ID: 1149614001

View in Genome Browser
Species Human (GRCh38)
Location 17:57982714-57982736
Sequence CCACAAACACTGCAAGTATA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 2, 1: 0, 2: 0, 3: 19, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149613996_1149614001 -7 Left 1149613996 17:57982698-57982720 CCTTGAGAAGCCTTTCCCACAAA 0: 1
1: 0
2: 1
3: 17
4: 197
Right 1149614001 17:57982714-57982736 CCACAAACACTGCAAGTATAGGG 0: 2
1: 0
2: 0
3: 19
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149614001 Original CRISPR CCACAAACACTGCAAGTATA GGG Exonic
900476139 1:2877259-2877281 CCAAAAATACTGCAGGAATAGGG - Intergenic
903924574 1:26822689-26822711 CCACTCACCCTGCAACTATAAGG - Intergenic
905649627 1:39647571-39647593 CCACAAACAGTGGCAGAATAGGG - Intergenic
905658092 1:39699172-39699194 CCACAAACGCTGCAAGAAGGTGG - Intronic
905754309 1:40495622-40495644 CCACATTCATTGCAAGTAAAAGG - Exonic
906846115 1:49194380-49194402 ACATATACACTGAAAGTATAGGG - Intronic
906901998 1:49845323-49845345 CCACATACACTGCACTCATAGGG - Intronic
907407647 1:54263467-54263489 CCACAAACACTGCAGGGCTGTGG + Intronic
907893104 1:58655024-58655046 CCACAAACACTGATAGCATTTGG + Exonic
909169666 1:72280165-72280187 CCAACAACACTGGAAATATATGG + Intronic
910016030 1:82525264-82525286 CCACAAACATTTCAACTTTATGG + Intergenic
910388743 1:86714360-86714382 CCAGCTACACTGCAAGTTTATGG + Intronic
911368563 1:96970061-96970083 CCAAATACACTGTAAGTACATGG - Intergenic
915185865 1:154104794-154104816 CCACAAAGACTGCAATTCTTGGG + Intronic
915865850 1:159498107-159498129 ACACATACACTGAAAGTAAAGGG - Intergenic
916617940 1:166462955-166462977 ACACATACACTGAAAGTAAAGGG - Intergenic
916890865 1:169111165-169111187 CCATACACACTGCAAGTGGAGGG + Intronic
917939930 1:179908638-179908660 CCCCACAAACTGCAAGAATAAGG + Exonic
918553426 1:185770840-185770862 CCACAAACACTGCCTTAATAAGG - Intronic
918742945 1:188159667-188159689 CCACAAATACTGTAAAAATACGG + Intergenic
923855026 1:237837327-237837349 CCACTACAACTGCAAGTATGAGG + Intergenic
1063555265 10:7073171-7073193 CCACAAACCCCACATGTATATGG + Intergenic
1064412977 10:15124246-15124268 CCCCAAACACTGAAAGGGTAGGG + Intronic
1068870141 10:61934667-61934689 CCACAAACCATGCAGATATAAGG - Intronic
1070656457 10:78275046-78275068 CCACAAACACTGAATGGAAAAGG - Intergenic
1071001338 10:80833822-80833844 TCAAAAACACTGAAAGTAAATGG + Intergenic
1077667108 11:4122060-4122082 TTAGAAACACTGCAAGCATAAGG - Intronic
1077950948 11:6956193-6956215 CCACATTCACTGCATTTATAGGG - Exonic
1078840210 11:15071045-15071067 CCAAAAACCCTGCAATTCTAGGG - Intronic
1079614782 11:22478805-22478827 CCCCAAATACTGCAAATATAAGG - Intergenic
1091910249 12:4224831-4224853 GCACAAGCACAGCAAATATATGG + Intergenic
1092330042 12:7578221-7578243 CCAAAGACACTGCAAGAAAAGGG - Intergenic
1093150088 12:15610696-15610718 CCAAAAACAGAGAAAGTATAAGG - Intergenic
1093452773 12:19334592-19334614 CCACAAAAACTGCAAATAGTGGG - Intronic
1094292733 12:28870505-28870527 ATATAAACTCTGCAAGTATAGGG + Intergenic
1094380844 12:29841158-29841180 CCACAAACACTGCAATTCCTAGG - Intergenic
1094647721 12:32343014-32343036 CCAGAAGCACTGCAATTGTAAGG - Intronic
1097600313 12:61683781-61683803 CCCCAAAAACTACAAATATATGG + Intergenic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1099955179 12:89346243-89346265 CCTCAAACATTGCAACTTTATGG + Intergenic
1104228480 12:126860392-126860414 CCACAAACACTGCAGCTAGGAGG + Intergenic
1105036415 12:132926439-132926461 CCACACTCACTGCAACTGTAGGG + Exonic
1105046812 12:133010900-133010922 CCACAATCACTGCATTGATAGGG - Exonic
1105066383 12:133203013-133203035 CCACAATCACTACAAACATAAGG - Intergenic
1105441247 13:20416648-20416670 CAAATAACACTGCAAGTATAGGG - Intronic
1106251853 13:27987848-27987870 CAATAAACACATCAAGTATAAGG + Intronic
1109486331 13:63026083-63026105 CCAGAAACACTGTAGTTATAAGG + Intergenic
1112229618 13:97575471-97575493 CCATAAACATTGCAAGGAAATGG - Intergenic
1112543865 13:100344963-100344985 CCACAAACCATGCACGTGTAAGG + Intronic
1112925711 13:104672755-104672777 CCACAAACTCTGTAAGAAAAGGG + Intergenic
1114317891 14:21524508-21524530 CCACAGACATTGCACTTATAGGG + Exonic
1115381308 14:32743231-32743253 ACACATAGACTGAAAGTATAGGG - Intronic
1115881731 14:37927146-37927168 CCCCAAACACTGAAAGTAACAGG + Intronic
1116923322 14:50605142-50605164 GCACAAACTCTCCAAGGATATGG - Intronic
1120207500 14:81602217-81602239 AAACAAACACAGAAAGTATAAGG - Intergenic
1125858645 15:42976162-42976184 CCTCTAAAACTGCAAGTATCTGG - Intronic
1126413446 15:48395103-48395125 CCAAAAACACTGCACATGTAAGG - Intergenic
1127413440 15:58732339-58732361 CCGCAATCACTGCATTTATAAGG - Intronic
1127792520 15:62410964-62410986 CCACAACCACAGCAAGCACATGG - Intronic
1129344078 15:74905807-74905829 ACACAAAAACTGCAAGTCTTTGG + Intronic
1130423373 15:83771141-83771163 CCAGAAACAGATCAAGTATAAGG - Intronic
1131196602 15:90360363-90360385 CCACACTCAATGCACGTATAGGG - Exonic
1136567235 16:31077714-31077736 CCACACTCACTGCACTTATAGGG - Exonic
1137786052 16:51138719-51138741 CCACAAATAGTGCAAGCAAAGGG + Exonic
1138797569 16:59988281-59988303 AAAAAAACACTGCAAGTAAAGGG - Intergenic
1140047138 16:71448160-71448182 CCACACACACTACACATATAGGG + Exonic
1140937788 16:79690995-79691017 CCACAAACCCTGCCAGGATAGGG - Intergenic
1141492207 16:84381678-84381700 CCACATACACTGCAGGAATATGG - Intronic
1141568037 16:84916483-84916505 CCACAAAGACTGCACCTATCCGG - Intronic
1144491548 17:15716532-15716554 CCACATTCATTGCAGGTATAGGG - Exonic
1144594133 17:16552265-16552287 CCACACACACTGCATTTATATGG + Exonic
1144908936 17:18662673-18662695 CCACATTCATTGCAGGTATAGGG + Exonic
1145015857 17:19397746-19397768 CCACTAACACTGCAAGGTCAGGG + Intergenic
1149125837 17:53230951-53230973 CTACACACATTTCAAGTATACGG - Intergenic
1149614001 17:57982714-57982736 CCACAAACACTGCAAGTATAGGG + Exonic
1152073752 17:78146607-78146629 CCACATATACAGCAAGTTTAGGG - Intronic
1156554220 18:38048970-38048992 CCACAATCAATGCAAGTTTATGG - Intergenic
1157420662 18:47545151-47545173 CCACAAACAAGACACGTATATGG + Intergenic
1157954473 18:52081649-52081671 CCACAAGGACTGCAACTCTAAGG + Intergenic
1163898535 19:20080494-20080516 GCACAAACGCTGCAAGTCCAGGG - Intronic
1165555428 19:36627200-36627222 CCACATTCATTGCAAATATAGGG - Exonic
1165565190 19:36720066-36720088 CCACATTCACTACAAATATAGGG - Exonic
1166600143 19:44086586-44086608 CCACATACATTACAATTATATGG - Exonic
1166633418 19:44428376-44428398 CCACACACACCACACGTATAGGG + Exonic
1166633514 19:44429048-44429070 CCACACTCACTGCATTTATAGGG + Exonic
1166652911 19:44588293-44588315 CCACATTCACTGCATGCATAGGG - Intergenic
1167815069 19:51873079-51873101 CCACAATCACTGCATTTATAAGG + Exonic
1167816909 19:51890913-51890935 CCACAGTCACTGCATTTATAGGG + Exonic
1167816932 19:51891165-51891187 CCACATTCACTGCATGTATGAGG + Exonic
1167822879 19:51945330-51945352 CCACAGTCACTGCATGTATAGGG - Exonic
1167825106 19:51965566-51965588 CCACATTCACTGCATATATAGGG + Exonic
1167828134 19:51993439-51993461 CCACACTCATTGCAAATATAAGG + Exonic
1167828151 19:51993607-51993629 CCACAATCATTGCATATATATGG + Exonic
1167830445 19:52016468-52016490 CCACATTCACTGCACATATAGGG + Exonic
1167830451 19:52016552-52016574 CCACATTCACTGCATATATAGGG + Exonic
1167832256 19:52034291-52034313 CCACATTCACTGCATGTGTAGGG + Exonic
1168457504 19:56525187-56525209 CCACAATCAATGCAATTAAAAGG - Exonic
1168460744 19:56555051-56555073 CCACACACACTGCATTCATAAGG - Exonic
1168546355 19:57253675-57253697 CCACATTCACTGCACTTATAAGG - Exonic
1168554715 19:57328306-57328328 CCACATTCACTGCACTTATAAGG - Exonic
1168560463 19:57377775-57377797 CCACATTCACTGCAACCATAAGG - Exonic
1168563044 19:57399293-57399315 CCACAATCATTGCACTTATAAGG - Exonic
1168563051 19:57399377-57399399 CCACATACACTGCACTCATAAGG - Exonic
1168563061 19:57399461-57399483 CCACATTCACTGCATTTATAAGG - Exonic
1168568554 19:57444592-57444614 CCACATTCACTGCATGTATAAGG - Exonic
1168571337 19:57473341-57473363 CCACATTCACTGCACTTATATGG + Exonic
1168574051 19:57493413-57493435 CCACATTCACTGCATGTAAAAGG - Exonic
1168574063 19:57493581-57493603 CCACATTCACTGCACTTATAAGG - Exonic
1168575711 19:57506915-57506937 CCACATTCACTGCATGTAAAAGG - Exonic
1168575723 19:57507083-57507105 CCACATTCACTGCACTTATAAGG - Exonic
1168587670 19:57606993-57607015 CCACATACACTGCACTCATAAGG - Exonic
1168589497 19:57620978-57621000 CCACAATCACTGCACTTATAAGG - Exonic
1168589501 19:57621062-57621084 CCACAATCACTGCAATCATAAGG - Exonic
1168597224 19:57687527-57687549 CCACAATCACTGCACTGATAAGG - Exonic
1168611964 19:57808275-57808297 CCACAATCACTGCATTCATATGG + Exonic
1168616573 19:57842235-57842257 CCACAATCACTGCATTCATATGG - Intronic
1168618777 19:57859967-57859989 CCACATTCACTGCACTTATAAGG - Exonic
1168620212 19:57872723-57872745 CCACAATCACTGCATTCATATGG + Exonic
1168624733 19:57908701-57908723 CCACATTCACTGCACTTATAAGG + Exonic
1168628904 19:57941654-57941676 CCACATTCACTGCACATATAAGG + Exonic
1168656039 19:58128794-58128816 CCACACTCATTACAAGTATAAGG + Exonic
1168678281 19:58294910-58294932 CCACACACACTGCAGGTGTATGG - Exonic
1168700186 19:58433630-58433652 CCACATTCACTGCATTTATAAGG + Exonic
925227417 2:2196411-2196433 CAACAAATACTGTAAGTATGTGG + Intronic
926449651 2:12986764-12986786 CCACAAACACTGGATCTATATGG - Intergenic
926544009 2:14216358-14216380 CCCCACACACTACAAGTCTAAGG - Intergenic
926783988 2:16502157-16502179 CCACATCCACTGGAAATATAAGG + Intergenic
931208790 2:60172815-60172837 CAACAAACAGACCAAGTATATGG - Intergenic
936659615 2:114528156-114528178 CCATACACACTGCAAGCACAGGG + Intronic
937811898 2:126208623-126208645 GCACAAACACTGAAAATATGTGG - Intergenic
938652121 2:133394242-133394264 CCACAAACACTTCAAGGGCAAGG - Intronic
940512571 2:154637195-154637217 TCACCAACACTGCAAGCAAAAGG - Intergenic
940749474 2:157609822-157609844 CCATATACACTGAAAGTAAAGGG - Intronic
940755642 2:157678968-157678990 CCCCAAACAGGGCAAGCATAAGG + Intergenic
940802914 2:158153359-158153381 CCACAAAGACTGCAATTCTTGGG + Intergenic
942740637 2:179173432-179173454 TCATAAACACTGGAAATATAGGG - Intronic
943075262 2:183186919-183186941 TCACAAAGACTGAAAGTAAAGGG - Intergenic
943582894 2:189705334-189705356 CCACACACACTGCCACTAAAAGG + Intronic
944592985 2:201235258-201235280 ACCGAAACACTGAAAGTATAAGG - Intronic
945592915 2:211756088-211756110 CCACACACACACCAAGAATAGGG - Intronic
946832723 2:223742518-223742540 CACCAAACAAAGCAAGTATAAGG - Intergenic
948736976 2:240015329-240015351 ACATATATACTGCAAGTATATGG - Intronic
1169039770 20:2483381-2483403 CCACATTCCCTGCAAATATAAGG + Exonic
1169039860 20:2484137-2484159 CCACAATCACTGCAAATGTAGGG + Exonic
1169574726 20:6945526-6945548 CCTGACACATTGCAAGTATATGG + Intergenic
1170305071 20:14929526-14929548 CCACAAAAACTCCAAATAAAGGG - Intronic
1170495683 20:16922599-16922621 ACACAAACAGTACAAGTAAAAGG + Intergenic
1170827602 20:19809835-19809857 CCACAACCACTACAAGAAGATGG + Intergenic
1175992118 20:62794717-62794739 CCACAATTACTGCAGGCATAGGG - Intergenic
1177569732 21:22871436-22871458 CCATAAAGACTGCAACTATTAGG - Intergenic
1177706916 21:24717907-24717929 CCACAAATATTAAAAGTATATGG - Intergenic
1177817635 21:25995028-25995050 CCAAATACACTGCAAGTAGATGG + Intronic
1178921479 21:36741703-36741725 TCACCAACACTGCAAGCACAAGG - Exonic
1185217683 22:49611476-49611498 CCACAAACACGCCAAGTGGAGGG - Intronic
950124050 3:10500857-10500879 TCAGAAACACTGCAAGTCTCAGG - Intronic
951579794 3:24150221-24150243 CCATACACATTGCAAGTATGGGG + Intronic
952676651 3:36039381-36039403 ACACATACACTGAAAGTAAAAGG - Intergenic
953370951 3:42387978-42388000 CAACAAACACTGCAACCACAAGG + Intergenic
953625939 3:44571178-44571200 CCACAATCATTGCATTTATAGGG - Exonic
953628894 3:44594506-44594528 CCACATTCACTGCATGTATAGGG - Exonic
956916021 3:73871763-73871785 CAAAAAACACTGTAAGAATAAGG + Intergenic
958435842 3:94094816-94094838 AAACAAACACTGAAAGTACATGG + Intronic
959488359 3:106955685-106955707 CCACTAACTCTGCAAGGAGATGG + Intergenic
960825926 3:121784529-121784551 ATACAAACATTGCAGGTATAAGG - Intronic
965918695 3:173884588-173884610 CCACACATACTGATAGTATATGG + Intronic
967514813 3:190354713-190354735 CCACAAAGCCTGAAACTATAAGG - Intronic
967754712 3:193156284-193156306 CCACAAACACTGCAAGTATAGGG + Intergenic
973803744 4:54503649-54503671 ATACAAAAACTGCAAGTAAAAGG + Intergenic
978633884 4:110780624-110780646 CCACCAACACTCCAAGTAGCTGG - Intergenic
980085995 4:128390550-128390572 CCAAAAACACTGAAAGCAGAAGG - Intergenic
980532284 4:134071072-134071094 CCACAAACACTTCAGCTATCAGG - Intergenic
983039533 4:162908864-162908886 ACACAAACACTGACTGTATATGG + Intergenic
984082010 4:175259074-175259096 CCACAAACACTCTAAGGCTAAGG + Intergenic
984124935 4:175796261-175796283 TCACAAACATTGGAAGTAAATGG + Intronic
985133249 4:186759984-186760006 CCACAAACACTGGAAGCGTTTGG - Intergenic
985192226 4:187387447-187387469 ACACACCCACTGCAAGTGTACGG - Intergenic
989843749 5:46113165-46113187 ACACACACATTGCATGTATACGG - Intergenic
996439456 5:123473169-123473191 TCACAAAGACTGAAAGTAAATGG - Intergenic
1003005645 6:2378555-2378577 CCATAAACACTGCAAGAAGAGGG - Intergenic
1005136473 6:22574387-22574409 ACACCATCAGTGCAAGTATAGGG - Intergenic
1005764240 6:28995236-28995258 CCACACTCACTGCAGGTGTATGG + Exonic
1009375347 6:62961481-62961503 ACACAAAGACTGCAATTATTAGG - Intergenic
1010540900 6:77090910-77090932 TGAGAAACACTTCAAGTATATGG + Intergenic
1014668425 6:124269797-124269819 CCACAGAGACTGCCAGTACATGG + Intronic
1016404174 6:143713172-143713194 CTACACACAATGCAAGGATATGG + Intronic
1020511465 7:9062000-9062022 CCACAGACACAGCAAATAAATGG - Intergenic
1020601439 7:10279383-10279405 CCAAAGACACTTCAAATATAGGG - Intergenic
1021109205 7:16674867-16674889 CCAAAAACACTGAAAGATTAGGG - Intronic
1023743118 7:43298582-43298604 CCTCACACACTGCAAGACTAGGG - Intronic
1024143101 7:46481583-46481605 CCCCAAACCCTGCAAGAACAGGG - Intergenic
1028626000 7:92877817-92877839 ACACATACACTGAAAGTAAAGGG + Intergenic
1029299916 7:99573243-99573265 CCACATTCACTACACGTATAGGG - Exonic
1033774865 7:144597836-144597858 CCACCAACAGTGTATGTATAAGG - Intronic
1039145087 8:34438277-34438299 TAACAATCACTGCAAGTAGAAGG + Intergenic
1043778914 8:84306969-84306991 CCACATCCACTCCAAGTAGAAGG - Intronic
1045593858 8:103630270-103630292 CCATAAAGACTGGAAGTAAATGG + Intronic
1046738081 8:117798875-117798897 CCCCAACCCCTGCAAGTATTGGG + Exonic
1049114483 8:140674251-140674273 CCACAAATCCTGCAAGCAGAAGG + Intronic
1049858728 8:144882500-144882522 CCACATACACTGCACACATAGGG + Exonic
1049865262 8:144931303-144931325 CCACAGACACTGCATCTGTACGG + Exonic
1049865278 8:144931471-144931493 CCACAGTCACTGCACTTATAGGG + Exonic
1049871090 8:144977182-144977204 CCACACACACTACAACCATAAGG + Intergenic
1050272870 9:3964764-3964786 CCAGAAACACTGAAAATAAAAGG - Intronic
1050277203 9:4012181-4012203 CTGCAAACAATGCAAGTATGGGG + Intronic
1050981886 9:12029623-12029645 CCACAAACAATGCAAATAAATGG + Intergenic
1051255754 9:15211506-15211528 CCATAATCACTGAAATTATATGG + Intronic
1051783822 9:20720702-20720724 CCACAAATTCTGAAACTATAGGG - Intronic
1053422308 9:37987335-37987357 CCACAGACACTGCCATTTTATGG + Intronic
1053599711 9:39598461-39598483 CAACAAACACTTCAAGAATCGGG + Intergenic
1054253816 9:62743925-62743947 CAACAAACACTTCAAGAATCGGG - Intergenic
1057156591 9:92846946-92846968 CCACAAATACTGCATTCATAGGG + Exonic
1058027595 9:100159154-100159176 CTACAAAGAATTCAAGTATAAGG + Intronic
1187205936 X:17181326-17181348 CCACAAACATTGCAAGAGTGTGG - Intergenic
1189977152 X:46473415-46473437 TCACAGACACTGCATTTATAGGG - Exonic
1190133926 X:47776990-47777012 CCACAGTCACTGCATTTATAAGG + Intergenic
1190360856 X:49646847-49646869 CCAGAAACTCTGCAAATATCAGG - Intergenic
1190406668 X:50094966-50094988 CAACAAATACAGCCAGTATAGGG + Exonic
1191083289 X:56537229-56537251 CAACAAACACTGCAATTGTGAGG + Intergenic
1192978086 X:76307322-76307344 CCACAAACACTGCAACTGCTTGG - Intergenic
1193297252 X:79847415-79847437 CCACAAACACTGCAACTCCTAGG - Intergenic
1193584994 X:83310822-83310844 CCACAAATACTGCAACTTTTAGG + Intergenic
1194175558 X:90642698-90642720 GCACAGACACTGGAAGTATCTGG - Intergenic
1194520588 X:94914358-94914380 CCACAAAGACTGCAAGTCCTAGG + Intergenic
1196253250 X:113486293-113486315 CCACAAAAACTGCAACTCTTAGG - Intergenic
1198365462 X:135935408-135935430 CAGCCAAGACTGCAAGTATATGG - Intergenic
1198409040 X:136347268-136347290 CCACCACCACTGAAAGTATATGG - Exonic
1198697331 X:139355523-139355545 CCACAAACACTGCAACTCCTAGG - Intergenic
1199521306 X:148739497-148739519 CCACATAAACTTCAAGTAAAGGG - Intronic
1200522205 Y:4223658-4223680 GCACAGACACTGGAAGTATCTGG - Intergenic
1202023266 Y:20491246-20491268 CCACAAGGACTGCAAGTCTTTGG + Intergenic