 CGGCGGCGGCGGCGGCGATGGGG + Intergenic
1149599649 17:57885264-57885286 CAGCAGCGGCGGCGTCTATGAGG - Exonic
1149659867 17:58328688-58328710 CAGCAGGGGCTGAGACTATGAGG - Intronic
1151478543 17:74356878-74356900 CAGCAGCGGCGGCGACGCGGCGG - Exonic
1152072476 17:78140750-78140772 CAGCAGCGGCAGCAACTCTGCGG - Intronic
1153051870 18:907952-907974 CAGCAGCGGGCGGGTCTGTGTGG + Intronic
1160892996 19:1388878-1388900 CAGCAGCCGGGGCGAGTATGTGG + Exonic
1161808762 19:6459657-6459679 CGGCAGCGGCGGCCTCAGTGGGG + Exonic
1162470940 19:10871707-10871729 CAGCGGCGGCGGCGGCGGTGGGG + Exonic
1163476199 19:17527374-17527396 CAGCAGCGGCAGCACCTAAGGGG + Exonic
1167609939 19:50502165-50502187 CAGCAGTGGGGGCTTTTATGGGG - Intergenic
1167719225 19:51167394-51167416 CAGCAGCGGCAGCATCTCTGAGG - Intergenic
1167772858 19:51531601-51531623 CAGCAGCGGTAGCATCTCTGAGG + Exonic
932837313 2:75049659-75049681 CATCAGCGCCGGCGACTATGAGG - Exonic
942471919 2:176269475-176269497 CAGCAGCGGCGGCTGCAGTGAGG - Exonic
944155340 2:196601700-196601722 CAGCAGCAGCAGCAACTATGAGG - Intergenic
947749183 2:232523924-232523946 CTGCAGCGCCGGCGGCGATGCGG + Exonic
948775241 2:240284582-240284604 CAGCAGGGGCTGTGTCTTTGGGG - Intergenic
1168802628 20:653180-653202 CCGCGGCGGCGGCGACGATGGGG - Exonic
1171035136 20:21707886-21707908 CAGCAGCAGCAGCGCCTCTGTGG + Intronic
1175767239 20:61599953-61599975 CAGCAGCAGCAGCTTCTCTGTGG - Intronic
1182236950 22:28883644-28883666 CGGCGGCGGCGGCGGCTTTGTGG - Exonic
1183154691 22:36066071-36066093 CAGCAGGGGCGGCCTCCAGGGGG - Intergenic
1183702322 22:39457502-39457524 CAGCGGCGGCGGCGGCTCCGCGG - Exonic
960747725 3:120908364-120908386 CAGCGGCGGCGGCGTCCCAGAGG - Intronic
962301863 3:134250565-134250587 CAGCAGCGGCGGCGGCGGCGGGG + Exonic
966402636 3:179563092-179563114 CATGAGCGGCGGCGTGTACGGGG + Exonic
971467097 4:26975635-26975657 CAGGAGCAGCCGCGTATATGAGG + Intronic
976330998 4:83830981-83831003 CAGCAGAGGCTGAGTCTAGGTGG - Intergenic
982224407 4:153152963-153152985 CTTCAGCGGCGGCGTCGCTGGGG + Intronic
992627636 5:78649075-78649097 CAGCGGCGGCGGCGTCTCCCGGG + Intronic
997142429 5:131397053-131397075 CAGCAGCAGCGGAGGCTCTGGGG - Intronic
1003123239 6:3335266-3335288 CAGCAGCGGCGGAGGCTCCGAGG + Intronic
1011127202 6:84020020-84020042 CAGCAGCTGCAGCGTCTCTTGGG + Intergenic
1017672322 6:156778985-156779007 CGGCGGCGGCGGCGGCTATGGGG + Exonic
1019724797 7:2595574-2595596 TAGTCGCGGCGGCGTCTCTGTGG + Intronic
1023418121 7:39950739-39950761 CAGCAGCGGCGGCTGCTGAGGGG - Exonic
1026806740 7:73433806-73433828 CAGCGGCGGTGGCGGCTAGGCGG + Exonic
1031978592 7:128109380-128109402 CAGCAGCAGCTGTGTATATGTGG + Intergenic
1032525590 7:132576748-132576770 GAGCAGCGGCGGCGGCTCTCGGG + Exonic
1034222997 7:149460171-149460193 CAGTAGCGGCGGCGACTCCGGGG - Intronic
1034940346 7:155226601-155226623 CAGCAGCGGGGCCGTTGATGAGG - Intergenic
1035093749 7:156335062-156335084 CAGCAGAGGCTGGGTCTAGGAGG + Intergenic
1036671679 8:10792644-10792666 GAGTACCGGCGGCGTGTATGTGG - Intronic
1061188845 9:129070390-129070412 CAGCAGCGCAGGCGTGAATGGGG + Exonic
1062665233 9:137667142-137667164 CAGCAGCAGTGGCGTCTGTGGGG + Intronic
1062721550 9:138046896-138046918 CAGAAGCGGCGGAGCCTGTGAGG - Exonic
1189324595 X:40105100-40105122 CAGCAGCGGCGGCGGCGGCGAGG + Intronic
1189324596 X:40105103-40105125 CAGCGGCGGCGGCGGCGAGGAGG + Intronic
1190117723 X:47637100-47637122 CAGCAGCACCGGGGTCTGTGGGG + Exonic
1190984478 X:55488693-55488715 CAGCAGCGGCGGCGACGAGAAGG - Exonic
1191846559 X:65551551-65551573 CAGCAGCGACGGCGGGTGTGAGG - Intergenic