ID: 1149610734

View in Genome Browser
Species Human (GRCh38)
Location 17:57956052-57956074
Sequence CTTGAAGTGATCAGGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 158}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149610734_1149610741 8 Left 1149610734 17:57956052-57956074 CCAGCATCCCTGATCACTTCAAG 0: 1
1: 0
2: 0
3: 13
4: 158
Right 1149610741 17:57956083-57956105 AGCCCTGGGAAGATTTTCCACGG 0: 1
1: 0
2: 3
3: 19
4: 211
1149610734_1149610739 -7 Left 1149610734 17:57956052-57956074 CCAGCATCCCTGATCACTTCAAG 0: 1
1: 0
2: 0
3: 13
4: 158
Right 1149610739 17:57956068-57956090 CTTCAAGGGCTGCTGAGCCCTGG 0: 1
1: 0
2: 1
3: 32
4: 246
1149610734_1149610746 30 Left 1149610734 17:57956052-57956074 CCAGCATCCCTGATCACTTCAAG 0: 1
1: 0
2: 0
3: 13
4: 158
Right 1149610746 17:57956105-57956127 GAAGAACTTGTTTAATAAATGGG 0: 1
1: 0
2: 3
3: 42
4: 453
1149610734_1149610745 29 Left 1149610734 17:57956052-57956074 CCAGCATCCCTGATCACTTCAAG 0: 1
1: 0
2: 0
3: 13
4: 158
Right 1149610745 17:57956104-57956126 GGAAGAACTTGTTTAATAAATGG 0: 1
1: 1
2: 2
3: 27
4: 400
1149610734_1149610740 -6 Left 1149610734 17:57956052-57956074 CCAGCATCCCTGATCACTTCAAG 0: 1
1: 0
2: 0
3: 13
4: 158
Right 1149610740 17:57956069-57956091 TTCAAGGGCTGCTGAGCCCTGGG 0: 1
1: 0
2: 0
3: 27
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149610734 Original CRISPR CTTGAAGTGATCAGGGATGC TGG (reversed) Intergenic