ID: 1149604727

View in Genome Browser
Species Human (GRCh38)
Location 17:57916595-57916617
Sequence CCTGACAGGAAGACAGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 164}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149604714_1149604727 26 Left 1149604714 17:57916546-57916568 CCCGTCACCACCTCCCAGGCCAG 0: 1
1: 1
2: 7
3: 64
4: 600
Right 1149604727 17:57916595-57916617 CCTGACAGGAAGACAGCGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 164
1149604715_1149604727 25 Left 1149604715 17:57916547-57916569 CCGTCACCACCTCCCAGGCCAGT 0: 1
1: 2
2: 6
3: 66
4: 493
Right 1149604727 17:57916595-57916617 CCTGACAGGAAGACAGCGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 164
1149604716_1149604727 19 Left 1149604716 17:57916553-57916575 CCACCTCCCAGGCCAGTGTGATC 0: 1
1: 0
2: 7
3: 105
4: 1136
Right 1149604727 17:57916595-57916617 CCTGACAGGAAGACAGCGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 164
1149604719_1149604727 12 Left 1149604719 17:57916560-57916582 CCAGGCCAGTGTGATCGATGCTG 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1149604727 17:57916595-57916617 CCTGACAGGAAGACAGCGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 164
1149604717_1149604727 16 Left 1149604717 17:57916556-57916578 CCTCCCAGGCCAGTGTGATCGAT 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1149604727 17:57916595-57916617 CCTGACAGGAAGACAGCGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 164
1149604721_1149604727 7 Left 1149604721 17:57916565-57916587 CCAGTGTGATCGATGCTGGCAGA 0: 1
1: 0
2: 0
3: 13
4: 103
Right 1149604727 17:57916595-57916617 CCTGACAGGAAGACAGCGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 164
1149604718_1149604727 13 Left 1149604718 17:57916559-57916581 CCCAGGCCAGTGTGATCGATGCT 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1149604727 17:57916595-57916617 CCTGACAGGAAGACAGCGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149604727 Original CRISPR CCTGACAGGAAGACAGCGGA AGG Intronic
901353330 1:8618917-8618939 CCTGACAGTACAACAGCAGAAGG - Intronic
902005547 1:13229178-13229200 CCTGAGTGGAAGACAGGGAAGGG - Intergenic
902024867 1:13375455-13375477 CCTGAGTGGAAGACAGGGAAGGG - Intergenic
902078259 1:13804154-13804176 GATGACATGAAGACAGCGCATGG + Intronic
903874607 1:26464879-26464901 ACTGAGAGGAAGGCAGCGGGTGG + Intronic
905096355 1:35474610-35474632 CCTGACAGGAAGTCAGAGGAGGG + Intronic
905224689 1:36471617-36471639 CCCTGGAGGAAGACAGCGGACGG - Exonic
905738066 1:40344478-40344500 CCTGACAGGAGAACAATGGAGGG - Intergenic
910217652 1:84858532-84858554 CCTGTCAGGTAGACAAGGGAGGG - Intronic
912096724 1:106153741-106153763 CCTGACAGTAACATAGGGGAAGG - Intergenic
912208119 1:107530725-107530747 CCTGGCAGGAAGACAGTGCAGGG - Intergenic
913163713 1:116167296-116167318 CTTGACAGGAAGGCAGCTCAGGG - Intergenic
914014186 1:143802975-143802997 ACTGACAGGATGACTGCAGAGGG - Intergenic
914652806 1:149711533-149711555 ACTGACAGGATGACTGCAGAGGG - Intergenic
915731475 1:158057176-158057198 CCTAACACGAAGAGAGCTGAGGG + Intronic
916926266 1:169524185-169524207 CCTAACAGGAAGACATGGAAGGG + Intronic
919981346 1:202644274-202644296 CCAGACAGGAACCCAGCAGAAGG + Intronic
920677963 1:208051423-208051445 CCTGACAGGGAGACAGCAGGAGG + Exonic
1063227810 10:4032898-4032920 CCAGACAGGGGGACAGCAGAGGG + Intergenic
1063364832 10:5483673-5483695 CTGGACAGGAAGACAACAGAAGG - Intergenic
1064191691 10:13211999-13212021 CTTGACAGGAAGAGATCGCATGG + Intergenic
1067227240 10:44384251-44384273 AGAGACAGGAAGACAGCGGCTGG + Intronic
1072981409 10:100100926-100100948 CCTGGCAGGAAGATAGATGATGG - Intergenic
1075081468 10:119386803-119386825 CCTGACTGGAACCCAGAGGAGGG + Intronic
1075086834 10:119419283-119419305 TCTGACACGCAGCCAGCGGAGGG + Intronic
1075946752 10:126440051-126440073 CCTGGCAGGAATTCAGGGGAGGG + Intronic
1076440426 10:130477486-130477508 CATGGCAGGAAGACAGGAGAAGG - Intergenic
1078735040 11:14012030-14012052 CCTGGCAGGTAAACAGTGGATGG + Intronic
1082778747 11:57269756-57269778 CCTGAAAGGCAGACAGAGGCTGG - Intergenic
1085731369 11:79001940-79001962 CATGACAGCAAAACAGTGGAGGG - Intronic
1088579729 11:111302802-111302824 CCTCACTGGAAGCCATCGGATGG + Intronic
1088892221 11:114054010-114054032 CCTGACAGGGAGAAAACGCAAGG - Intergenic
1089621378 11:119724329-119724351 CCTGCCAGGGAGACAACAGAAGG + Intronic
1089940466 11:122411137-122411159 CCCGAGAGGATGACAGGGGAGGG - Intergenic
1091818024 12:3454250-3454272 CCTGACGGGGAGCCTGCGGATGG + Intronic
1091894374 12:4089230-4089252 CCTGCCAGGAGGCCAGAGGATGG + Intergenic
1091990990 12:4955701-4955723 CCGGACTGGAAGAGAGAGGAGGG + Intergenic
1092027987 12:5259066-5259088 CCTCACAGCAAGACAGCAGTGGG - Intergenic
1098862171 12:75722353-75722375 TCTGACAGGTAGACAGGGAAGGG - Intergenic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1102782412 12:115576539-115576561 AATGAAAGGAAGACAGTGGAGGG - Intergenic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1104336516 12:127900883-127900905 GCTGACTGGAAGACAGGGAATGG - Intergenic
1105874679 13:24541373-24541395 CCCGGCAGGAAGAGAGGGGAAGG - Intergenic
1110470474 13:75854419-75854441 GATGACAGGAAGACAGAGGAGGG + Intronic
1110833081 13:80053861-80053883 CCTGACTGGAAGAGAGGGAAAGG + Intergenic
1112607988 13:100926866-100926888 CCTGAGAGCCAGACAGCTGATGG - Intergenic
1113542261 13:111118058-111118080 CCTGACAGCCAGTGAGCGGAGGG + Intronic
1114150296 14:20031072-20031094 CCTGACAGGAAGACAGTTTGAGG + Intergenic
1116428038 14:44813689-44813711 CCTGAGAGGAAGAAAGAGGAGGG + Intergenic
1116953602 14:50900639-50900661 CCTGAGATGAAGCCAGCTGATGG + Intronic
1126256914 15:46638512-46638534 TTTGACAGGAAGACAGAGGAGGG + Intergenic
1126538999 15:49801639-49801661 CCTGAAGGGAAGCCAGTGGAGGG - Intergenic
1127773764 15:62250368-62250390 GCTGCCAGGAATACAGCAGATGG + Intergenic
1129635523 15:77312722-77312744 CCTGGCAGGAAGAAGGCTGAAGG + Intronic
1130028828 15:80293989-80294011 GCTGTCAGGGAGACAGCTGATGG - Intergenic
1130830207 15:87591574-87591596 CATGACAGAAAGACAGAGCAAGG - Intergenic
1132626278 16:893072-893094 CCTGCAAGGAAGAGAGCAGAGGG + Exonic
1133679986 16:8112473-8112495 GGTGACTGGAAGAAAGCGGAAGG - Intergenic
1136594681 16:31239847-31239869 CCAGACAGGGAGAGAGAGGAGGG - Intergenic
1137758456 16:50920904-50920926 CCTGACAGCAAGAGAGCTGAAGG - Intergenic
1140890222 16:79278764-79278786 CCTGACAGGGGGACAGGAGATGG + Intergenic
1140951074 16:79817972-79817994 CCAGACCAGAAGATAGCGGATGG - Intergenic
1140984277 16:80142707-80142729 ACTGGCAGGAAGACAGGGGAGGG + Intergenic
1147420570 17:40320330-40320352 CCTGGCAGGAAGCCAGCTGTGGG + Intronic
1148647216 17:49225922-49225944 CTGGACAGGAAGACAGAGTAGGG + Intronic
1149604727 17:57916595-57916617 CCTGACAGGAAGACAGCGGAAGG + Intronic
1151626387 17:75278450-75278472 CCTGCCAGGAAGACAGTCAAGGG + Intronic
1152551864 17:81034336-81034358 CCAGACAGGCAGACAGCGCTTGG - Intergenic
1152569251 17:81114366-81114388 CCTGGCAGGCAGACAGGGCATGG + Intronic
1152730889 17:81969366-81969388 CCTGACAGGGTGACAGGGGAAGG + Intergenic
1153434909 18:5058902-5058924 CCCGACAGGAAGCCAGAGGGTGG - Intergenic
1153970125 18:10218554-10218576 CCTGACAGGCTGAAAGAGGAGGG + Intergenic
1158909644 18:62047255-62047277 CCTGACACCATGACAGTGGAGGG - Intronic
1161054032 19:2181002-2181024 ACTGACAAGGAGACAGAGGAAGG - Intronic
1161497160 19:4592963-4592985 CCCTACAGGAAGGCAGTGGAGGG - Intergenic
1162472215 19:10879182-10879204 CCAGACAGCAGGACAGAGGAAGG + Intronic
1163449286 19:17366195-17366217 CCTGCCCGGAAGATAGGGGAAGG + Exonic
1164861661 19:31566537-31566559 CCTGACAGGGGGAAAGAGGAGGG + Intergenic
1165007656 19:32819721-32819743 CCTGACAGGTAGAGAGGGAATGG + Intronic
1165307968 19:35013722-35013744 ACTGATAGGAAGAGAGAGGAGGG + Intronic
1168242731 19:55095509-55095531 CCTGAAAGGCGGACAGCGGAGGG - Exonic
926700463 2:15800026-15800048 CTGGACAGGAAGGCAGCGCAGGG + Intergenic
927313368 2:21654790-21654812 CCTGGCAGGAAGAGAGGGGATGG + Intergenic
929292540 2:40209802-40209824 GCTGACAGTAAGACACAGGAGGG + Intronic
933803776 2:85983314-85983336 GCGGACAGGAAGACAGGGGTAGG - Intergenic
934765038 2:96875927-96875949 AGTGACAGGGAGACAGAGGAAGG + Exonic
937198285 2:120179869-120179891 ACTGACAGGAAGATGGAGGATGG + Intergenic
937446115 2:121959643-121959665 CCTGGGAGGTAGACAGGGGAAGG + Intergenic
937535108 2:122876677-122876699 CCTGAAAGGAAGAAAGCAGAGGG - Intergenic
940792371 2:158042693-158042715 CCTTATAGGAAGAGAGAGGAAGG + Intronic
949007670 2:241658933-241658955 ACAGACAGGAAGAAAGCTGAGGG - Intronic
1172197051 20:33099182-33099204 ACTAGCAGGAAGACAGCAGATGG - Intronic
1172916669 20:38448483-38448505 CTACAGAGGAAGACAGCGGATGG - Intergenic
1175578288 20:60079062-60079084 CCTGACAGGGAGCCAGGGAAGGG + Intergenic
1180749464 22:18114143-18114165 CCTAACAGGAAGACACTGCAGGG - Intronic
1181755206 22:25019198-25019220 TCTGACAGGAAGGCAGGGGTGGG + Intronic
1182295490 22:29309458-29309480 CCTGGGAGGCAGATAGCGGATGG + Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1184105398 22:42364757-42364779 CCCGTCAGGAAGGCAGGGGAAGG + Intergenic
1184930265 22:47675588-47675610 CCTTCCCGGAAGACAGAGGAGGG + Intergenic
1185317091 22:50183944-50183966 CCTCACAGGAGGGCAGCGGGTGG - Intergenic
1185422839 22:50744645-50744667 CTGGACAGGGAGACAGCGGCGGG + Exonic
949796880 3:7861003-7861025 CCTGAATGGAAGACAGGGCAAGG + Intergenic
950184275 3:10935408-10935430 ACAGACAGGAAGACAGAGGCTGG - Intronic
952069381 3:29616041-29616063 CATGACAGGGAGACAGCTCAAGG + Intronic
954660062 3:52222245-52222267 CCTGGCAGGAAACCAGCTGAAGG - Exonic
954766005 3:52917373-52917395 CCTTACAGGAAGAGAGGGGTCGG + Intronic
959584819 3:108016121-108016143 CATCACAGGAAGAGAGGGGATGG - Intergenic
961107272 3:124252752-124252774 CTTGACAGAAAGACAGCTGGTGG + Intronic
961602777 3:128073768-128073790 CTTGTCAGGCAGACAGCAGAGGG - Intronic
962269182 3:133965720-133965742 CCTGAGAAGAAGACAGAGGGAGG - Intronic
962414145 3:135167181-135167203 CATGACAGGTAGACGGCAGATGG - Intronic
962917432 3:139917392-139917414 CCTGTCAGGTTGACAGCGGAAGG + Intergenic
967000567 3:185330276-185330298 TCTGAGATGAAGACAGAGGAAGG - Intronic
968623924 4:1618111-1618133 CCTGGAAGGAAGACAGAGGCAGG + Intronic
974981996 4:68968190-68968212 CATGGGAGGAAGACAGTGGAAGG + Intergenic
977238371 4:94536249-94536271 CCAGGCCGGAAGACAGCTGAAGG + Intronic
977281586 4:95046692-95046714 CCTGACAGAAGGGCAGAGGAAGG - Intronic
978859423 4:113430804-113430826 GCTGACTGGAAGAAAGCGGAAGG - Intergenic
980421540 4:132566592-132566614 CCTGACAGGCAGGCAGCAGTTGG + Intergenic
980880069 4:138700936-138700958 CCTGACAGGAAATCAGAGGAAGG + Intergenic
981595808 4:146420522-146420544 CCTGAGAGGAAGAAAGTGGATGG + Intronic
984729587 4:183055201-183055223 GCTGAGAGGAAGAAAGAGGAGGG - Intergenic
985564481 5:608555-608577 CCTGTCAGGGAGACAGCACACGG + Intergenic
985875801 5:2592958-2592980 CCTCACAGGAATACGGCGGAGGG - Intergenic
986059116 5:4171325-4171347 GCTGAAGGGAAGACAGAGGATGG + Intergenic
986984348 5:13483016-13483038 CCAGACAGGAAGGAAGCTGAAGG + Intergenic
991545236 5:67774355-67774377 CCTGCCAGGAAGGCATCTGAAGG + Intergenic
991966454 5:72096289-72096311 GCTGATAGGAAGAAAGCAGACGG - Intergenic
993037875 5:82777135-82777157 CCTGACAGTAAGACTGGGGCAGG - Intergenic
998203997 5:140146258-140146280 GCTGCCAGGAGGGCAGCGGAGGG - Intergenic
999259445 5:150228974-150228996 CCTGACAGCCAGGCAGGGGAAGG + Intronic
999304147 5:150508976-150508998 GCTGGCAGGAAGACAGAGGCAGG - Intronic
999825143 5:155266592-155266614 CCTTACGGGAAGACAGAGAAAGG + Intergenic
1000505997 5:162118905-162118927 ACTCAGAGGAAGACAGAGGAAGG + Intronic
1000758949 5:165197162-165197184 CCACACAGGAAGAATGCGGAGGG - Intergenic
1000875607 5:166633964-166633986 CCTGAAAGAAAGAAAGCGAATGG - Intergenic
1006191490 6:32212492-32212514 TCTGGCAGGAGGACAGTGGAAGG + Exonic
1006548901 6:34804080-34804102 CCTGAAAGGAAGACAGTGTGGGG - Intronic
1007554133 6:42752112-42752134 TCTGGCAGGAAGACAGTGAAAGG + Intronic
1014005975 6:116418603-116418625 CATGACAGCAAGACAGAGCAAGG - Intronic
1015566974 6:134583360-134583382 ACTGAAAGGAAGACATCAGATGG + Intergenic
1019670612 7:2276172-2276194 CCTGCCAGGGAGCCAGCGGCTGG - Intronic
1019881722 7:3866978-3867000 CCTGCCAGAAGGACAGAGGATGG - Intronic
1019921517 7:4166385-4166407 ATTGATAGGAAGACAGCAGAAGG + Intronic
1019932646 7:4234132-4234154 CCTCCCAGAAAGCCAGCGGAGGG + Intronic
1022356057 7:29615630-29615652 CCAGAGAGGAAGACAGAGGTAGG - Intergenic
1024995943 7:55273334-55273356 TCTGACAGGCAGTCAGCGGCAGG - Intergenic
1026221293 7:68399868-68399890 CCAGACAGGCAGACAGGGGCAGG - Intergenic
1027171019 7:75872506-75872528 CCTGACAGGCACAGAGAGGAAGG + Intronic
1031172818 7:118313041-118313063 ACTGAGAGGAGGACAGGGGAAGG + Intergenic
1031947135 7:127854026-127854048 CCTGAAAGGCAGAAAGCAGATGG - Intronic
1032986538 7:137343699-137343721 CCTGACAGGGAGGGAACGGAAGG + Exonic
1033546109 7:142401644-142401666 CCTGAGAGGAAGAGAGCATAAGG - Intergenic
1036563168 8:9914516-9914538 CCTCGCAGGAAGCCAGAGGAAGG + Intergenic
1037419444 8:18686821-18686843 CCAGACAGGATGACAGCAGATGG - Intronic
1037576281 8:20206798-20206820 TCTGTCAGGAAGTCAGGGGATGG + Intronic
1038643628 8:29346970-29346992 CAGGACAGGAAGCCAGTGGAAGG - Intronic
1042052333 8:64724907-64724929 ACAGACAGAAAGACAGGGGAAGG - Intronic
1042732588 8:71953946-71953968 CCTGGCAGGAACACAGTGGTAGG - Intronic
1046223944 8:111251961-111251983 CTTCACAGGAAGACAGGAGAGGG + Intergenic
1047859302 8:128947147-128947169 CCTGACAGGGAGACAGTTGGTGG - Intergenic
1049214520 8:141401647-141401669 CCTGGCAGGAAGTCACCGGAAGG + Intronic
1051144363 9:14010763-14010785 CCAGACTGGATGACAGAGGAAGG - Intergenic
1053308309 9:36999625-36999647 GCTAAGAGGAAGACAGCTGAGGG - Intronic
1059450556 9:114368785-114368807 CCTGAAAGGAAGACAGGGTGGGG + Intronic
1061107971 9:128546954-128546976 CCTGACAGCCAGTCAGCTGATGG + Intergenic
1061675191 9:132211616-132211638 CCAGACAGGAAGGCTGGGGAGGG - Intronic
1061918475 9:133769416-133769438 CCTGACCAGAAGGGAGCGGAGGG + Exonic
1062161585 9:135083359-135083381 CCTGCCAGGGAGAGTGCGGAGGG + Intronic
1062319553 9:135984118-135984140 CCTCAGAGGAGGACAGGGGAGGG + Intergenic
1062337626 9:136079342-136079364 CCTGCCTGGAAGCCAGAGGATGG - Intronic
1186514798 X:10158803-10158825 CCAGACAGAAAGACGGGGGAGGG + Intronic
1188539340 X:31232207-31232229 CCTGACAGGTAGGCAGGGGGAGG + Intronic
1189980220 X:46502762-46502784 CATGACAGGCAGACAGCATAAGG + Intronic
1190227816 X:48559652-48559674 ACTGACAGGCCGAGAGCGGATGG + Exonic
1192536112 X:71929080-71929102 GCTGAGAGGAAGACAGGGCAGGG + Intergenic
1193681033 X:84518969-84518991 CCTGGCCGGAACACAGGGGAGGG - Intergenic
1194433871 X:93846059-93846081 CCAGAAAGGAAGAAAACGGAAGG - Intergenic
1195676578 X:107511553-107511575 CCTCACAGGAAGGAAGCAGATGG + Intergenic
1199974225 X:152883157-152883179 CCTGAAAGAAAGACAGCCGTGGG + Intergenic
1200066802 X:153507859-153507881 GCTGACTGGAAGAAAGAGGAGGG + Intronic
1200226448 X:154420283-154420305 GCAGACAGGCAGACAGCCGAAGG - Intronic