ID: 1149603263

View in Genome Browser
Species Human (GRCh38)
Location 17:57907069-57907091
Sequence GGAAATCCTGGCCTGCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149603263 Original CRISPR GGAAATCCTGGCCTGCACAG AGG Intronic