ID: 1149600448

View in Genome Browser
Species Human (GRCh38)
Location 17:57889886-57889908
Sequence GGCCATGGCTGTGGTGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 322}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149600441_1149600448 7 Left 1149600441 17:57889856-57889878 CCCCCTGGCTAAGCTCAGGGCAG 0: 1
1: 0
2: 1
3: 18
4: 216
Right 1149600448 17:57889886-57889908 GGCCATGGCTGTGGTGTGCCTGG 0: 1
1: 0
2: 0
3: 34
4: 322
1149600438_1149600448 14 Left 1149600438 17:57889849-57889871 CCTCTCTCCCCCTGGCTAAGCTC 0: 1
1: 0
2: 0
3: 34
4: 308
Right 1149600448 17:57889886-57889908 GGCCATGGCTGTGGTGTGCCTGG 0: 1
1: 0
2: 0
3: 34
4: 322
1149600442_1149600448 6 Left 1149600442 17:57889857-57889879 CCCCTGGCTAAGCTCAGGGCAGA 0: 1
1: 0
2: 2
3: 16
4: 186
Right 1149600448 17:57889886-57889908 GGCCATGGCTGTGGTGTGCCTGG 0: 1
1: 0
2: 0
3: 34
4: 322
1149600437_1149600448 15 Left 1149600437 17:57889848-57889870 CCCTCTCTCCCCCTGGCTAAGCT 0: 1
1: 0
2: 0
3: 29
4: 306
Right 1149600448 17:57889886-57889908 GGCCATGGCTGTGGTGTGCCTGG 0: 1
1: 0
2: 0
3: 34
4: 322
1149600444_1149600448 4 Left 1149600444 17:57889859-57889881 CCTGGCTAAGCTCAGGGCAGAGT 0: 1
1: 0
2: 3
3: 21
4: 144
Right 1149600448 17:57889886-57889908 GGCCATGGCTGTGGTGTGCCTGG 0: 1
1: 0
2: 0
3: 34
4: 322
1149600443_1149600448 5 Left 1149600443 17:57889858-57889880 CCCTGGCTAAGCTCAGGGCAGAG 0: 1
1: 0
2: 1
3: 22
4: 213
Right 1149600448 17:57889886-57889908 GGCCATGGCTGTGGTGTGCCTGG 0: 1
1: 0
2: 0
3: 34
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149600448 Original CRISPR GGCCATGGCTGTGGTGTGCC TGG Intronic
901632651 1:10655494-10655516 GGCCATCCCTGTGCTGGGCCAGG + Intronic
902148757 1:14425441-14425463 GGGCATGGCAGTGGTTTTCCTGG - Intergenic
903302645 1:22390296-22390318 GGCCATGTGTCTGGTGTACCTGG - Intergenic
905206742 1:36346961-36346983 GGCCATGGGGGTGGTGCCCCAGG + Intronic
905330452 1:37191625-37191647 GGCCTTGGCTTTGGTGTTTCTGG + Intergenic
905420589 1:37840909-37840931 GGTCATGGCTGTGGTTGGCCTGG + Intronic
905879811 1:41456091-41456113 GCCCAGGGCTGTGGAGTGGCGGG + Intergenic
906210885 1:44011564-44011586 GGCCATGGCTAGGGAGTGCTGGG + Exonic
906796176 1:48698035-48698057 GGCCATGGCTGGACTGAGCCTGG + Intronic
907045265 1:51296722-51296744 GGTGCTGGATGTGGTGTGCCTGG - Intronic
907949127 1:59164019-59164041 GGGCGTCACTGTGGTGTGCCTGG - Intergenic
908796282 1:67833534-67833556 CGCCCTGGCTGTGCTGTCCCGGG + Intergenic
910277487 1:85464790-85464812 GGACGTGGCCGTGGTGTGCGAGG - Exonic
912507401 1:110165635-110165657 GGCCTTGGCTGGGGTCAGCCAGG + Intronic
913215195 1:116614141-116614163 GGGCATGGCAGTGGTCTGCAGGG + Exonic
914195534 1:145446336-145446358 GGGCTTGGCTGTGCTGTGCTTGG - Intergenic
914980647 1:152411546-152411568 GGCCTTGGTTCTGGTTTGCCAGG + Intronic
915095594 1:153460167-153460189 GGCCAGGGCTATGCTGTGTCGGG + Intronic
915456639 1:156044797-156044819 GGCCGCCACTGTGGTGTGCCTGG - Intronic
915705065 1:157836021-157836043 GGACGTGGCTGTGTTGTGCCGGG - Exonic
915714248 1:157929643-157929665 GGATGTGGCCGTGGTGTGCCAGG + Intergenic
916327344 1:163577984-163578006 GGTCAAGGCTGTAGTGAGCCTGG - Intergenic
916818882 1:168379041-168379063 GGCCCTGGCTGTGGTGGGATGGG + Intergenic
918841748 1:189549693-189549715 GGCCAGGGTTGTAGTGAGCCAGG + Intergenic
920377892 1:205519089-205519111 GACAAAGGCTGTGCTGTGCCTGG + Intronic
921203518 1:212828596-212828618 GTTCAAGGCTGTAGTGTGCCAGG - Intergenic
924057998 1:240142828-240142850 GGCAGTGGATGTGGTGGGCCAGG - Intronic
1063339953 10:5253628-5253650 GGCCTTGGCTGAGGTGGGGCAGG + Intergenic
1063343783 10:5293023-5293045 GGCCTTGGCTGGGGTGGGGCAGG - Intergenic
1063412894 10:5850280-5850302 GTCCATGCCTGCTGTGTGCCAGG - Intergenic
1063670388 10:8095408-8095430 GCACATGGCTGTGGTGTCTCTGG + Intergenic
1064178821 10:13098212-13098234 GCCCATGGCTTTGGTGTGGGAGG - Intronic
1064335843 10:14440598-14440620 GGCCTTGCCTTTGCTGTGCCAGG + Intronic
1065021704 10:21507213-21507235 GGCCATGGCTGCGGGGCGACTGG - Intergenic
1065242338 10:23719510-23719532 GGTCATGGCTGCAGTGAGCCAGG + Intronic
1066702915 10:38148904-38148926 GGCAGAGGCTGTGGTGAGCCAGG - Intergenic
1067768369 10:49106690-49106712 GGCTTTGGCTGGGGGGTGCCGGG - Intronic
1068023789 10:51617495-51617517 GGCGATGGCTGTGGTGGGCTAGG - Intronic
1068504614 10:57884288-57884310 GGCCATGTCTGTGTGGTGACTGG - Intergenic
1069575388 10:69523645-69523667 AGCCATGGCTGTGGATTGTCAGG + Intergenic
1072308401 10:94130624-94130646 GGCCATGGAGATGGTGTGCTGGG - Intronic
1073425269 10:103452123-103452145 GGCCCTCCCTGGGGTGTGCCAGG - Intronic
1073470871 10:103721356-103721378 GGCCATGGCTTTGTGGGGCCAGG - Intronic
1076217042 10:128703513-128703535 AGCCATGGCTGGGGTGTGACTGG + Intergenic
1076703924 10:132290898-132290920 GGCCCTGGGTGTGGTGGGTCTGG - Intronic
1076768848 10:132651955-132651977 GGCCTTGGCTCTGGTGTGAGTGG - Intronic
1076785111 10:132745753-132745775 GGCCTTGGGTATGGTGGGCCCGG + Intronic
1076785132 10:132745814-132745836 GGCCCTGGGTATGGTGGGCCTGG + Intronic
1076785151 10:132745859-132745881 GGCCTCGGGTGTGGTGGGCCCGG + Intronic
1076811118 10:132886837-132886859 CGCCATGGCTGTGTTGGGTCGGG - Intronic
1076886618 10:133266040-133266062 GGCCAGGCCTGGGCTGTGCCTGG + Intronic
1077197366 11:1288188-1288210 GGCATTGGCCGTGGTGTGGCAGG - Intronic
1077226935 11:1442703-1442725 GGGCCTGCCTGTGGGGTGCCGGG - Intronic
1077408349 11:2392495-2392517 GTCCTTGGCTGTGGTTTCCCTGG + Intronic
1077551121 11:3200767-3200789 GGCCCGGGCTGTGCTGAGCCTGG - Intergenic
1077967622 11:7152811-7152833 GGCCATGTCAGTGGAGTCCCTGG + Intergenic
1081661168 11:44889327-44889349 GCCTATGGCTGGGGTGTGTCAGG - Intronic
1081809739 11:45908119-45908141 TGCCATGGTTCTGGTGAGCCAGG - Intergenic
1083203266 11:61132518-61132540 GGCCATGGCTGAGAAGTTCCTGG - Exonic
1084206113 11:67594091-67594113 GGATATGGGTGTGGTGGGCCAGG + Intergenic
1084599776 11:70137870-70137892 GGCCATGCCTGGCTTGTGCCTGG + Intronic
1084652139 11:70495591-70495613 TCCCATAGCTGTGGTGAGCCAGG + Intronic
1084932587 11:72569081-72569103 AGCTGTGGCTGTGGGGTGCCTGG - Intergenic
1085099493 11:73788540-73788562 GGCGAAGGTTGTGGTGAGCCGGG - Intronic
1085477905 11:76799292-76799314 GGCCAGGGCTGCGGGGTGCAGGG - Intergenic
1085753914 11:79188324-79188346 GGCCATGAATGTGTTTTGCCAGG - Intronic
1087076265 11:94129296-94129318 GGCCATGGCTGCGGCGCGCCAGG - Exonic
1090234505 11:125137536-125137558 GGCCATGGCTGCTCTGTGGCAGG + Intergenic
1090410057 11:126501831-126501853 GTCCATGTCTGGGGTGGGCCAGG + Intronic
1090934316 11:131328433-131328455 AGGCATGGCTGTGGGGTGCTTGG - Intergenic
1091586333 12:1819104-1819126 GGCCAGTCCTGTGGTGTTCCGGG + Intronic
1092069490 12:5621227-5621249 GGCAATAGCTGGGGTCTGCCTGG - Intronic
1092786582 12:12032323-12032345 GCCGATGACTGTGGTGTGGCCGG - Intergenic
1096552895 12:52385224-52385246 GGCTATGGCTTTGGTGGCCCTGG - Exonic
1096648464 12:53050404-53050426 GGCCAGGGCTGTAGTGTGAGGGG + Intronic
1097099557 12:56577541-56577563 GGTCAAGGCTGTAGTGAGCCAGG - Intronic
1098968779 12:76825873-76825895 GGTCAAGGCTGTCGTGAGCCTGG - Intronic
1099906662 12:88779375-88779397 GGTCAAAGCTGTGGTGAGCCAGG - Intergenic
1100665507 12:96747834-96747856 GTGCATGACTGTTGTGTGCCAGG - Intronic
1101497609 12:105270231-105270253 GGACATGGCTGATTTGTGCCAGG + Intronic
1101857726 12:108457846-108457868 TGCCATTGCTGTGGTCTGCTGGG + Intergenic
1102258169 12:111428218-111428240 GGCCATGGGTGGGATGTGCCAGG - Intronic
1104724492 12:131067413-131067435 GGCCCTGGAGGAGGTGTGCCTGG + Intronic
1104873736 12:132018508-132018530 GTCCTTGGCTGTGGTATGCCTGG + Intronic
1104888343 12:132125326-132125348 GGCCGTGACTGTGGTGAGCTGGG - Intronic
1105218928 13:18307630-18307652 GGGCATGGCAGTGGTCTGCAGGG + Intergenic
1105635617 13:22212700-22212722 GCCCCAGGCAGTGGTGTGCCAGG + Intergenic
1106979253 13:35257003-35257025 GGCCAGGGCTGTGGGCTGCATGG - Intronic
1113554035 13:111216731-111216753 GGCCGGGGCTGAGGTCTGCCAGG + Intronic
1113785969 13:113002222-113002244 GGCCATGGCCCTGGGGTCCCTGG + Intronic
1114514032 14:23286026-23286048 GGCCATCGCTGGGGTGGGCTCGG - Exonic
1115695772 14:35897543-35897565 GGCAGTGGCAGTGGTGGGCCAGG + Intronic
1116296680 14:43119812-43119834 AGCCATGGCTGGGGAGTGGCTGG + Intergenic
1117735718 14:58766247-58766269 GGCCCTGGCTGAGGTCTCCCAGG + Intergenic
1117790177 14:59331992-59332014 AGCCATGGCCGTGATGTGACCGG + Intronic
1118763160 14:68892884-68892906 GTCCATGTGTGTGATGTGCCTGG - Intronic
1118785099 14:69038990-69039012 TGCCCTGGCTGTGGTGGTCCAGG + Intergenic
1119807107 14:77489354-77489376 GGCAATTGCTGTTGTGTGCTGGG - Intronic
1121783789 14:96639648-96639670 GGCCCTGGCCTTGGTGTGGCAGG + Intergenic
1121813872 14:96914325-96914347 CCCCATGGCTGGGGTGAGCCAGG + Intronic
1122288853 14:100668694-100668716 GGCCCAGCCTGTGCTGTGCCAGG - Intergenic
1122926947 14:104908034-104908056 GGTCAAGGCTGTGCTGAGCCGGG + Intergenic
1123704983 15:22944791-22944813 GGGCAGGGGTGTGGTGTGGCAGG + Intronic
1124231820 15:27952504-27952526 GGCCATGGCTGCGTGGGGCCAGG + Intronic
1125341797 15:38682863-38682885 GGCCATGTCTGTGGGCAGCCTGG + Intergenic
1125501560 15:40242855-40242877 GGCCATGGCTGTCATCTGCTTGG - Intronic
1127132532 15:55882434-55882456 GACCATGGCTGAGTTCTGCCTGG - Intronic
1129322762 15:74783754-74783776 GGCCATCTGTGTGGTGTGGCAGG + Intronic
1129659481 15:77544974-77544996 GGCCATGGCAGAGGAGAGCCAGG - Intergenic
1129699558 15:77759882-77759904 GGCCACGGCCGTGGGGAGCCTGG + Intronic
1129759516 15:78121363-78121385 GGCCAGGGCTGTGGGGAGCCAGG + Intronic
1130096973 15:80863052-80863074 GGCCTTGGATTTGGTGAGCCTGG + Intronic
1130777059 15:86995315-86995337 GGTCAAGGCTGTAGTGAGCCTGG + Intronic
1132253578 15:100353811-100353833 GGGCATGGCTCTGGTGTCCCAGG - Intergenic
1132680847 16:1141156-1141178 GGCCAAGGCGGTGGAGAGCCCGG - Intergenic
1134008719 16:10835446-10835468 GGCCAGGGCAGCGGTGTGGCTGG - Intergenic
1134762827 16:16729163-16729185 TGCCATGGCTTAGGTGAGCCAGG - Intergenic
1134983225 16:18629985-18630007 TGCCATGGCTTAGGTGAGCCAGG + Intergenic
1135270286 16:21063609-21063631 GGTCAAGGCTGTAGTGAGCCAGG - Intronic
1136075041 16:27811492-27811514 GGCCAGGGAGGTGGTGTTCCGGG - Intronic
1136429156 16:30186907-30186929 GTTCTGGGCTGTGGTGTGCCAGG - Exonic
1137710617 16:50564166-50564188 GGCCATGGCTGCGGCCAGCCAGG - Intronic
1137762672 16:50953179-50953201 AGCCATGGCTGTGGAGCACCTGG + Intergenic
1138551259 16:57749950-57749972 GGGCATGGCTGGGGTGGCCCTGG - Intronic
1139234342 16:65318726-65318748 TGCAAAGCCTGTGGTGTGCCAGG + Intergenic
1139731168 16:68946580-68946602 GGCCAAGGCTGTAGTAAGCCTGG - Intronic
1139947313 16:70650167-70650189 GGCACTGGCTGTGGGGTTCCTGG + Intronic
1141097831 16:81175400-81175422 GACCATGTCTGTTGTGTCCCTGG + Intergenic
1141570546 16:84931022-84931044 GGGCATGGCTGTGTTGAGTCGGG + Intergenic
1142007767 16:87697898-87697920 GGCCCTGGCTCTCGTGTGCATGG + Exonic
1142272912 16:89100243-89100265 GGCCATGCCTGTTGTGAGCGGGG + Intronic
1142324372 16:89405024-89405046 GGCCATGGCTCTGGTGGGATGGG - Intronic
1142331047 16:89454121-89454143 TGTGTTGGCTGTGGTGTGCCAGG - Intronic
1142432707 16:90038881-90038903 GGCTTTGTCTGTGGTGTGCGGGG + Intronic
1142670180 17:1484461-1484483 GGGCCTGGGTGTGGTGGGCCGGG + Intronic
1142679126 17:1535351-1535373 GGGCATGGCTGGGGTGAGCTGGG - Intronic
1144767816 17:17742273-17742295 AGCCCTGTCTGTGGTGAGCCTGG - Intronic
1146300683 17:31686672-31686694 GGCTGGGGCTGTGCTGTGCCAGG - Intergenic
1147484813 17:40802329-40802351 GGCCATGGCTGTGGAGGGTGGGG + Intergenic
1147846520 17:43407887-43407909 GGTCAAGGCTGCGGTGAGCCAGG - Intergenic
1148243207 17:46013296-46013318 AGCCATGGCTGTGTGGGGCCTGG - Intronic
1148821201 17:50360673-50360695 GGCCATGTCTGTGGGGAGCAGGG + Exonic
1148821534 17:50362729-50362751 GGCTATGGCTGTGCTGTGTTAGG + Intronic
1149600448 17:57889886-57889908 GGCCATGGCTGTGGTGTGCCTGG + Intronic
1151573888 17:74941601-74941623 GGCCCTGAATGTGGTGTTCCTGG + Exonic
1151824735 17:76517950-76517972 GGCCGGGGCTGTGGGGTACCTGG - Intergenic
1151897939 17:76993020-76993042 GTGCATGGCTCTGGTCTGCCTGG + Intergenic
1151917535 17:77129479-77129501 GGGCAGGGCTGTAGGGTGCCTGG + Intronic
1152035042 17:77867160-77867182 GGCGAAGGTTGTGGTGAGCCAGG + Intergenic
1152356055 17:79807997-79808019 GGGCATGGCTGTGCTGCGCTAGG + Intergenic
1152705627 17:81842067-81842089 GGCGATGGCTCTGCTGAGCCTGG - Intergenic
1152809427 17:82374501-82374523 GGCCATGGGCGTGGTGGGCGTGG + Exonic
1152897481 17:82921050-82921072 CCCCAGGGCTGTGGTGTCCCGGG + Intronic
1154309451 18:13255739-13255761 GGCCAGGGCTGTGGGGTGCTTGG + Intronic
1157165070 18:45351421-45351443 GGTCAAGGCTGTAGTGAGCCAGG - Intronic
1157820902 18:50767656-50767678 GGCTATGGCAGTGGTGGGCTGGG - Intergenic
1159736515 18:72105632-72105654 GGCCATGCCTGTGTTGGGGCAGG + Intergenic
1159892913 18:73969331-73969353 GTGCATGGCTGTGGTGTGGAAGG - Intergenic
1162930827 19:13956677-13956699 GGGCAGGGCTGTGGTGGGCGTGG - Intronic
1162998491 19:14351229-14351251 GGCCAGGGCTGCGATGAGCCAGG + Intergenic
1163134452 19:15299513-15299535 GGCCATGGCGGGGATGTCCCAGG - Intronic
1163152366 19:15422918-15422940 CGCCCTGGCTGTAGTGTGCCCGG + Exonic
1163262567 19:16199924-16199946 CGCCATGGCTGTGGTGTTAGGGG + Intronic
1164405039 19:27936937-27936959 GGTCATGGATGTGGTGTACATGG - Intergenic
1166123408 19:40699460-40699482 GGTCATCGCTGTGTGGTGCCAGG + Intronic
1166331032 19:42078114-42078136 GGCCATGGGAGGGGTGTGGCTGG + Intronic
1166683674 19:44782355-44782377 GGCCATGGCTGGGGTGGGGCAGG - Exonic
1166915931 19:46196221-46196243 AGCCATGGCTCTGGGGTGGCTGG - Intergenic
1166938131 19:46347249-46347271 GGCCCAGGCTGAGGGGTGCCGGG + Intronic
1166997747 19:46727902-46727924 GGCCGGGGCTGGGGTGTGCCAGG + Exonic
1167291728 19:48628552-48628574 CCCCACGGCTGTGGTGGGCCTGG + Intronic
1167867436 19:52339726-52339748 GGCAATGGTTGTGGTGTGTGGGG - Intronic
1168385048 19:55956144-55956166 GGCCTTGACTATGGTGTCCCGGG + Intronic
925278714 2:2668627-2668649 GGCCATGGGTGTGGGGCCCCTGG - Intergenic
926161732 2:10494538-10494560 GGCCAGGGCTGGGGCGGGCCAGG + Intergenic
926335427 2:11859144-11859166 GGCCAAGGCTGTGGAGTGGGAGG + Intergenic
926576285 2:14585771-14585793 GGCCAAGGCTTTGGTCAGCCAGG + Intergenic
926624536 2:15080122-15080144 GAACATGGCTGTGGTGTTCATGG - Intergenic
926724156 2:15984476-15984498 GGCCTTGGCTGGGCTGTGCGGGG + Intergenic
927553646 2:24018265-24018287 GGGCATGGCAGTGGGGTGCAGGG - Intronic
928414304 2:31078952-31078974 GGCCATGGCTGTTCCATGCCTGG + Intronic
929118148 2:38462212-38462234 GCCCAAGGGTGTGGTGTGGCAGG - Intergenic
932230798 2:70082639-70082661 GGCAGTGGTTGTGGTGAGCCAGG + Intergenic
932430488 2:71671211-71671233 AGCCATTGCTGTGGAGTGACTGG + Intronic
934089706 2:88540421-88540443 GGGGATGGCAGTGGAGTGCCTGG + Intergenic
934295390 2:91739004-91739026 GGGCATGGCAGTGGTCTGCAGGG - Intergenic
935284261 2:101549972-101549994 TGGGATGGCTGTGGTGTACCAGG + Intergenic
935596583 2:104883288-104883310 GGTCAAGGCTGCGATGTGCCTGG - Intergenic
937150237 2:119681315-119681337 GGCCAGGGAAGTGGTGTACCTGG + Exonic
938170226 2:129069494-129069516 TTGCATGCCTGTGGTGTGCCGGG + Intergenic
938388763 2:130887759-130887781 GGCCATTTCTGTGGTTGGCCCGG + Intronic
938776136 2:134543188-134543210 TGTCATGTCTGTGTTGTGCCTGG + Intronic
940778778 2:157911218-157911240 CGCCAGGTCTGTGGTGGGCCTGG - Intronic
942731901 2:179069461-179069483 GGTCAAGGCTGTGGTGAGTCAGG + Intergenic
944048564 2:195440427-195440449 GGCTCTGGCTGTGGTAGGCCGGG - Intergenic
944143292 2:196480028-196480050 GGGAGTGGCAGTGGTGTGCCAGG - Intronic
945291023 2:208127697-208127719 GGCAATGGCTGCGGTGGCCCTGG + Intergenic
946868965 2:224068750-224068772 GGCTATGCCTGTGGTATGTCAGG - Intergenic
947567279 2:231202389-231202411 GGTCAAGGCTGTAGTGAGCCGGG - Intronic
947574377 2:231260981-231261003 GACCATGGCCAGGGTGTGCCTGG - Intronic
947905689 2:233760284-233760306 CGCCATGGCTGTGGAGTCCCAGG + Exonic
947926674 2:233927526-233927548 GGCCAGGACTGAGGTGTGACTGG - Intronic
948832541 2:240605226-240605248 GTCCAGGGCTGTGGGGTCCCTGG + Intronic
948835445 2:240624034-240624056 GGCCCTGGCTCTGGTGGGCTGGG + Intronic
948933484 2:241147981-241148003 GGCTGTGGCTGTGGAGTGCACGG - Intronic
949048282 2:241882229-241882251 GGCCAAGGCTGTGGCGTGCTTGG + Intergenic
1170064755 20:12299212-12299234 GGCACTGGCTGTGGTGGGCAGGG + Intergenic
1171195515 20:23194533-23194555 GGCCATGGCTGTGGAGTTTGTGG + Intergenic
1172029329 20:31970410-31970432 GGCCATGGGTGTGGGGTCCCAGG + Intronic
1172447506 20:35000903-35000925 GGCAAGGGCTGTGGGGAGCCTGG + Intronic
1173007499 20:39151328-39151350 GGCCAGGGCTGAAGGGTGCCTGG - Intergenic
1174479439 20:50820479-50820501 GGCCAGGGATGTGGTATGGCTGG + Intronic
1174552704 20:51373246-51373268 GGCAGGGGCTGTGATGTGCCTGG - Intergenic
1175047598 20:56121965-56121987 GGACTTGGCTGTGCTATGCCTGG + Intergenic
1175735010 20:61379269-61379291 TGCCTTGGCTGTGGGGTGCTGGG + Intronic
1175745221 20:61451770-61451792 CTCCCTGGCCGTGGTGTGCCAGG + Intronic
1175988356 20:62775582-62775604 TGCCATGGCTGTGGGGTCCCTGG - Intergenic
1176107885 20:63398122-63398144 GGCCATTGCTGGGCTGTGCACGG - Intergenic
1176206442 20:63891217-63891239 GGGCCTGCCTGTGGTGTGCCCGG + Exonic
1176367948 21:6045009-6045031 GGCGATGGCTGAGGGGTCCCAGG + Intergenic
1176407848 21:6431179-6431201 GGCCATGCCCGTCGTGTGCTGGG + Intergenic
1176870149 21:14077543-14077565 GGTCAAGGCTGTGGTGAGCCAGG + Intergenic
1177105076 21:16945557-16945579 GGCACTGGCTGCGTTGTGCCTGG - Intergenic
1178353481 21:31891036-31891058 GGCCAGGGCTGGGGGGTGCTCGG - Intronic
1178494796 21:33077616-33077638 GCCCATGGCTGTGGGGAACCAGG - Intergenic
1179683339 21:43039510-43039532 GGCCATGCCCGTCGTGTGCTGGG + Intergenic
1179755571 21:43493533-43493555 GGCGATGGCTGAGGGGTCCCAGG - Intergenic
1180109925 21:45643041-45643063 GGCCAGGCCTGTGGTGGGCGGGG - Intergenic
1180634326 22:17252362-17252384 GGCAAAGGTTGTGGTGAGCCTGG + Intergenic
1181427962 22:22856261-22856283 GGTCCTGGCTGTGGGGTCCCAGG - Intronic
1181683627 22:24513859-24513881 GGACAGGGCTGTGGCGTGCTAGG - Intronic
1181859154 22:25804980-25805002 GCCCATGGCTGTGATGGGCAAGG + Intronic
1182520720 22:30883204-30883226 GGCCAGGGCTGTGCTGTGCATGG - Intronic
1183187500 22:36300387-36300409 GGCCATGGCTGAGGTGGGGACGG + Intronic
1183441370 22:37824948-37824970 GCCCGTGGCTGTGGTGAGCCTGG + Exonic
1183931027 22:41236391-41236413 GGGCATGGACATGGTGTGCCTGG + Intronic
1184245876 22:43235507-43235529 AGCCCTGGCTGTGGCCTGCCTGG + Intronic
1184418604 22:44366348-44366370 GGCGACAGCTGTTGTGTGCCAGG + Intergenic
1184535166 22:45081884-45081906 GGCCCTGCCAGTGCTGTGCCCGG - Intergenic
1184658649 22:45955226-45955248 GGCCAGGCCTGGGGTGTGGCAGG - Intronic
1185269934 22:49924782-49924804 TGCCATGGTTGTGGGCTGCCTGG + Intronic
1185403084 22:50628334-50628356 GGCCCTGGCTGAGGCGTCCCGGG + Intergenic
950497254 3:13341151-13341173 GGCCATGGCAGTTGTGGCCCAGG - Intronic
953228494 3:41043018-41043040 GGGGCTGGCTGTGGTGTGGCGGG - Intergenic
954031741 3:47824877-47824899 GCCCAGGGCTGTGGTGAGCGAGG + Intronic
954419951 3:50413439-50413461 GGCCATGGCTGTGTGGAGTCAGG + Intronic
954582011 3:51707950-51707972 GGCCATGGCTAGGGTGGGCAGGG + Intronic
955231463 3:57102552-57102574 GGCCACGGCTCTGATGGGCCCGG + Exonic
961327475 3:126117932-126117954 GGACATGGCAGTGCTGTCCCAGG - Intronic
961661763 3:128472752-128472774 GGCCGTGGCTGAGCTATGCCTGG + Intergenic
962395841 3:135014791-135014813 GGCCATCACTGTGGAATGCCAGG - Intronic
966873637 3:184308707-184308729 GGCAGTGGATGTGGTGGGCCAGG + Exonic
967878157 3:194280801-194280823 GGCCATTGCTGTCATGTGTCTGG + Intergenic
968581832 4:1398879-1398901 TGCCATGGCAATGGTGTGCCTGG - Intergenic
968814211 4:2813266-2813288 GGCCGTGGCTGTGCTGGGCCGGG + Intronic
968832287 4:2939084-2939106 AGCCAAGGCTGTGGGATGCCAGG + Intronic
968964789 4:3764390-3764412 GGCCATGGCTGTCCTGTGGGAGG - Intergenic
969048586 4:4356509-4356531 GGCCACGGCTGTTGGATGCCGGG + Intronic
969153107 4:5187068-5187090 GGGATTGGCTGTGGTGTGTCAGG + Intronic
969576124 4:8036733-8036755 GGCCATGCCTGTGATGTACCTGG + Intronic
971387774 4:26157005-26157027 GACTGAGGCTGTGGTGTGCCAGG + Intergenic
971694942 4:29888770-29888792 TGGCATGGCTGTGGTGAGCATGG + Intergenic
973178675 4:47241456-47241478 GAACATGTCTATGGTGTGCCAGG - Intronic
977693785 4:99946270-99946292 GGCCAGGGCGGGGGTGTGTCGGG + Intronic
978615283 4:110587774-110587796 GGCCAGGGCTGCGGCGTCCCAGG - Intergenic
980035478 4:127878556-127878578 GGCAAAGGCTGCAGTGTGCCAGG - Intergenic
981258975 4:142696692-142696714 GTCGATGGCTGTGTAGTGCCTGG - Intronic
982325635 4:154125995-154126017 GGGCATGTCTGGGGTTTGCCAGG + Intergenic
983231623 4:165134809-165134831 GGCTATGGGTGGGGTGTGGCAGG + Intronic
983357415 4:166681416-166681438 GGACATGGCTGTGGGGTGACAGG - Intergenic
984740722 4:183158935-183158957 TACAATGGCTGTGGTGAGCCAGG + Intronic
985062494 4:186092925-186092947 GGCCATGGGAGTAGGGTGCCGGG + Intergenic
985071285 4:186169294-186169316 GGCCTTGGCTGTGTTGTCCTTGG - Intronic
985613669 5:906141-906163 GGTCCAGGCTGTGGTGAGCCTGG + Intronic
986006406 5:3672412-3672434 GGCCATGGCTGGAGTGTGCAGGG + Intergenic
987113168 5:14705746-14705768 GACCATCGCTGTGGGGTGCTGGG + Exonic
989421056 5:41240456-41240478 GGCCATGGCAGTAGGGTGGCGGG + Intronic
989783082 5:45293432-45293454 GGTCAAGGCTGAGGTGAGCCTGG + Intronic
991095254 5:62732885-62732907 GTCCATGGCTGCTGTGTGGCTGG + Intergenic
993917096 5:93756469-93756491 GGAGGTGGCTGTGGTGTGCAGGG - Intronic
997296082 5:132769364-132769386 GGACATGTCTGCTGTGTGCCAGG + Intronic
998140418 5:139696907-139696929 GGCCAGGCCTGTGGTGGGCAGGG + Intergenic
998752702 5:145340419-145340441 GGTCATGGCAGTGGTGGGCTGGG - Intergenic
999382046 5:151128130-151128152 GGGCATGGCCTTGGGGTGCCAGG - Intronic
1000359611 5:160434856-160434878 GTCCATGGCCGAGGTGTGGCAGG + Intergenic
1002198331 5:177513128-177513150 GGCCATGGCAGGGCTGTGGCGGG - Intronic
1008910855 6:56731082-56731104 GCCCAGGGCTGGGGTGTGCAGGG + Intronic
1009546338 6:65024424-65024446 GGCGATGTCTGTGGGGAGCCAGG + Intronic
1010339893 6:74737185-74737207 GGGCAGGGATGTGGTGTGCTGGG - Intergenic
1014736110 6:125097943-125097965 GCCCATGCCTGTGATGTGACTGG + Intergenic
1015531592 6:134226461-134226483 GGCCAAGGCTGTGGATTGCCTGG + Intronic
1015560957 6:134515303-134515325 AGGAATGGCTGTGGTGAGCCAGG + Intergenic
1017044542 6:150334807-150334829 GGCCTTGGCTGTGGGATCCCTGG - Intergenic
1017352534 6:153459177-153459199 GGCCATGGCCCTGGTGTACCAGG + Intergenic
1017972454 6:159325131-159325153 GGCCATGTCTGTGCTGGCCCGGG - Intergenic
1018144960 6:160877270-160877292 GGCCAGGGCTCTGGGGTACCAGG - Intergenic
1019599648 7:1874886-1874908 GGCCAGGCCTGGGGTGTGGCCGG - Intronic
1020279509 7:6643167-6643189 GGCCATGGCACTGGAGTCCCCGG + Intronic
1020781148 7:12518368-12518390 GGTAATGGCAGTGGTGAGCCAGG + Intergenic
1022455879 7:30557967-30557989 GGCCAAGGCTTTGATGAGCCAGG + Intergenic
1022549943 7:31228879-31228901 GGCCATGGCTGTAATGGGCTGGG + Intergenic
1022870301 7:34471455-34471477 GGCCATGGTAGTAGTGGGCCAGG + Intergenic
1023164329 7:37328312-37328334 GGTCAAGGCTGTAGTGAGCCAGG + Intronic
1024096012 7:45983439-45983461 GGCCAAGCCTGTGCTGTGCCTGG + Intergenic
1024113898 7:46174028-46174050 GGCCATGGCTGGTGTGTGGTGGG - Intergenic
1024584853 7:50833318-50833340 AGCCATGGCTGTGTTGGGCTGGG + Intergenic
1024733109 7:52274300-52274322 GGCCTTGGCTGGGGTGGGGCAGG - Intergenic
1028199892 7:87949155-87949177 GGCCCTGGCTCTGCTGGGCCAGG - Intronic
1030168231 7:106575671-106575693 GGCCATGCATGTCTTGTGCCAGG - Intergenic
1032323608 7:130906052-130906074 GGCCATCGTCGTGGTCTGCCAGG - Intergenic
1032708993 7:134446450-134446472 GCCCATGGCTGTGCTGCGCTCGG + Intronic
1034086625 7:148328229-148328251 GGGGAAGGCTGGGGTGTGCCGGG + Intronic
1034182230 7:149147739-149147761 GGCCATGGCTGAGGCGGCCCCGG + Exonic
1034551366 7:151822725-151822747 GGCCTTGGCTGTGTGGAGCCAGG + Intronic
1035028666 7:155843682-155843704 GGCCAGGGCTGTGGGGTTCCTGG + Intergenic
1035456949 7:159014843-159014865 TGCCATGCCTGCGGTGGGCCTGG + Intergenic
1035497106 8:61852-61874 CACCATGGCTTTGGAGTGCCTGG - Intergenic
1036809519 8:11857862-11857884 GCCCAGGGCTGTGGTGTTCCTGG + Intronic
1037838244 8:22227197-22227219 GGCCAAGGCTGTGGAGTGTCTGG - Intronic
1039476296 8:37841029-37841051 GGGCATGGCTGGGGTGGGGCTGG - Intronic
1041434076 8:57818041-57818063 GGTAATGGCAGTGGTGGGCCAGG - Intergenic
1044781549 8:95748764-95748786 GGCCAGGGCTCTGGTGTCCCTGG + Intergenic
1048363022 8:133714567-133714589 GGCCATGGCTGGCATGTGGCAGG - Intergenic
1048441214 8:134460380-134460402 AGCCATGGCTGGGGGCTGCCCGG + Intergenic
1049023365 8:139972615-139972637 GGCCAGGGCTGTGGTGTCTGGGG - Intronic
1049093651 8:140535182-140535204 AGCCAGGGGTGTGGTGTGGCTGG - Intronic
1049275936 8:141720197-141720219 GCCCGTGGCTGTCCTGTGCCTGG + Intergenic
1049351721 8:142168109-142168131 GGCAGTGGTTGTGGTGGGCCGGG - Intergenic
1049418815 8:142507769-142507791 GGCCTGGGTTGTGCTGTGCCTGG + Intronic
1049442343 8:142615133-142615155 GGCCCTGGCGTTGGTGTGCATGG + Intergenic
1051331164 9:16026222-16026244 GACCCTGGCTCTGGTGTGGCAGG - Intronic
1051605256 9:18911953-18911975 CGACAGGCCTGTGGTGTGCCGGG - Intergenic
1052813609 9:33083104-33083126 AGCCAGGGCTGGGCTGTGCCAGG - Intergenic
1055558150 9:77496540-77496562 GTCCAGGGCTGTGGGTTGCCAGG + Intronic
1056279940 9:85031275-85031297 GGAAATGGCTGTGATGTGTCTGG - Intergenic
1056494991 9:87147903-87147925 GGCAATGGACCTGGTGTGCCTGG - Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1056786268 9:89594740-89594762 GGCCATGGCGGGGGTGGACCTGG - Intergenic
1057198767 9:93129533-93129555 GGGCTGGGCTGTGGTGAGCCAGG - Intronic
1061968850 9:134032589-134032611 GGCCTTGCCAGTGGTGTGCCGGG - Exonic
1062148812 9:135007051-135007073 GGACCTGGCTGTGGAGGGCCGGG - Intergenic
1062148833 9:135007111-135007133 GGGCCTGGCTGTGGGGAGCCGGG - Intergenic
1062245143 9:135562304-135562326 CGCCATGGCCATGGAGTGCCAGG - Exonic
1062549476 9:137079282-137079304 GCCCGTGGGCGTGGTGTGCCAGG + Exonic
1062699131 9:137890014-137890036 GGGCTTGGCTGTGCTGTGCTTGG + Intronic
1186448388 X:9651995-9652017 GGCCCCAGCTGTGCTGTGCCTGG - Intronic
1187326484 X:18295234-18295256 GGCACTGGCTGTGGTGGGCAGGG - Intronic
1189508514 X:41637710-41637732 GGTCGAGGCTGTGGTGAGCCAGG - Intronic
1190116632 X:47629710-47629732 GGTCAGGGATGTGGTGGGCCTGG + Intronic
1190386134 X:49883681-49883703 GGACATGGCTGTGTTCTTCCAGG - Intergenic
1190452231 X:50593711-50593733 GGATGTGGCTCTGGTGTGCCTGG + Exonic
1190832735 X:54073892-54073914 GGTCATGGCTGCAGTGAGCCAGG - Intronic
1191956858 X:66651721-66651743 GCCTATAGCTGTGGTGAGCCTGG - Intergenic
1192038325 X:67589728-67589750 AGCCATGCCTTTGGTGTGCATGG + Intronic
1195536515 X:106014173-106014195 GGCAGTGGCTGTGATGTGCTAGG + Intergenic
1198761097 X:140033205-140033227 GGCTATGGCGGTGGTGGACCAGG + Intergenic
1200097990 X:153673158-153673180 GGCAATGGCTGAGGCCTGCCTGG - Intronic